ID: 1101287622

View in Genome Browser
Species Human (GRCh38)
Location 12:103331791-103331813
Sequence CTATTTAATTCCATGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101287622_1101287626 11 Left 1101287622 12:103331791-103331813 CCTAGATACATGGAATTAAATAG 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1101287626 12:103331825-103331847 ATCTATAGTCATTGCCCACAAGG 0: 1
1: 0
2: 2
3: 6
4: 113
1101287622_1101287630 24 Left 1101287622 12:103331791-103331813 CCTAGATACATGGAATTAAATAG 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1101287630 12:103331838-103331860 GCCCACAAGGGGGAAGACACAGG 0: 1
1: 0
2: 0
3: 14
4: 157
1101287622_1101287627 12 Left 1101287622 12:103331791-103331813 CCTAGATACATGGAATTAAATAG 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1101287627 12:103331826-103331848 TCTATAGTCATTGCCCACAAGGG 0: 1
1: 0
2: 0
3: 3
4: 136
1101287622_1101287628 13 Left 1101287622 12:103331791-103331813 CCTAGATACATGGAATTAAATAG 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1101287628 12:103331827-103331849 CTATAGTCATTGCCCACAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1101287622_1101287629 14 Left 1101287622 12:103331791-103331813 CCTAGATACATGGAATTAAATAG 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1101287629 12:103331828-103331850 TATAGTCATTGCCCACAAGGGGG 0: 1
1: 0
2: 0
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101287622 Original CRISPR CTATTTAATTCCATGTATCT AGG (reversed) Intronic
900692690 1:3991050-3991072 CTATTCCATTCCATTGATCTAGG + Intergenic
904119263 1:28185872-28185894 CTATTTAATTGCTTGTTTATAGG - Intronic
907170003 1:52453922-52453944 CTTGTTCATTGCATGTATCTGGG - Intronic
908827341 1:68146456-68146478 ATATCTGATTCCATATATCTAGG - Intronic
913071816 1:115305804-115305826 CTATTTAATTTTATGCATTTTGG + Intronic
913139507 1:115926640-115926662 CTAGTTAGTTGTATGTATCTGGG + Intergenic
916903943 1:169261304-169261326 CTATTTCTTTCCATGAAACTGGG + Intronic
918765612 1:188479377-188479399 TTATATAATTCCATATTTCTTGG + Intergenic
919224688 1:194681296-194681318 CAATTTACTTTCATGTACCTAGG - Intergenic
919340749 1:196303293-196303315 CAATTTAATACCAGGTATCTAGG - Intronic
920562036 1:206945777-206945799 CTATCTAATTCCAGGTCTGTTGG + Intronic
921440355 1:215178628-215178650 GTTTTTAATTCCATTTATGTGGG + Intronic
922040966 1:221896872-221896894 CTATATGATTCCATTTATATGGG + Intergenic
1064593599 10:16920630-16920652 TTATTTCATTCCATTGATCTTGG - Intronic
1066999776 10:42598682-42598704 CAGTGTAATTCCCTGTATCTCGG - Intronic
1068285479 10:54928596-54928618 CTACATAATTCCATATTTCTTGG + Intronic
1068865621 10:61892596-61892618 CTATATCAGTGCATGTATCTGGG - Intergenic
1069244979 10:66192946-66192968 CTATTTTATTCCCAGTATATAGG + Intronic
1069260632 10:66390671-66390693 CTTTTTAGTTTCATGTATGTTGG - Intronic
1069520491 10:69116109-69116131 ATATTTACTTCCATCTATCTAGG - Intergenic
1071076148 10:81755397-81755419 TTATTCATTTCCATGTTTCTTGG - Intergenic
1072150930 10:92682776-92682798 CTATTTAATTCAAAATCTCTCGG - Intergenic
1073520526 10:104124588-104124610 CTATTTAATTCAACCTATATGGG - Intronic
