ID: 1101289340

View in Genome Browser
Species Human (GRCh38)
Location 12:103351935-103351957
Sequence AAAGAGAGGAAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3126
Summary {0: 1, 1: 0, 2: 27, 3: 312, 4: 2786}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101289340 Original CRISPR AAAGAGAGGAAGAGGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr