ID: 1101289899

View in Genome Browser
Species Human (GRCh38)
Location 12:103357496-103357518
Sequence CCTTGCCTGCAGCAGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101289899_1101289902 0 Left 1101289899 12:103357496-103357518 CCATCTGTCTGCTGCAGGCAAGG 0: 1
1: 0
2: 3
3: 13
4: 307
Right 1101289902 12:103357519-103357541 TCCCAGTTGCTCAGCCATTTGGG 0: 1
1: 0
2: 0
3: 21
4: 213
1101289899_1101289901 -1 Left 1101289899 12:103357496-103357518 CCATCTGTCTGCTGCAGGCAAGG 0: 1
1: 0
2: 3
3: 13
4: 307
Right 1101289901 12:103357518-103357540 GTCCCAGTTGCTCAGCCATTTGG 0: 1
1: 1
2: 2
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101289899 Original CRISPR CCTTGCCTGCAGCAGACAGA TGG (reversed) Intronic
900206373 1:1433537-1433559 CTGTGCCTGCAGGAGGCAGAGGG + Intergenic
900602993 1:3511163-3511185 CCTTGTCCACAGCAGACAGGCGG - Intronic
900752383 1:4406836-4406858 CCCTGCTTGCAGCTCACAGAAGG - Intergenic
900783960 1:4636095-4636117 CCTCGCCTGCAGGACAAAGAGGG + Intergenic
901550271 1:9990823-9990845 CTTTGCCAGCACCAAACAGAAGG + Intergenic
902410379 1:16208411-16208433 GCCTGGCTGCAGTAGACAGAGGG + Intronic
902618240 1:17635468-17635490 GCATGGCTGCAGCAGAGAGAAGG - Intronic
903964011 1:27074721-27074743 GCTGGCCTGGAGCAGTCAGAGGG + Intergenic
904286471 1:29455902-29455924 CCTTGCCTGGAGCTGAGGGAAGG + Intergenic
904490483 1:30855829-30855851 CCTTGACTGCTGGAGAGAGAGGG + Intergenic
904931228 1:34088939-34088961 CCTTCCCTGTAGCAAACAGCTGG - Intronic
905003696 1:34693784-34693806 CCTAGCCTGGAGCAGAGACAAGG + Intergenic
905205172 1:36339313-36339335 CCTTGCATGCAGGAGGCAGCGGG - Intergenic
906030707 1:42717947-42717969 CCTCGCCTGCTGCAGTCTGAGGG - Intergenic
906157959 1:43625230-43625252 CCTTGCGAGCAGCCGGCAGAAGG + Intergenic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
907533432 1:55125662-55125684 CCTTGCAAGCTGTAGACAGATGG + Exonic
910791391 1:91054745-91054767 CCTTACAGGCAGCAGCCAGATGG + Intergenic
911295126 1:96105917-96105939 ACTTGCCTCCAGCAGTCAAAAGG + Intergenic
912569365 1:110610162-110610184 CCCTGCCTTCAGCAGAGGGAAGG + Intronic
913231145 1:116741704-116741726 CCTTGGCTGCCTCAGACAGTCGG + Intergenic
914397104 1:147280147-147280169 CCTTGCCTGCAGCAGAAGGAGGG + Exonic
914703431 1:150153001-150153023 CCTTCCCAGCAGGAGACAGCTGG - Intronic
915735714 1:158083654-158083676 TCTGCCCTGGAGCAGACAGATGG - Intronic
915803495 1:158819304-158819326 CTTTGCCTGAACCACACAGAAGG + Intergenic
916181413 1:162087072-162087094 TATTTTCTGCAGCAGACAGAGGG + Intronic
916683065 1:167121683-167121705 CCTTCCCTGCAGCATACCCAAGG + Intronic
917444927 1:175099179-175099201 CCCTGCCTGGAGCAGGCAGCTGG - Intronic
918221778 1:182442012-182442034 TCTTACCTGCAGGACACAGAAGG + Intergenic
918388576 1:184036313-184036335 CCCTCCCCGCAGCAGACACAGGG + Intronic
918983812 1:191596777-191596799 CCATGCCTGCAGCAGAGACTTGG + Intergenic
920712223 1:208306217-208306239 ACTTGCCTGGAGCAGAGTGAGGG + Intergenic
921348809 1:214214472-214214494 CCTTTCCTGCAGTAGAAAAAGGG - Intergenic
922070178 1:222184416-222184438 CTTTGCCTTCAGCAGAAGGAAGG + Intergenic
1064716288 10:18180251-18180273 GCTTCTCTGCAACAGACAGAGGG + Intronic
1067236892 10:44458745-44458767 CCCTGGCTGCAGGAGACAGCAGG - Intergenic
1069545681 10:69326391-69326413 CCTTGTGTGTTGCAGACAGAAGG + Intronic
1069956238 10:72053726-72053748 CCTATCCTGCAGCAGTTAGAGGG - Intergenic
1070535313 10:77372774-77372796 CCCTGCATGCAGCAGAGAGATGG + Intronic
1072648055 10:97274894-97274916 GGTGGCCTGCAGGAGACAGAGGG + Intronic
1072705118 10:97675507-97675529 CCTTGACTGTAGGAGCCAGAAGG + Exonic
1072756240 10:98023108-98023130 GCTTCCCTGCAGCAGCCAGGTGG + Intronic
1072764260 10:98083182-98083204 TCTTGCCTGGAGGAGACAGGGGG + Intergenic
1072922245 10:99585969-99585991 CCTTCCCTGCAGCATGCTGATGG + Intergenic
1074491290 10:113941763-113941785 CCTGGCCTGCAGAAGCCAGGGGG + Intergenic
1074736229 10:116436694-116436716 CTTTTCCTGCAGCAGAAAGGTGG - Exonic
1074860321 10:117505079-117505101 CCGTGCCTACAGCAGACAGATGG + Intergenic
1075175687 10:120158646-120158668 CCTCTCTTGCAGCTGACAGATGG - Intergenic
1075939725 10:126380150-126380172 CCTTGCCTCCAGTTGATAGATGG - Intronic
1077257357 11:1592797-1592819 GCTTACCTGCAGCATACAGCGGG + Intergenic
1077375459 11:2203457-2203479 ACCCGCCTGCAGCTGACAGAGGG - Intergenic
1077553714 11:3215860-3215882 CCTGTCCTGCTGCACACAGATGG + Intergenic
1078092837 11:8278008-8278030 CCCTGCCTGCAGCATGGAGAAGG - Intergenic
1078436590 11:11330562-11330584 CCATCCCTGCAGCTGGCAGAGGG - Intronic
1078542758 11:12224705-12224727 TGGTGCCAGCAGCAGACAGAGGG + Exonic
1079665735 11:23103285-23103307 CAATGCCTGCAGCAGATACATGG + Intergenic
1080362760 11:31535007-31535029 CATTGCTTACAGCTGACAGATGG - Intronic
1080775395 11:35381466-35381488 CTTTGGATACAGCAGACAGAGGG - Intronic
1083281341 11:61629023-61629045 CCTTACCTGGAGCAGAAACAAGG - Intergenic
1084183343 11:67457429-67457451 CCACGCCTGCAGCAGATAGGAGG - Intronic
1084492026 11:69484097-69484119 CCTTCCCTGGAGCTGACACAGGG - Intergenic
1086955907 11:92934360-92934382 CTTTGCCTGCAGCTTAGAGAAGG + Intergenic
1089626783 11:119755926-119755948 CATGGCCTGAAACAGACAGAGGG - Intergenic
1089699756 11:120237490-120237512 CCTAGGCTGCTGGAGACAGAAGG + Intronic
1090278919 11:125439593-125439615 CTCTGCCTTCTGCAGACAGAGGG + Intergenic
1090523813 11:127507072-127507094 CCTTGCTTTCAGAAGCCAGAGGG - Intergenic
1091307470 11:134545796-134545818 CCATGCTTGCAGCAGAGGGAGGG + Intergenic
1091521817 12:1253192-1253214 CTTTTTCTGCAGCAGAAAGAAGG - Intronic
1092090830 12:5802452-5802474 CCTCCCCTGCAGGTGACAGAAGG - Intronic
1092140893 12:6182678-6182700 CGTGGCCTGGAGCAGAGAGAAGG + Intergenic
1093771386 12:23022302-23022324 CCTTGCCTACAGCAAAGAGGAGG - Intergenic
1093881041 12:24405037-24405059 CTTCGCCTGCAGCCGTCAGAAGG + Intergenic
1096185957 12:49580700-49580722 CCTTTCCTGCAGAAGCCACAAGG - Intronic
1096629203 12:52914847-52914869 CCCTTCCTGCAGCAGGGAGATGG - Intronic
