ID: 1101286321

View in Genome Browser
Species Human (GRCh38)
Location 12:103317006-103317028
Sequence GCCACTGTGGTGACTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101286321_1101286323 -7 Left 1101286321 12:103317006-103317028 CCAGCTCTAGTCACCACAGTGGC 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1101286323 12:103317022-103317044 CAGTGGCTTGCCCCCATCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 77
1101286321_1101286324 -4 Left 1101286321 12:103317006-103317028 CCAGCTCTAGTCACCACAGTGGC 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1101286324 12:103317025-103317047 TGGCTTGCCCCCATCAAAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101286321 Original CRISPR GCCACTGTGGTGACTAGAGC TGG (reversed) Intronic
900859404 1:5217448-5217470 GCCTCTGTGGAGAGCAGAGCAGG - Intergenic
902258688 1:15207556-15207578 GCCACTCTGATGTCTGGAGCTGG + Intronic
904288109 1:29466555-29466577 GTTTCTGTGGTGACTAGAGCAGG - Intergenic
905517483 1:38572421-38572443 GACAATGCGGTGACAAGAGCAGG - Intergenic
907914322 1:58854672-58854694 GCCACTGTGAAGACAGGAGCTGG - Intergenic
910718467 1:90258200-90258222 CCCTCTGTGGTGAATAGAGGCGG - Intergenic
911025842 1:93434904-93434926 CCCTCAGTGGAGACTAGAGCTGG + Intergenic
914906697 1:151752023-151752045 GCCACTGGGGAGACTAAGGCAGG + Intergenic
915207293 1:154279600-154279622 GCCACTGGGGAGGCTAGGGCAGG + Intergenic
915835795 1:159173476-159173498 GTCTCTGTGGTGACTAGGGCGGG - Intronic
917358416 1:174150555-174150577 GCTACTGTGGAGGCTACAGCAGG - Intergenic
917559885 1:176139378-176139400 GCCACTGTGGAGACCGGAGTTGG + Intronic
920787893 1:209060186-209060208 AGCACTGTGGAGACTGGAGCGGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922570563 1:226632320-226632342 GTCCCTGTGGTGACGAGGGCTGG + Exonic
923619675 1:235568212-235568234 GCAGGTGTGATGACTAGAGCGGG - Intronic
1063232515 10:4079379-4079401 GCAACTGTAGTGAATACAGCAGG - Intergenic
1064928414 10:20595713-20595735 GCTACTCTGGGGACTAAAGCAGG + Intergenic
1067842305 10:49690835-49690857 GCCTCTGTGCTGAGTAGAGGAGG + Intronic
1075764857 10:124885231-124885253 GCCACTGTGGAGGCTAAGGCAGG + Intergenic
1078440978 11:11367575-11367597 CCCACCGTGGTGTCCAGAGCAGG - Intronic
1078583703 11:12561198-12561220 GGCACTGTGGAGACCAGAACTGG - Intergenic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1081655548 11:44854679-44854701 GACACTGTGGGGACCAAAGCAGG + Intronic
1084320416 11:68370371-68370393 GGCCCTGTGGTGATTAGAGGAGG + Intronic
1084694494 11:70745537-70745559 GCCACTGTGGTGACTACCCTTGG + Intronic
1088231837 11:107681024-107681046 GCCACTGTGGAGCCAAGAGATGG - Intergenic
1089877992 11:121744518-121744540 ACCACTATGGTGGCTTGAGCTGG + Intergenic
1091396944 12:159305-159327 GCCACTGTCCAGACTGGAGCAGG - Intronic
1093917123 12:24816894-24816916 GCCACTGAGCTGACAAGAGGTGG + Intronic
1094013239 12:25831295-25831317 GCCACTCAGGAGACTACAGCAGG - Intergenic
1095758327 12:45796623-45796645 GCTACTCTGGAGACTAAAGCAGG - Intronic
1095925611 12:47576156-47576178 GCCTCTGTGGGGAGTAGTGCGGG + Intergenic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1097141689 12:56908079-56908101 GCCACTGTGCTGGCTACAGCGGG + Intergenic