1073957187 10:108886672-108886694 CTACATAATTACATATATCTCGG - Intergenic
1074090069 10:110243332-110243354 CTTTTTCATTTCATGTCTCTTGG + Intronic
1074407933 10:113196007-113196029 CCATTTAATTGCATTTATATTGG + Intergenic
1074898061 10:117794057-117794079 CCATTTCATTCCATTTCTCTGGG - Intergenic
1079600687 11:22309825-22309847 TTATTTAATTCCACTTATCTTGG - Intergenic
1080462260 11:32465480-32465502 CTTTTTAATTCAATATATGTAGG + Intergenic
1080849442 11:36055508-36055530 CCATTTAATTCCATGGTGCTAGG + Intronic
1081250583 11:40827173-40827195 ATATTTAATTGAACGTATCTAGG + Intronic
1081250703 11:40829533-40829555 ATATTTAACTCCAAGTATTTTGG + Intronic
1081349505 11:42032812-42032834 CTGGTTTATTCCCTGTATCTTGG - Intergenic
1083004114 11:59325195-59325217 ATATTATATTCCATGTACCTTGG + Intergenic
1085233501 11:74993103-74993125 CTATTAAAGTCCAAGTTTCTAGG - Intronic
1086455080 11:86953304-86953326 ATTTTTAATTACATGTATCCTGG - Intronic
1086820907 11:91434586-91434608 CTATATAATTCCATTTATATGGG - Intergenic
1087324500 11:96704895-96704917 CTATTTAATTGTAAGTCTCTAGG + Intergenic
1087328855 11:96754763-96754785 CTACATAATCCCATGTTTCTTGG + Intergenic
1091662172 12:2392640-2392662 CTTTTTAAACCCAGGTATCTTGG - Intronic
1092326728 12:7540130-7540152 CTAAATTATTCCATGTATCCAGG - Intergenic
1093020596 12:14199914-14199936 ATATTTACTTCCATTTTTCTCGG - Intergenic
1097301739 12:58026451-58026473 CTATAAATTTCCATGTATGTTGG - Intergenic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1102627178 12:114244569-114244591 CTCTTAAATTCCATGCTTCTAGG - Intergenic
1102990451 12:117311898-117311920 CTTCTTCATTCCATGGATCTGGG + Intronic
1106677530 13:31976749-31976771 ATATTTCAGCCCATGTATCTGGG + Intergenic
1107406516 13:40119296-40119318 CTTTTTCATTGCATGTATATAGG - Intergenic
1109684054 13:65790291-65790313 CTAATTAATTCCCTTTATTTTGG + Intergenic
1111023787 13:82491393-82491415 TTATGTCATTCCAAGTATCTTGG - Intergenic
1111604663 13:90521437-90521459 GTACATAATTCCATGTTTCTTGG - Intergenic
1112819406 13:103313792-103313814 CTATTTTATTCAATATTTCTAGG - Intergenic
1112976569 13:105326769-105326791 CTGTTTCATTCCATGTATTCTGG + Intergenic
1113583972 13:111449988-111450010 CTAATTAATTCCATGAGTCCAGG + Intergenic
1114899728 14:27042401-27042423 CTATTAAATTCAGAGTATCTGGG + Intergenic
1115089982 14:29562938-29562960 CTATGTGATTCCATTTATATGGG + Intergenic
1115096390 14:29641567-29641589 GTATTCAATTCTATGTTTCTGGG + Intronic
1115118572 14:29911980-29912002 CTATTTAATTCCTTGGCTCATGG + Intronic
1115671980 14:35623657-35623679 ATATTTCATGCCATGTATATTGG - Intronic
1116246367 14:42418815-42418837 ATATTTAAAGCCATGAATCTGGG - Intergenic
1120055182 14:79916055-79916077 CTATTAATTTCCATGTTTCATGG - Intergenic
1120897505 14:89546906-89546928 CTTTGTAATTCCAGCTATCTGGG - Intronic
1122001547 14:98660515-98660537 CAGTTTAATTCCATGTATTCAGG + Intergenic
1122677532 14:103428303-103428325 CTTCTTAATGCCATATATCTTGG + Intronic
1123908585 15:24944406-24944428 TTATTTAATTTAAAGTATCTGGG + Intronic
1125933241 15:43614715-43614737 CTATCTAATTCCATTTTACTGGG + Intronic
1125946339 15:43714177-43714199 CTATCTAATTCCATTTTACTGGG + Intergenic
1126227516 15:46288808-46288830 TTACGTAATTCCATGTTTCTTGG + Intergenic
1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG + Intergenic
1126397330 15:48232834-48232856 CCAATTTATTCCATGTACCTTGG - Exonic
1126404707 15:48311916-48311938 CAATTTTGTTCCATGTATCCTGG + Intergenic
1126648081 15:50894895-50894917 CTCTTTGACTCCATGTATCCAGG - Intergenic
1126856020 15:52840246-52840268 CTATGTAATTCCATATGGCTGGG + Intergenic
1127664644 15:61133767-61133789 CTTTTTAGTTCCAGGAATCTGGG + Intronic
1128861880 15:71081039-71081061 ATATTTAACTCCATGTGGCTGGG + Intergenic
1128916683 15:71569243-71569265 CTATTTGATTTCATGTTTCAAGG + Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1130331841 15:82928358-82928380 ATATTTAATTGCATGGATGTAGG + Intronic
1131774302 15:95777378-95777400 CTATTTAATTCAAAGAATCTTGG + Intergenic
1132882915 16:2170316-2170338 CTATTCAATTCCATATACCCGGG - Intronic
1134582759 16:15385105-15385127 ATATTTTATTTCATGTATCTGGG - Intergenic
1134585833 16:15409964-15409986 GTATTTTATTTCATGTATCTGGG - Intronic
1135314084 16:21429173-21429195 ATATTTTATTTCATGTATCTGGG - Intronic
1135367009 16:21861451-21861473 ATATTTTATTTCATGTATCTGGG - Intronic
1135444807 16:22509709-22509731 ATATTTTATTTCATGTATCTGGG + Intronic
1136193531 16:28634251-28634273 ATATTTTATTTCATGTATCTGGG + Intergenic
1136310754 16:29407881-29407903 ATATTTTATTTCATGTATCGGGG - Intergenic
1136324196 16:29509659-29509681 ATATTTTATTTCATGTATCTGGG - Intergenic
1136438881 16:30249641-30249663 ATATTTTATTTCATGTATCTGGG - Intronic
1138882133 16:61029612-61029634 CTGTCTAATTCCCTTTATCTTGG + Intergenic
1139022301 16:62764562-62764584 TTCTTTTATTCCATGTATTTTGG + Intergenic
1139791253 16:69437843-69437865 TTATTTGATTCCATTTATATGGG - Intronic
1139858431 16:70000257-70000279 ATATTTTATTTCATGTATCTGGG - Intergenic
1144450289 17:15371688-15371710 CTATTAAATACCCTGTTTCTTGG + Intergenic
1150963985 17:69946941-69946963 CTATTTTATAACATCTATCTAGG + Intergenic
1151837789 17:76595028-76595050 ATATATAGTTCCATGTATTTGGG + Intergenic
1152760607 17:82105371-82105393 CTAGTTATTTCCAAGTCTCTTGG + Intronic
1153364434 18:4238337-4238359 CTTTTTTATTCTATGTATCAGGG - Intronic
1153454332 18:5263169-5263191 TTATATAATCCCATGTTTCTCGG - Intergenic
1154119881 18:11643547-11643569 ATATTTTATTTCATGTATCTGGG - Intergenic
1156067152 18:33157299-33157321 CAATGTAATTGCTTGTATCTAGG - Intronic
1156193472 18:34746529-34746551 TTATTCAATACGATGTATCTTGG - Intronic
1156365472 18:36422339-36422361 ATATTCAGTTCCATGTATATAGG + Intronic
1157164388 18:45344870-45344892 CAGTTTAATTCCAAATATCTGGG - Intronic
1157164980 18:45350506-45350528 CAGTTTAATTCCAAATATCTGGG + Intronic
1159522276 18:69541516-69541538 GTATATAATTGCATGTATCTAGG + Intronic
1159905902 18:74092037-74092059 CTCTTTAATCCCATATTTCTTGG + Intronic
1159950721 18:74480758-74480780 TAATTTATTTCCATGTATTTTGG - Intergenic
1161092996 19:2372160-2372182 CTTTTTTCTTCCCTGTATCTTGG + Intergenic
1162376644 19:10309143-10309165 CCATGCAATTCCATGTCTCTGGG - Exonic
1164787945 19:30951110-30951132 CTATTTATTCCTAGGTATCTAGG + Intergenic
1164963082 19:32453202-32453224 TTTTTTAATTCCATGATTCTTGG + Exonic
1166627124 19:44367944-44367966 CTACTTTATTCCATGTGTTTTGG + Intronic
925083378 2:1088156-1088178 CTATTAAATTACTTGTATTTTGG - Intronic
925560735 2:5191513-5191535 CTATTAAATTTTATGTATCATGG + Intergenic
928737144 2:34305050-34305072 GTATTTAATTCTAAATATCTTGG - Intergenic
928815498 2:35290632-35290654 TTATGTAATTCCATATTTCTTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930514039 2:52382776-52382798 CTATTTAATTCTTTGTGACTTGG - Intergenic
931087814 2:58852915-58852937 TTTTTTAATTTCATGTATTTAGG - Intergenic
932553064 2:72791986-72792008 CCATTTTATTCCAGGCATCTAGG - Intronic
933345090 2:81074276-81074298 ATATTTTATTCCCTGTCTCTAGG - Intergenic
935437291 2:103048455-103048477 CTATATAATTCCACTTATGTGGG + Intergenic
936671312 2:114660152-114660174 CTATTTCCTTCCCTGTTTCTTGG - Intronic
937923331 2:127147459-127147481 CTCTTTAATTCCAAGGGTCTGGG + Intergenic
939015235 2:136895434-136895456 CTTTTTAATACCATGTAAATGGG + Intronic
940038497 2:149334138-149334160 CTTTTTCATTACATGTATCCAGG - Intronic
940839518 2:158563282-158563304 GTATTTAATTCCCTCTACCTTGG - Intronic
941224103 2:162823652-162823674 CTTTTTTAGTCCATGTTTCTTGG + Intronic
942526982 2:176863567-176863589 CTATTCCATTCCATTGATCTAGG + Intergenic
942618586 2:177822429-177822451 CTATTCTATTCCATTGATCTAGG + Intronic
943491862 2:188563600-188563622 ATATTTAATTCCAAATATGTGGG - Intronic
943850136 2:192709097-192709119 TTATTTATTTTCATGTTTCTTGG - Intergenic
945680101 2:212903551-212903573 CTACTTAATTCCATGCTTCCTGG - Intergenic
946468924 2:219938482-219938504 CTATTTAATCCCATGCAACAGGG - Intergenic
947022028 2:225689373-225689395 CTATTTATTTTTATGTATCTGGG - Intergenic
1170913271 20:20596465-20596487 CAATTTAAATCCAAGTATGTAGG - Intronic
1176677685 21:9794982-9795004 GATTTTAATTCCATGTATATTGG + Intergenic
1177655141 21:24007364-24007386 CCATTAAATTCCATGTATTTAGG + Intergenic
1178632143 21:34271155-34271177 CTATTTAGTGCCATGTAAATTGG - Intergenic
1179614256 21:42571585-42571607 CTACGTATTTCCATGTTTCTTGG + Intronic
1181839432 22:25643663-25643685 CTATTTAATTTTGTTTATCTAGG + Intronic
1182950442 22:34370308-34370330 TTATGTAATTCCATCTTTCTTGG - Intergenic
949165787 3:939232-939254 CTATCTAATCCCATATATCTTGG - Intergenic
950983679 3:17336634-17336656 ATATTTAATTCCAGGTTGCTGGG - Intronic
952636668 3:35541391-35541413 CTATTTATTTCCCTGGATGTAGG + Intergenic
954580331 3:51699753-51699775 CTATGTAGATCCATGTGTCTGGG - Intronic
955153741 3:56395083-56395105 CTATTTAATTTCATATAAATAGG - Intronic
955445481 3:59005888-59005910 TCATCTAATTCTATGTATCTAGG - Intronic
955829130 3:62982815-62982837 TTGTTTAATTCCAAGTATTTAGG + Intergenic
955880081 3:63534039-63534061 CTATTTAAATACAAGTTTCTAGG - Intronic
955987103 3:64584982-64585004 CTCTTTACTTCCATATTTCTGGG + Intronic
956065122 3:65389821-65389843 CTATTTAATTCCATGCATTGTGG + Intronic
958690098 3:97454340-97454362 TTATTTGATTACATGTATATTGG - Intronic
958911993 3:100004576-100004598 TTTCTTAATTCCTTGTATCTTGG - Intronic
959230087 3:103637691-103637713 ATATTTTATTCCATGTATTTGGG - Intergenic
959616985 3:108359564-108359586 TTATTTAATTCCATTCAGCTTGG - Intronic
959751218 3:109837714-109837736 CTATTTAATACCAGGTATTGGGG + Intergenic
960012727 3:112850768-112850790 CTACATAATCCCATGTTTCTTGG - Intergenic
960405911 3:117259370-117259392 CTCTTCAATTCAATGTATTTAGG + Intergenic
963427012 3:145143067-145143089 CTATTTTCTTCCATGTATAATGG + Intergenic
963463525 3:145647839-145647861 ATAGTTAATTACATGTTTCTTGG - Intergenic
964372535 3:156016003-156016025 CAATTTAAATACATGTAACTAGG + Intergenic
964846566 3:161050352-161050374 CTTTTTACTTTCATGTTTCTTGG - Intronic
966062850 3:175780729-175780751 CTATTCAACTCCATGTAGCAAGG - Intronic
968886569 4:3337615-3337637 CTATCTAATTCCACTTATGTGGG + Intronic
970031397 4:11679392-11679414 TTATTTGATTCCTTGTAACTTGG - Intergenic
970335166 4:15030881-15030903 CTATTTTATTACCTGTATCTTGG + Intronic
970745810 4:19293990-19294012 TTATATAATTCCATACATCTTGG + Intergenic
971381287 4:26100542-26100564 CAATTTAATTCTAATTATCTAGG - Intergenic
973162444 4:47034725-47034747 CTCTTTATTTCCATTTTTCTTGG - Intronic
973224520 4:47767661-47767683 CTATTTAAATCTATATATCTTGG - Intronic
974408357 4:61506109-61506131 CTCTTTAAGGCCATATATCTTGG - Intronic
974613293 4:64245124-64245146 CAATTGAATTCCATTTAACTTGG - Intergenic
974942679 4:68488317-68488339 TTATATAATTCCATATTTCTTGG + Intronic
975041226 4:69746363-69746385 CTATATAATCCCATATTTCTTGG + Intronic
975320094 4:73000331-73000353 CCATTAAATTCCCTGCATCTGGG - Intergenic
975935264 4:79572132-79572154 CTATATCATCCCATTTATCTTGG - Intergenic
976242793 4:82975893-82975915 CTATTTATTTCCATAAAACTTGG - Intronic
977604567 4:98970034-98970056 CTATTTAATCAAATGTCTCTTGG - Intergenic
977682738 4:99813607-99813629 CTATTTGATGCCATGAAGCTTGG - Intergenic
977861095 4:101960911-101960933 CTAGTTAATTCCTTCCATCTTGG - Intronic
979861307 4:125697036-125697058 CTATTTGAATTCATGTTTCTTGG - Intergenic
980525384 4:133984917-133984939 CTATTAAATTCCCTGTTCCTGGG - Intergenic
980631450 4:135440581-135440603 CTATTTTATTACATGTTTTTTGG - Intergenic
980748141 4:137048595-137048617 TTTATTAATTCCATGTATTTGGG - Intergenic
981778756 4:148400925-148400947 CAATATAATTCTATGTATTTAGG - Intronic
982098479 4:151945647-151945669 CTACTTGAGTCCATGTCTCTTGG + Intergenic
984046591 4:174807825-174807847 GTATTTGATTCCATGTATTATGG - Intronic
984241050 4:177219625-177219647 CAATTTAATTTCATGTCACTGGG - Intergenic
984271647 4:177555423-177555445 CTATGTATCTCCATTTATCTAGG + Intergenic
984622553 4:181970794-181970816 TTGTTTCATACCATGTATCTGGG + Intergenic
984692355 4:182741426-182741448 ATATTTATTTCCATGTTTCAGGG - Intronic
985397847 4:189563786-189563808 GATTTTAATTCCATGTATATTGG - Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
987795449 5:22622454-22622476 TTTTTTTATTGCATGTATCTGGG - Intronic
989795012 5:45458077-45458099 CTATTTCATTCCATAAATGTAGG - Intronic
991324728 5:65418023-65418045 CTATTCTATTCCATTGATCTAGG - Intronic
992371635 5:76149937-76149959 CCATTTAATTTCATGCAGCTAGG - Intronic
993201626 5:84823485-84823507 CTATCTAGTTCCATTTCTCTTGG + Intergenic
993309991 5:86317088-86317110 CTTATTAATACCATTTATCTGGG - Intergenic
994860849 5:105191417-105191439 CTATACCATTCCATGTATCATGG - Intergenic
995925081 5:117362727-117362749 TTATTTAAATTCATGTATTTTGG + Intergenic
996739183 5:126783659-126783681 CTGTTTACTTCCTTGAATCTGGG - Intronic
997031713 5:130137605-130137627 TTATTTATTAACATGTATCTAGG + Intronic
997170425 5:131713696-131713718 CTGTTTAATTGCATGTATATTGG - Intronic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1004036266 6:11927155-11927177 ATACTCATTTCCATGTATCTGGG + Intergenic
1004479301 6:16003660-16003682 CTATCTAAGTCCTTTTATCTGGG - Intergenic
1004889447 6:20085641-20085663 CTATTGAATCCCCTGTTTCTTGG - Intergenic
1005511971 6:26519467-26519489 CCATTTTATTTCATGTTTCTTGG + Intergenic
1005535465 6:26751077-26751099 CTATTCTATTCCATCAATCTGGG + Intergenic
1005579979 6:27224541-27224563 TTTTTTAATTTCATGTATCCTGG + Intergenic
1006060660 6:31416250-31416272 CTGTTTTATTTCATGTGTCTGGG + Intergenic
1006555701 6:34864368-34864390 GGGTTTAATTCCATGTTTCTAGG + Intronic
1009006502 6:57794707-57794729 CTATTCTATTCCATCAATCTGGG + Intergenic
1009817677 6:68756725-68756747 CTATTTAATTCCAAAACTCTTGG + Intronic
1010495570 6:76531063-76531085 CTACATAATCCCATGTTTCTTGG + Intergenic
1010706139 6:79113108-79113130 ATATTTACTTACATTTATCTAGG - Intergenic
1010976237 6:82317114-82317136 GTTTTTAATTCCATGTATTGTGG - Intergenic
1012645008 6:101667597-101667619 CTATTTATTTGAATGTATCATGG + Intronic
1013328847 6:109077372-109077394 CTATTTAAGTTCATCTTTCTGGG + Intronic
1013718818 6:112998014-112998036 CTATTTCATGCCAAGTATTTTGG - Intergenic
1014528638 6:122532598-122532620 CTATTTGAATCCATCTATATGGG - Intronic
1014588580 6:123232414-123232436 CAGTTTAATTCCATGCAGCTTGG - Intronic
1015397582 6:132752525-132752547 CTATTGAATTCCATTCAGCTTGG - Exonic
1015572684 6:134637662-134637684 GCATTTAATTCCATATACCTAGG + Intergenic
1015574225 6:134653811-134653833 CTATTTGCTTACATGTATATTGG + Intergenic
1015658825 6:135549927-135549949 CTATTTAATTCTTTCTATGTAGG - Intergenic
1016112534 6:140242945-140242967 CTATTGAATTCCTTTTATTTGGG - Intergenic
1017555810 6:155566695-155566717 TAATTTAATTCCATGTGTCCAGG + Intergenic
1018325536 6:162663779-162663801 CTTTTTAGTTTCATGTAACTTGG - Intronic
1018577525 6:165275148-165275170 CGTTTTAATTCTATGTAGCTTGG - Intergenic
1021124802 7:16839118-16839140 CTATTTAAGTCCATCCATCCTGG + Intergenic
1021361206 7:19714777-19714799 CTATTTAATGTCAAGAATCTTGG - Intergenic
1022098550 7:27155882-27155904 TTATTTAACTCCATTTGTCTTGG - Intronic
1026184097 7:68068162-68068184 CCATTTTGTTCCATGTCTCTTGG + Intergenic
1028041155 7:86056829-86056851 TTATGTAATTCCATATTTCTTGG + Intergenic
1028263172 7:88688076-88688098 CAATTTAATTCCATGTACTATGG + Intergenic
1028669937 7:93390270-93390292 CAGTTTAATTCCATTTATATAGG + Intergenic
1028909048 7:96187466-96187488 CTATTGATTTCCATCTATATAGG - Intronic
1029024269 7:97398942-97398964 CTATTTTTTTCCACGTATGTTGG + Intergenic
1031620371 7:123927888-123927910 CTTTTTAATTCCATTACTCTGGG - Intronic
1032572410 7:133014178-133014200 CTTTTAAATTCCTTGTTTCTTGG - Intronic
1032672867 7:134100999-134101021 ATATTTACTTCTATCTATCTTGG + Intergenic
1032925638 7:136601742-136601764 ATATTTTATTCCATTTATTTTGG - Intergenic
1033381884 7:140829118-140829140 CTATTTACTTCTTGGTATCTGGG + Intronic