1096678901 12:53241983-53242005 CCATGCCTGGAGCAGGCAGGAGG - Intergenic
1098206792 12:68119069-68119091 TCTTGCCTGCTGGAGAAAGAAGG + Intergenic
1098702286 12:73644839-73644861 AGGTGCCTGCAGAAGACAGAAGG - Intergenic
1100682809 12:96947636-96947658 CCTTTCCTTCAGCAGACCCAGGG + Intronic
1101289899 12:103357496-103357518 CCTTGCCTGCAGCAGACAGATGG - Intronic
1101823938 12:108206056-108206078 GCTTGGCTGCAGCCCACAGAAGG + Intronic
1102528458 12:113528805-113528827 CCTTTCCTGCTGGAGAGAGAGGG - Intergenic
1102780155 12:115557278-115557300 CACTTCCTGCAGCTGACAGAAGG + Intergenic
1102976855 12:117213052-117213074 CCTTTCTAGTAGCAGACAGATGG - Exonic
1103928102 12:124434737-124434759 CCTTCCTCGCAGGAGACAGAGGG + Intronic
1108160257 13:47631837-47631859 ACATGCCTGCAGCAGACTAAGGG - Intergenic
1109794325 13:67289737-67289759 CCATGCCAGCAGAAGACAGGAGG - Intergenic
1111973233 13:94939146-94939168 CCTTCCCTGGGGGAGACAGAGGG - Intergenic
1113292913 13:108925725-108925747 CCTGTACTGCAGCAGAGAGATGG - Intronic
1115496903 14:34013897-34013919 GCTTTCCTGCATCAGACAAAAGG - Intronic
1116569333 14:46495725-46495747 CCTTGCCTGAGGGAGACAGCAGG - Intergenic
1118818757 14:69331157-69331179 CCTTGACTGCTGCAGGCTGAAGG - Intronic
1122101288 14:99412345-99412367 CCTTGACTGCAGGAGTCAGCTGG - Intronic
1122355486 14:101120751-101120773 CTTTGCCAGCTGCACACAGAGGG - Intergenic
1122938382 14:104970315-104970337 CCCGACCTGCAGCTGACAGACGG - Intronic
1123105500 14:105839403-105839425 CCCTGCCTGCCTCACACAGATGG - Intergenic
1126787899 15:52193402-52193424 CCATGCCTGCTGGGGACAGAAGG - Exonic
1127721259 15:61702380-61702402 CCTGTGATGCAGCAGACAGAAGG + Intergenic
1127916793 15:63461373-63461395 CCTTGCCTCCTGCAGACGGTGGG - Intergenic
1129060822 15:72859181-72859203 CCAGGCCTGCAGCTGACAGCAGG - Intergenic
1130042281 15:80415039-80415061 CCTTGCCTGCAGGAAAGAAATGG - Intronic
1130576181 15:85095117-85095139 CATAGCTTGTAGCAGACAGAAGG + Intronic
1130994763 15:88897596-88897618 CCCTGCCTGCAGAACACAGCCGG + Intergenic
1132038112 15:98503198-98503220 ACTCGTCTGCAGCAGAAAGAAGG + Intronic
1132115412 15:99132074-99132096 CCTTCCCTGCAGCAGAAATGGGG - Exonic
1132336414 15:101051131-101051153 CCTTGCATGAAGCAGGCAGTTGG + Intronic
1132533679 16:466812-466834 CCTTCCCAGCAGCTGACAGATGG + Intronic
1132863394 16:2082338-2082360 CCGTGCCTGCAGAGGAGAGAGGG - Intronic
1132956432 16:2596780-2596802 CCTTGCCTGCGGAGGACATACGG - Intronic
1133736351 16:8618988-8619010 CCATGTCTGCAGCAGAGGGAAGG - Intergenic
1133878855 16:9762048-9762070 GCTAGCCTTCGGCAGACAGATGG + Exonic
1133892187 16:9890955-9890977 CCCTGCATTCAGCACACAGAAGG + Intronic
1137520927 16:49195009-49195031 CCTAGCCGACAGCAGACAGCAGG + Intergenic
1137553853 16:49457904-49457926 CCTTGCCTGTTGGAGAGAGAAGG - Intergenic
1138199270 16:55077084-55077106 CCCTGCCTGCAGCAGTCACCTGG - Intergenic
1138643263 16:58403315-58403337 ACTTGCCTGCAGCAGAGACTGGG - Exonic
1139440888 16:66966295-66966317 CAGTGCCTTCAGCAGAAAGAAGG + Exonic