1098151860 12:67555523-67555545 GCCACTGAGGAGGCTTGAGCAGG - Intergenic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1102965778 12:117124438-117124460 TCCAGTGTGGTCCCTAGAGCAGG + Intergenic
1102985200 12:117272355-117272377 TCCCCTGTGGTGACCAGAGAGGG + Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105547891 13:21365084-21365106 GGCCCTGGGGTGACTAAAGCAGG + Intergenic
1106415873 13:29545349-29545371 GCCACTGTGGGGACCAGCTCAGG + Intronic
1111635844 13:90902889-90902911 GAGACTGTGGTGACTAAGGCAGG + Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1117308532 14:54499356-54499378 GCTACTGTGGAGACTAAGGCAGG + Intergenic
1118988585 14:70777954-70777976 ACCACTGTGGTTACTAGAAAAGG + Intronic
1119239451 14:73046791-73046813 GCCAGTGTGGTGGCCAGAGGTGG + Intergenic
1122129024 14:99594436-99594458 CCCACTGTGGGGCCTAGAGATGG - Intronic
1124480481 15:30075004-30075026 GGCCCTGGGGTGACTAGGGCAGG - Intergenic
1127702126 15:61511897-61511919 ACCACTGTTGTCTCTAGAGCAGG - Intergenic
1127920402 15:63490009-63490031 GCAATTGTGGTGACAAGAGAAGG - Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1129705916 15:77794134-77794156 GCAACTGGGGTGACAAGGGCAGG - Intronic
1132211813 15:100029520-100029542 GCAGCTCTGGTGACTGGAGCTGG - Intronic
1132349776 15:101132584-101132606 GGCACTGTGGGGACTGGAGAGGG + Intergenic
1132357396 15:101182380-101182402 GCCACTGTGGTGAGCTCAGCTGG - Intronic
1133229021 16:4357727-4357749 CACACTGTGGTGTCTAGGGCAGG - Intronic
1133767766 16:8849711-8849733 GCCACTGTGGGAACTGGGGCAGG - Intergenic
1138491370 16:57378918-57378940 GGCCCGGTGGGGACTAGAGCAGG + Intronic
1141413421 16:83852041-83852063 ACCACTGTGGTGCCTTGGGCAGG + Intergenic
1144140860 17:12346828-12346850 GCTACTCTGGTGACTAAAGGAGG - Intergenic
1146639117 17:34526889-34526911 CCCACTGTGGGGAGGAGAGCAGG + Intergenic
1146988637 17:37246542-37246564 GCCACTCTGGTGTCTAAGGCGGG - Intronic
1149013274 17:51880094-51880116 GGCTCTGGGGTGATTAGAGCAGG - Intronic
1149797780 17:59536736-59536758 GTCACTGTAGAGAATAGAGCAGG - Intergenic
1150412440 17:64956570-64956592 GCCACTGTGTTGGCTGGAGAGGG + Intergenic
1150799455 17:68269053-68269075 GCCACTGTGTTGGCTGGAGAGGG - Exonic
1152232965 17:79124129-79124151 CCCAGTGTGGTCACTAGACCTGG - Intronic
1155489915 18:26390507-26390529 GCCACTGTGGTGACTTTGGTCGG + Exonic
1156277047 18:35593573-35593595 TCAACTGTGGTGACTGGAGATGG + Intronic
1158513675 18:58113537-58113559 GACACTGTGGTGGCTGGAGGGGG + Intronic
1159024442 18:63169632-63169654 GCTACTCGGGTGACTAGAGCAGG - Intronic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1161482163 19:4516675-4516697 GCCACTGTGGGGACAGGGGCCGG + Exonic
1162320713 19:9969561-9969583 GGCCCTGTGGTGAGTGGAGCGGG - Exonic
1163360251 19:16841441-16841463 GCCTCTGTGGTGCCAAGTGCTGG - Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1168428624 19:56259025-56259047 TCTTCTGTGCTGACTAGAGCTGG - Intronic
925192518 2:1896673-1896695 GACACTGTGGACACTAGAGAGGG + Intronic