1033967758 7:146998309-146998331 CTTTTTATTTCCATTTATTTGGG + Intronic
1037242678 8:16795165-16795187 CTATATACCTCCATGTATGTTGG - Intergenic
1041468828 8:58186068-58186090 CTATTAGATTCCATTGATCTAGG - Intronic
1043285031 8:78517247-78517269 ATATTTCATTCCATGCATTTGGG - Intronic
1043637342 8:82402698-82402720 ATATTTAATTCCTTGACTCTGGG - Intergenic
1044369909 8:91398108-91398130 CGATTTATTTCCATGTAAATTGG - Intronic
1044473875 8:92604062-92604084 CTATTTAATCCCATAAAACTTGG - Intergenic
1044653119 8:94519814-94519836 ATATTTAAATTCATGTATCTAGG + Intronic
1044829043 8:96227622-96227644 CTTTTTAATTCCAAGTAGTTTGG + Intronic
1046233279 8:111386467-111386489 TTATTTAACCCCATGTTTCTTGG + Intergenic
1050847911 9:10246541-10246563 CTATTTTAAAACATGTATCTTGG - Intronic
1054943412 9:70768885-70768907 CTTTTTAGGTCCATGTATTTTGG + Intronic
1055386562 9:75769344-75769366 CTGTTTTATTCCAATTATCTGGG + Intergenic
1055612637 9:78038678-78038700 CCAATTAAATCCAAGTATCTGGG - Intergenic
1056326992 9:85488317-85488339 CTGTTTAATCCCATGCTTCTGGG + Intergenic
1056462630 9:86823055-86823077 CTCTTTAATTCCATGTCTCCTGG - Intergenic
1057615957 9:96590217-96590239 CTGCTTGATTCCATGTATATAGG - Intronic
1058865086 9:109154582-109154604 CAATTTAATTCTGTGTACCTAGG - Intronic
1059567126 9:115394017-115394039 TTATTTGAATCCATGTCTCTAGG - Intronic
1059633549 9:116151271-116151293 CTATTTGTTTCCATCTGTCTTGG - Intergenic
1060035782 9:120254446-120254468 CTAATTCATTCTATGCATCTAGG + Intergenic
1060167594 9:121431693-121431715 ATATTATATTCCATTTATCTTGG - Intergenic
1060857002 9:126922373-126922395 GTATTTAAGTCCATGTTTATTGG + Intronic
1185802764 X:3028553-3028575 CGATTTAATTCCATGTATGTGGG + Intronic
1186536443 X:10354892-10354914 CTAATTAATTCAGTGCATCTGGG + Intergenic
1187668435 X:21642457-21642479 TTATTTAATACTATGTAACTGGG + Intronic
1189393491 X:40598753-40598775 TTTTTTAATTCCATTTATTTTGG + Intronic
1189676973 X:43471343-43471365 CTATGTAATTCAATGTTTTTAGG - Intergenic
1190835541 X:54097623-54097645 CTTTTTAATTTTATGTATTTTGG + Intronic
1192558833 X:72111377-72111399 CTCTTTAATTCCAGGAATTTGGG - Intergenic
1193960254 X:87915867-87915889 CTATGTAATCCCATATTTCTTGG - Intergenic
1194151782 X:90334211-90334233 CTATTTCATTCAATGTTACTAGG - Intergenic
1196432400 X:115641077-115641099 CTATTTAGTCCCAAGTTTCTAGG + Intronic
1196642247 X:118075645-118075667 CTCTTTTATTCCATGTCACTGGG - Intronic
1196959695 X:120988119-120988141 GTATATAACTCCATGTAGCTAGG - Intergenic
1197033640 X:121848929-121848951 CTCTATTATTCCATGTATATTGG + Intergenic
1197126442 X:122951868-122951890 CTAGTTAATTTTATGTATCTAGG + Intergenic
1197170926 X:123433209-123433231 TGTTTTAATTCCATGTATATAGG + Intronic
1197317315 X:124983393-124983415 TTACTTAATTCCATATATCTTGG + Intergenic
1197498054 X:127210067-127210089 CCATTTATTTCAATGTATCATGG + Intergenic
1197729768 X:129799462-129799484 CTATAGAATTCCATTTATTTAGG - Intergenic
1197890061 X:131261266-131261288 TTTTTTCATTCAATGTATCTAGG - Intergenic
1200498142 Y:3910977-3910999 CTATTTCATTCAATGTTACTAGG - Intergenic
1201509341 Y:14740832-14740854 CAAATTAATCCCATGTTTCTTGG + Intronic