1140213399 16:72988337-72988359 CCTTTCCTGCAGCTGACTGAAGG + Intronic
1141913310 16:87075778-87075800 CCTCGCCCCCAGCAGAAAGAAGG + Intergenic
1142924491 17:3222805-3222827 ACTTGGCAGCAGGAGACAGAGGG - Intergenic
1143377856 17:6477995-6478017 CCCTGCCAGCAGCAGCCGGAAGG - Exonic
1145009230 17:19358014-19358036 CCTTACCTTCAGCAGGCAGTTGG + Intronic
1145092416 17:19996840-19996862 ACTTGCCTGGAGCAGGCGGATGG - Intergenic
1146124776 17:30222899-30222921 CCTTGCCTCCAGGAGACCTAGGG + Exonic
1146254889 17:31386151-31386173 CCATTTCTGCAGCTGACAGAAGG + Intergenic
1150349341 17:64430664-64430686 CATTGCCTGTAGCAGAGAAAGGG + Intergenic
1151756005 17:76075664-76075686 AGTTGGCTGCAGGAGACAGACGG - Intronic
1151924651 17:77186179-77186201 CCTTGCCGGGTGCAGACAGAAGG - Intronic
1152756682 17:82089962-82089984 CCTTGGCTGCAGAGGACTGAGGG - Intronic
1155808751 18:30206006-30206028 GCATGCCTGCAGATGACAGATGG + Intergenic
1158672024 18:59484726-59484748 CCTTCCCTTGAGCAGACAGCTGG - Intronic
1158711099 18:59838890-59838912 ACTTGCCTGAAGCAGAAAGGTGG + Intergenic
1159142098 18:64409670-64409692 GCTTTCCTTCAGCTGACAGAAGG - Intergenic
1160694890 19:478762-478784 CCTCGCCTGCAGCCGGCAGCTGG - Intergenic
1161273138 19:3401294-3401316 TCCTCCCTGCAGCAGGCAGAGGG - Intronic
1161551477 19:4915227-4915249 CCCTCCCTCCCGCAGACAGAAGG - Intronic
1161597236 19:5156777-5156799 CCTTCCCTGCAGCTTCCAGACGG + Intergenic
1161605618 19:5213233-5213255 TCCTCCCTGCAGCAGCCAGAGGG + Intronic
1162322392 19:9977817-9977839 CCCCTCCTGCAGCAGCCAGAGGG + Intronic
1162380348 19:10328220-10328242 CCTTGCATGCATCTGATAGAGGG + Intronic
1163096561 19:15062189-15062211 ACTTGGCTGGAGCAGGCAGAAGG + Intergenic
1164421875 19:28100640-28100662 CCATGCCTGCTGCAGAGAGCAGG - Intergenic
1164754423 19:30679384-30679406 TCTTGGCTGCAGCAGAAACAAGG + Intronic
1165071391 19:33256745-33256767 CCTTGCCGGGAGCAGACACAGGG + Intergenic
1167034811 19:46988804-46988826 GCTGGCCGGCAGCAGGCAGAGGG + Intronic
925295128 2:2771293-2771315 CCTTGGGTGAAGCAGACAGTGGG + Intergenic
925381916 2:3434268-3434290 CCTTACCTGGAGCTCACAGATGG + Intronic
925841391 2:7995311-7995333 GCAGGCCTGAAGCAGACAGATGG - Intergenic
927191082 2:20517364-20517386 CCTTTCCTGAAGAAGGCAGAGGG - Intergenic
927504627 2:23604868-23604890 CCTTGGCTGCAGCCCACAGCTGG - Intronic
931259435 2:60604419-60604441 CCTTGCCCACAGCTCACAGAAGG + Intergenic
932430384 2:71670591-71670613 CCTGGCTTGCATCAGCCAGAGGG + Intronic
932480031 2:72033498-72033520 CATTCCCTGCTGCAGCCAGAGGG + Intergenic
933061423 2:77741642-77741664 CCTTGCCTGTTTCAGCCAGAAGG + Intergenic
933165563 2:79070918-79070940 CCTTGTCTTCAGCAGCCACAAGG + Intergenic
933976634 2:87517367-87517389 CCTTCCATGCAGCAAACTGATGG - Intergenic
934502897 2:94873281-94873303 CCTTCCCAGCAGCCCACAGAAGG + Intronic
934605323 2:95690781-95690803 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
935287102 2:101574724-101574746 GCTTACCTGCAGCAGAGAGACGG + Intergenic
935316272 2:101837397-101837419 TCCTGCCAGCAGAAGACAGAGGG - Intronic
935650288 2:105376118-105376140 CCGTGCCTGGAGCTCACAGATGG - Intronic
935738837 2:106128640-106128662 TCTTGCTTGCAGAAGGCAGACGG + Intronic
936088874 2:109488343-109488365 CCTTGCCTCCAGGGGACAGGTGG - Intronic
936317184 2:111433437-111433459 CCTTCCATGCAGCAAACTGATGG + Intergenic
936538780 2:113333334-113333356 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
938205922 2:129423246-129423268 CTTTTCCTTCAGCAGACATAGGG + Intergenic
938292236 2:130156371-130156393 CCTGCCCTGCACCAGACAGGTGG + Intronic
938464313 2:131516596-131516618 CCTGCCCTGCACCAGACAGGTGG - Intergenic
938683248 2:133713158-133713180 AGTGGCCTGGAGCAGACAGAGGG + Intergenic
938694088 2:133819639-133819661 ACCTGCCTGCAACATACAGAAGG + Intergenic
939187448 2:138877782-138877804 CCTTGCCTCCAGCATTCAGGTGG - Intergenic
939983954 2:148812372-148812394 GCTTTCCTGCAGCTGACACAGGG + Intergenic
941650482 2:168087207-168087229 GCTTACCTGCAGAAGAAAGAGGG + Intronic
942497539 2:176555564-176555586 CCTTGTCTGCGGCAGAAAGAAGG + Intergenic
947535630 2:230939167-230939189 CTTTGCCCCCAGCAGGCAGAAGG + Intronic
948016310 2:234693480-234693502 CCTTCCATACAGCAGCCAGAGGG - Intergenic
948030212 2:234811566-234811588 CCTTCCCTACAGCCTACAGAGGG + Intergenic
948947882 2:241230449-241230471 CCTTGTTCCCAGCAGACAGAGGG + Intronic
1168830515 20:842812-842834 CCCTGCCTGCTGCAGGCATATGG - Intronic
1168971577 20:1934911-1934933 TCTTGGCTGCAGTAGAGAGAAGG - Intronic
1170087008 20:12544864-12544886 CCTTTCCTTAAGCAGACAGCAGG + Intergenic
1171115798 20:22523909-22523931 CCTTCCCTGGAGCAGGCTGAAGG + Intergenic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1171887692 20:30671296-30671318 ACATGCCTGCAGCAGACCGGAGG + Intergenic
1172044646 20:32071645-32071667 CCCATCCTGCAGCAGACAGAAGG - Exonic
1172273016 20:33664926-33664948 CCTTGCCTGCACCAGGCTGGAGG + Intronic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1173637750 20:44575790-44575812 CCATACCTGCAGCACACAGAGGG - Intronic
1176299919 21:5094759-5094781 CACTGCCTGCTGCAGCCAGAGGG + Intergenic
1179813302 21:43885938-43885960 CCTTGGCAGCAGCTGACAGGAGG + Intronic
1179857103 21:44167152-44167174 CACTGCCTGCTGCAGCCAGAGGG - Intergenic
1182062939 22:27410811-27410833 CATTACCTGAAGCTGACAGAGGG + Intergenic
1183398045 22:37584463-37584485 CCTCCCCAGCAGCACACAGAGGG + Intergenic
1183464419 22:37972585-37972607 CCTTGGCTCCAGGAGACACAGGG - Exonic
1183510769 22:38233462-38233484 CCCTGCAGGCAGCAGATAGACGG - Intronic
950654640 3:14428991-14429013 CCTCGCCTGCTGCAGAGACAAGG + Intronic
950890505 3:16400202-16400224 TCTTGCCTGCAAATGACAGAGGG - Intronic
951585797 3:24213453-24213475 CCCTGCCTGAAACAGAGAGAAGG + Intronic
951901693 3:27663780-27663802 CGTTACCTCCAGCAGACAGTGGG - Intergenic
952614623 3:35255200-35255222 GCTGTGCTGCAGCAGACAGAGGG - Intergenic
953025762 3:39144004-39144026 CCCTCCCTGCAGCAGCCACAGGG + Exonic