925898860 2:8494429-8494451 GCCACAGTGGTGGCCAGAGAGGG - Intergenic
927638600 2:24833062-24833084 GCCACTGTGGTGGCCAGGCCAGG - Intronic
929892550 2:45930469-45930491 GGCACAGTGGTGACTGGAGAGGG - Intronic
930019991 2:46995774-46995796 GCATCTCTGGTGTCTAGAGCAGG - Intronic
931284341 2:60819811-60819833 GTCCCTGTGCCGACTAGAGCAGG + Intergenic
935100904 2:99995086-99995108 GGCACTTTGGTGGCTGGAGCAGG + Intronic
935158980 2:100512560-100512582 GCCACTGTGGCGGCTAGTGCAGG - Intergenic
937004641 2:118500503-118500525 ACAACTGTGGTAACTAGACCAGG + Intergenic
937187823 2:120061930-120061952 GCACCTGTGGAGAATAGAGCTGG + Intronic
937334110 2:121050404-121050426 GCCACTGCTGCGACTGGAGCAGG - Intergenic
937701247 2:124865514-124865536 GCCAGTGTAGTGCCTAGTGCTGG + Intronic
939309399 2:140454908-140454930 GCCACTGTAGTGACTCAGGCAGG + Intronic
941621472 2:167783940-167783962 GCCACTGTGGTCACTGCAGATGG - Intergenic
946731010 2:222709463-222709485 GCTACTGTGCTGACTGCAGCTGG - Intronic
946946442 2:224827310-224827332 CCCACTGTGATGATTAGAGATGG + Intronic
948190647 2:236055631-236055653 GCCACTGTCGTGGCTTGAGCAGG - Intronic
948992588 2:241562327-241562349 GCCTGTGTGGTCACAAGAGCAGG - Exonic
1169111819 20:3038945-3038967 GGCACAGGGGAGACTAGAGCTGG + Intronic
1171837259 20:30168468-30168490 GCCACGGTGGTGGCTGGACCCGG + Intergenic
1172385281 20:34529870-34529892 GACACTGTGGAGACAGGAGCAGG + Intronic
1174478993 20:50817787-50817809 GCCACTGTGTTTATTAGAGCAGG + Intronic
1176415387 21:6471715-6471737 GCCACTGCCGTGACTTGGGCAGG - Intergenic
1179443054 21:41409113-41409135 GCCACTCAGGTGGCTGGAGCAGG + Intronic
1179690887 21:43080048-43080070 GCCACTGCCGTGACTTGGGCAGG - Intergenic
1180990164 22:19930905-19930927 GCCACTGGGGTGACCCCAGCAGG + Intronic
1183060990 22:35336313-35336335 GCCAGTCAGGTGACCAGAGCTGG - Intronic
1183476981 22:38041149-38041171 GCCAGGCTGGTGACTAGTGCTGG + Intronic
1183597735 22:38822553-38822575 GCCACTTTGGGGACTTGAGGGGG - Exonic
950111598 3:10422162-10422184 GCCTCTCTGGGGACTAGAGATGG + Intronic
951041392 3:17992424-17992446 GCCCCTGTCCTGTCTAGAGCAGG + Intronic
952381887 3:32811779-32811801 GCCACTTTGGGGTCTTGAGCTGG + Intergenic
952743760 3:36759384-36759406 GCCACTGTAGTCACCAGTGCAGG - Intergenic
954426835 3:50447792-50447814 GGCTCTGTGGTGACTGGGGCAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955753210 3:62203446-62203468 GCCTCTGTGGTGGCTAGGACTGG - Exonic
960188586 3:114675201-114675223 TCCACTTTGATGACTACAGCTGG - Intronic
961521681 3:127470778-127470800 GGCCTTGTGGTGACAAGAGCTGG + Intergenic
961635548 3:128330591-128330613 GCCACAGGGGTGAGGAGAGCTGG + Intronic
961862526 3:129928040-129928062 GCCACTCTGGTAACTACGGCAGG + Intergenic
961986533 3:131140563-131140585 GCAGCAGTGGTGACTGGAGCAGG + Intronic
962479993 3:135789637-135789659 GCCAGTGTGGGAACTAGAGAAGG - Intergenic
967232281 3:187351252-187351274 GCCACTATGGGGACTTGTGCTGG - Intergenic
967953192 3:194856712-194856734 GCCCCTCTGGTGTTTAGAGCTGG - Intergenic
968954868 4:3713090-3713112 GCCACTGAGGCGATTAGAGTAGG + Intergenic