953605540 3:44411015-44411037 TCCTGCCTGCAGCAGGCAGAAGG - Intergenic
955117940 3:56024501-56024523 CAGTCCCTGCAGCAGAGAGAGGG + Intronic
956214444 3:66833917-66833939 TCATGGCTGCAGCAGAAAGAGGG + Intergenic
956533088 3:70243145-70243167 TCTTGTCTGCAGAAGACAAAAGG - Intergenic
959841696 3:110983959-110983981 CCTCTCCTGAAGCAGAAAGAAGG - Intergenic
960519943 3:118643112-118643134 CCATGCCTACAGAAGACATATGG + Intergenic
960922694 3:122763875-122763897 CCTTGCGTGGAGCAGACAGGCGG - Intronic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
962006242 3:131352679-131352701 CTTTTCCTGCTGCAGACACAGGG - Intergenic
962342885 3:134600171-134600193 GTCTGCCTGCAGCAAACAGAGGG - Intronic
968131396 3:196194719-196194741 CCTTGGCTCCAGCCCACAGAAGG + Intergenic
968805492 4:2769018-2769040 CCTGGCGTGGAGCAGACGGAGGG + Intergenic
969252526 4:5977780-5977802 CCTAAACTGAAGCAGACAGAAGG - Intronic
969267327 4:6073154-6073176 CCTTCCCTCCAGCAGGCAGCAGG + Intronic
969267338 4:6073194-6073216 CCTTCCCTCCAGCAGGCAGCAGG + Intronic
970071263 4:12162357-12162379 CCTTTCCTCTAGCAGAAAGAAGG + Intergenic
970100383 4:12514831-12514853 CCATCCCTGCAGCAGACTTATGG - Intergenic
973298757 4:48556446-48556468 CCTTGCTTCCAGCAGCCTGAAGG + Intronic
973706609 4:53587595-53587617 CCTTGCCAGCATCTTACAGACGG + Intronic
974353051 4:60774234-60774256 CCTTTCCTAAAGCAGAAAGAGGG + Intergenic
977200671 4:94111929-94111951 CCTTGACTGCACCAAAGAGAGGG + Intergenic
978400021 4:108321573-108321595 GCCTGCCAGCAGCATACAGATGG - Intergenic
979084110 4:116383804-116383826 CGTTGCCTGCAGCAGAGAGGAGG - Intergenic
980091785 4:128450618-128450640 CATTGCCTGCTGTAGACAGTTGG - Intergenic
981066154 4:140488606-140488628 GCTTGCCTACAGCAGAAAGAAGG + Intronic
981518416 4:145634958-145634980 CCTTTCCTCAAGCAGAAAGAAGG + Intronic
982589876 4:157294745-157294767 ACTTGCCAGCAGCACACAGCTGG + Intronic
983928983 4:173432655-173432677 CCATGCCTGCCTCAGACAGGAGG - Intergenic
986284506 5:6349450-6349472 CCGTGCCTGCGGAAGCCAGAGGG - Intergenic
987030780 5:13974838-13974860 CCTTGCCAGGAGGAGACACAAGG + Intergenic
987199653 5:15563090-15563112 CCTTTCCAGCAGAAGACATATGG - Intronic
987709830 5:21492669-21492691 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
988602729 5:32654805-32654827 CCTGGGCTGCAACACACAGAGGG + Intergenic
988749783 5:34181494-34181516 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
989678217 5:43997780-43997802 CCCTGCCTGCAGCAGGCGGGAGG - Intergenic
991738042 5:69644698-69644720 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991760152 5:69911726-69911748 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
991787180 5:70206374-70206396 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991789618 5:70224424-70224446 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991814367 5:70499534-70499556 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991817502 5:70520826-70520848 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991839383 5:70786777-70786799 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
991879626 5:71206764-71206786 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991882066 5:71224793-71224815 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
993335269 5:86649938-86649960 CCTTGCCTGAAACTGACAGTTGG + Intergenic
993900828 5:93583492-93583514 CCATTCCTGCAGAAGAGAGAGGG + Exonic
994460578 5:100064764-100064786 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
994484728 5:100378175-100378197 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
996220030 5:120919889-120919911 CCTCTCCTGCAGCAGGCACATGG - Intergenic
996277504 5:121685091-121685113 AATAGCCTGCAGCAGGCAGAAGG + Intergenic
996831498 5:127745137-127745159 TCCTGTCTGCAGAAGACAGATGG - Intergenic
997763673 5:136476692-136476714 CCATGCTTGCAGAAGAAAGATGG - Intergenic
999501370 5:152149821-152149843 CCCTGCCTTCAGGACACAGATGG + Intergenic
1001528579 5:172446285-172446307 CCCTGCCTGCAGAAGCCACATGG + Intronic
1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG + Intronic
1001636647 5:173214822-173214844 CTTTGCCTGGAGCCGACGGAAGG + Intergenic
1002519049 5:179780501-179780523 CCCTGCCTCCAGCAGGCAGCTGG - Intronic
1002681336 5:180967594-180967616 CCATGCCTGAGGAAGACAGAAGG - Intergenic
1004046463 6:12028870-12028892 AATTGCCTGCAGCTGACAGTGGG - Intronic
1004436023 6:15595034-15595056 TCTTCACAGCAGCAGACAGACGG - Intronic
1004940646 6:20552744-20552766 GCTTGCATGCAGCAGACTGTGGG + Intronic
1005279958 6:24262600-24262622 CCTCTCCTGTAGCAGAAAGAAGG - Intronic
1005547850 6:26887837-26887859 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
1006788972 6:36686415-36686437 CCCTGCCTTCACAAGACAGAGGG - Exonic
1007250178 6:40489996-40490018 CTCTGCCTGCAGCAGAGGGAGGG + Intronic
1007391455 6:41551849-41551871 CCTGGCCTCCAGCACACAGTAGG - Intronic
1009018610 6:57928918-57928940 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
1013193831 6:107827846-107827868 CTTTACCAGCAGCTGACAGAAGG - Intergenic
1013373979 6:109496345-109496367 CAGTGCCTGCAGCAGCCAGGAGG - Intronic
1013574640 6:111469659-111469681 CCTAGCCTGCGGGAGACACATGG + Intronic
1014228940 6:118880582-118880604 CCTTGAATGCAAAAGACAGAAGG + Intronic
1015997135 6:139006799-139006821 GCTTGTCTGCAGTAGAAAGATGG + Intergenic
1017405129 6:154111170-154111192 CATTGCCTGAATCAGACATATGG - Intronic
1018453838 6:163934500-163934522 CTCTGCCTGAAGGAGACAGAAGG + Intergenic
1018841610 6:167521528-167521550 CCTGGCATGCAGCACACAGCAGG + Intergenic
1019408583 7:896957-896979 CCTTGCTGGCAGCAGGCACAGGG - Intergenic
1019613302 7:1947695-1947717 CCTTGCCTGCCGCACACGGCTGG + Intronic
1019768677 7:2870046-2870068 CCCTGCCTGGAGGAGAAAGAGGG + Intergenic
1020130451 7:5556225-5556247 CCTGGCCTGCAGCAGGCAGAGGG - Intronic
1023462250 7:40411453-40411475 CCTATCCTGCAGCAAACAGCAGG - Intronic
1024382473 7:48713432-48713454 CCTTGCCCTCAGGAGACAGCAGG - Intergenic
1024697832 7:51874474-51874496 CCTTGCCTACTGGAGAGAGATGG - Intergenic
1025718196 7:63983352-63983374 CCTTGCTTGAAGAAGAGAGAGGG + Intergenic
1025927734 7:65972884-65972906 CCAAGTCTGCAGCAGGCAGAAGG - Intronic
1027143801 7:75679928-75679950 CTTTGTCTGCAGCCGAAAGAAGG - Intronic
1027669071 7:81073683-81073705 CCTTGCCTGCCACAGAGAGGTGG + Intergenic
1033591571 7:142812924-142812946 GCTTGCCTTCCCCAGACAGAGGG + Intergenic
1034399403 7:150852174-150852196 TCTTACCTGAAGCTGACAGATGG - Intronic
1034743957 7:153504795-153504817 CCCTGCCTGTAACAGAGAGATGG - Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1037816013 8:22112222-22112244 CCATGCCTGCATTTGACAGATGG - Intergenic
1038708770 8:29921523-29921545 CATTGCCTGGAGATGACAGAAGG + Intergenic
1038755847 8:30340116-30340138 CCTTCCCTGCAGCTCACAGTTGG - Intergenic
1039804609 8:40987489-40987511 CCTGGCCTCCTACAGACAGAGGG + Intergenic
1041724631 8:61006484-61006506 CCAGGACCGCAGCAGACAGACGG - Intergenic
1041768929 8:61451898-61451920 CATTGCCTTTATCAGACAGAAGG + Intronic
1042427165 8:68661695-68661717 ACATGCCTGCAGCAGACTAAGGG - Intronic
1044421284 8:91998594-91998616 CCTTCCCTCCAGCAGCGAGAAGG + Intronic
1046534613 8:115493003-115493025 CCTTGCCTGGCCCAGACAAAGGG + Intronic
1046650787 8:116834707-116834729 CATACCCTCCAGCAGACAGAGGG + Intronic
1047439524 8:124864691-124864713 CCTTGCCTTCATGAGAGAGATGG - Intergenic
1048494610 8:134924821-134924843 CCTTGCCTGAATGAGAAAGAAGG - Intergenic
1049094828 8:140542225-140542247 CCTTTCCTTCCGCAGCCAGAGGG - Intronic
1049217598 8:141415253-141415275 CCCAGCCTGCAGCAGGCAGTGGG + Intronic
1049407888 8:142459883-142459905 CCCTGCCCCCAGCAGGCAGAGGG + Intronic
1053458671 9:38251453-38251475 TCTTCCCTAAAGCAGACAGATGG - Intergenic
1053500347 9:38583960-38583982 ACTTGCCAGCAGCAGACTGGAGG + Intergenic
1055722985 9:79196621-79196643 CATGGGCTGCATCAGACAGAAGG + Intergenic
1056201949 9:84285626-84285648 CTTTGCCTAAAGGAGACAGAGGG - Intronic
1056824051 9:89864559-89864581 CCTTCCCTGAAGAAGCCAGAGGG - Intergenic
1057203504 9:93156611-93156633 CCGTACCTGCAGCAGGGAGAAGG - Intergenic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1057999624 9:99851646-99851668 CCTTTCCTGCAGTAAACAGGGGG + Intronic
1060390199 9:123270113-123270135 CCTTGGCTGCCTCAGACACATGG + Intergenic
1060497487 9:124129303-124129325 CCTGCTCTGCAGCAGAAAGAGGG + Intergenic
1061200121 9:129133178-129133200 CCTTCCCTGAGGCAGGCAGATGG + Intronic
1061302435 9:129713184-129713206 CCCAGCCTACAGCAGAAAGATGG - Intronic
1185513104 X:677692-677714 TCTTGTCTGCACCAGAAAGATGG + Intergenic
1189324126 X:40102770-40102792 CCTCGCCTGCAGCAGGAAGGTGG + Intronic
1189381365 X:40504918-40504940 ACTTTCCTGCTGCAGACAGCTGG - Intergenic
1195314606 X:103665615-103665637 CTCTGCCTGCAGCAGGCACAGGG + Intergenic
1195559874 X:106271003-106271025 ACTTGCCTACAGAAGACAGTTGG - Intergenic
1195562088 X:106295336-106295358 ACTTGCCTACAGAAGACAGTTGG + Intergenic
1197720073 X:129739105-129739127 CCTGGGCTCGAGCAGACAGAGGG - Exonic