969185653 4:5472293-5472315 GCCACTGTGGGGACAGGAGGAGG + Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974363049 4:60907855-60907877 GACACAGTGGTGACTAAAGTTGG + Intergenic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
984235993 4:177159681-177159703 ACCACTGTGGACACTTGAGCTGG + Intergenic
985079501 4:186249986-186250008 GCAATGGTGGTGACTGGAGCTGG + Intronic
987359128 5:17090931-17090953 GCTACTGGGGTGACTAAGGCAGG + Intronic
988842496 5:35096730-35096752 GCTACTCTGGTGACTAAGGCAGG - Intronic
990484740 5:56247047-56247069 GACATTGTGGTGACTAGAACAGG + Intergenic
992088063 5:73295911-73295933 GCCACTGTGGTGCCAAGAAGTGG - Intergenic
992211985 5:74489288-74489310 CCAACTCTGGTGACTAGAGCAGG - Intergenic
994107330 5:95961757-95961779 GCCGCAGTGGAGGCTAGAGCCGG - Exonic
1000953472 5:167514081-167514103 GCCACTGAGTTGAAGAGAGCAGG - Intronic
1001123949 5:169002550-169002572 GCCATTGTGTAGTCTAGAGCAGG + Intronic
1003420817 6:5956948-5956970 GCCACAGTCGTGTTTAGAGCTGG - Intergenic
1003603132 6:7536642-7536664 GCTACTGGGGAGACTAGAGTGGG - Intergenic
1005451484 6:25977264-25977286 GCTACTGGGGAGACTAGGGCAGG + Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG + Intronic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1018800918 6:167221741-167221763 GCCACGGGGGTGACGTGAGCCGG - Intergenic
1019771547 7:2886625-2886647 GCCTGTGAGGTGACTGGAGCTGG + Intergenic
1023401030 7:39793112-39793134 GCCGCTGTGGGGGCGAGAGCTGG - Intergenic
1024648605 7:51387666-51387688 GCCGCTGTGGGGGCGAGAGCTGG + Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1029383180 7:100226562-100226584 GTCACCATGGTGACCAGAGCTGG - Intronic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1034393391 7:150802317-150802339 GGGGCTGTGGTGAGTAGAGCAGG + Exonic
1037470950 8:19210265-19210287 GGCACTGTGGAGACTAGGGCAGG + Intergenic
1041709657 8:60882214-60882236 GCTCCTGTGGTGATTACAGCTGG + Intergenic
1041938699 8:63363087-63363109 ACCATTGTGGAGAGTAGAGCTGG - Intergenic
1042145681 8:65727469-65727491 GCCAGTGTGGTGATGAGATCAGG - Intronic
1043198405 8:77330303-77330325 GCCACTGAAGTGAGTAGGGCTGG + Intergenic
1043866179 8:85378246-85378268 GGCCCTGTGGTGATTAGAGTGGG + Exonic
1044033541 8:87268523-87268545 GCCACTGTGGTGAGCAGTGTAGG - Intronic
1044405092 8:91817750-91817772 GCCACTCTGGAGGCTAGGGCAGG - Intergenic
1044890800 8:96833238-96833260 GCAACTGTGGTGTCTAGATTAGG + Intronic
1045013841 8:97981759-97981781 GCCACTCTGGGAACTAGGGCTGG - Intronic
1051249086 9:15141052-15141074 GCCAATGGAGTGACTTGAGCAGG - Intergenic
1057514344 9:95708779-95708801 GCCACGGTGGTGACTGGGGGCGG - Intergenic
1060221954 9:121768840-121768862 CCCACTCTGGGTACTAGAGCTGG + Intronic
1061660854 9:132129464-132129486 TCCACTGCTGTGGCTAGAGCTGG + Intergenic
1187372951 X:18725643-18725665 ACCACTGTGCTGACTAGGGAAGG + Intronic
1188045883 X:25426032-25426054 GCTACTGTGGTGGGTAGAGAAGG + Intergenic
1189193996 X:39136563-39136585 TCAACAGTGGTGACCAGAGCTGG + Intergenic
1190146693 X:47898198-47898220 GGCCCTGGGGTGATTAGAGCAGG + Intronic
1190236236 X:48617800-48617822 GCCACTGTGGGTCCTTGAGCAGG + Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic