ID: 1101290680

View in Genome Browser
Species Human (GRCh38)
Location 12:103364995-103365017
Sequence CCTAATATGAAAACAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 1, 2: 14, 3: 148, 4: 905}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101290673_1101290680 7 Left 1101290673 12:103364965-103364987 CCCTAAATCATTCTATGAAGCCA 0: 354
1: 898
2: 1751
3: 10944
4: 4821
Right 1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG 0: 1
1: 1
2: 14
3: 148
4: 905
1101290674_1101290680 6 Left 1101290674 12:103364966-103364988 CCTAAATCATTCTATGAAGCCAG 0: 341
1: 909
2: 2266
3: 11610
4: 6707
Right 1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG 0: 1
1: 1
2: 14
3: 148
4: 905
1101290672_1101290680 10 Left 1101290672 12:103364962-103364984 CCTCCCTAAATCATTCTATGAAG 0: 315
1: 804
2: 1600
3: 10539
4: 4909
Right 1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG 0: 1
1: 1
2: 14
3: 148
4: 905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101290680 Original CRISPR CCTAATATGAAAACAAGGGA AGG Intronic
902391281 1:16108513-16108535 CCTTATGGGAAAAGAAGGGATGG + Intergenic
902968007 1:20025130-20025152 CCTAATAACAAAACCAGGAAAGG - Intergenic
904569639 1:31453281-31453303 CCTAATACTAAAACCAGGGAAGG - Intergenic
904849834 1:33449370-33449392 CCTAATACCAAAACTAGGAATGG + Intergenic
905249447 1:36638616-36638638 CCTGAAATGGAAACAGGGGAGGG + Intergenic
906053666 1:42896752-42896774 CCTAATACCAAAACCAGGGAAGG - Intergenic
906131164 1:43457962-43457984 CCTAATACCAAAACCAGGAAAGG + Intergenic
906563703 1:46780414-46780436 CCTAATATGAAAACGAGGAAAGG - Intronic
906808132 1:48799974-48799996 CCTAATACCAAAACCAGGAAAGG - Intronic
906876866 1:49548752-49548774 CCTAATACCAAAACCAGGAAAGG - Intronic
906914924 1:49998602-49998624 CCTAATACCAAAACCAGGAAAGG + Intronic
907030029 1:51161931-51161953 CCTAATACCAAAACCAGGAAAGG + Intergenic
908298869 1:62741426-62741448 CCTAATACCAAAACCAGGAAAGG + Intergenic
908638507 1:66195505-66195527 CCAAATAGCAAAACAGGGGATGG - Intronic
908890498 1:68841965-68841987 CCTAATATCAAAACCAGGAAAGG - Intergenic
908961979 1:69708960-69708982 CCTTCTATGAAAATAAGGGAGGG + Intronic
908982091 1:69970794-69970816 CCTAATACCAAAACCAGGAAAGG + Intronic
909123661 1:71637408-71637430 CCTAATATAAAATTAAAGGAGGG + Intronic
909639499 1:77856369-77856391 CCTAATACCAAAACCAGGAAAGG - Intronic
909673937 1:78218219-78218241 CCTAATACCAAAACCAGGAAAGG + Intergenic
909701542 1:78529882-78529904 CCTACTGTGAACACATGGGAGGG + Intronic
909794949 1:79721858-79721880 CCTAATATCAAAACCAGACAGGG + Intergenic
909948058 1:81686112-81686134 CCTAATACCAAAACCAGGAAAGG - Intronic
909981082 1:82102043-82102065 CCTAATACAAAAACCAGGAAAGG - Intergenic
910077957 1:83302504-83302526 CCTAATACTAAAACCAGGAAAGG + Intergenic
910738676 1:90491498-90491520 CCTAATACCAAAACCAGGAAAGG - Intergenic
911265601 1:95739583-95739605 CCTGATAACAAAACCAGGGAAGG - Intergenic
911318443 1:96382702-96382724 CCTAATACCAAAACCAGGAAAGG + Intergenic
911322420 1:96431133-96431155 CCTAATACCAAAACCAGGGAAGG - Intergenic
911678666 1:100689412-100689434 CCTAATACCAAAACCAGGAAAGG - Intergenic
911743553 1:101414214-101414236 CCTAATACCAAAACAAGGAAAGG + Intergenic
911861971 1:102963094-102963116 CCTCATATGAAAAGAAGGAATGG - Intronic
912081415 1:105941983-105942005 CCTAATATCAAAACCAGGGAAGG - Intergenic
913151659 1:116050259-116050281 CCTAATACCAAAACCAGGAAAGG + Intronic
913236471 1:116788589-116788611 CCTAATATCAAAACCAGGAAAGG + Intergenic
913240675 1:116826763-116826785 TCTTATTTTAAAACAAGGGATGG + Intergenic
913242968 1:116846168-116846190 GTTAATACGAACACAAGGGAGGG - Intergenic
913312830 1:117519844-117519866 CCTAATACCAAAACCAGGAAAGG + Intronic
913338032 1:117728133-117728155 CCTAATATCAAAACCAGGAAAGG + Intergenic
913339440 1:117743844-117743866 CCTAATACCAAAACTAGGAAAGG - Intergenic
913464022 1:119120564-119120586 CCTAATACCAAAACCAGGAAAGG + Intronic
914455135 1:147829289-147829311 CCTAATACCAAAACCAGGAAAGG - Intergenic
915179696 1:154047618-154047640 CCTTACATGAAACAAAGGGATGG - Intronic
915999608 1:160602371-160602393 CCTAATACCAAAACCAGGAAAGG - Intergenic
916331414 1:163621633-163621655 CCTAATACCAAAACCAGGAAAGG - Intergenic
916913394 1:169377473-169377495 TCTAATAGAGAAACAAGGGAAGG - Intronic
917319304 1:173762397-173762419 CCTAATACCAAAACCAGGAAAGG + Intronic
917461877 1:175238142-175238164 CCTAATACCAAAACCAGGAAAGG + Intergenic
917799136 1:178554287-178554309 CCTTATGGGAAAAGAAGGGATGG + Intergenic
917898168 1:179513540-179513562 CCTAATACCAAAACCAGGAAAGG - Intronic
918819471 1:189233880-189233902 CCTAATATGAAAACTAGGGAAGG - Intergenic
919115203 1:193272954-193272976 CCTAATACCAAAACCAGGAAAGG - Intergenic
919214203 1:194531342-194531364 CCTAATATCAAAACCAGGAAAGG - Intergenic
919282591 1:195510266-195510288 CCTTATAGGAAACGAAGGGATGG - Intergenic
919306377 1:195844429-195844451 CCTAATACCAAAACCAGGAAAGG + Intergenic
919407739 1:197205724-197205746 CCTAATACCAAAACCAGGAAAGG - Intergenic
919485384 1:198140022-198140044 CCTAATACCAAAACCAGGAAAGG - Intergenic
919508700 1:198432806-198432828 CCTAATACCAAAACCAGGAAAGG - Intergenic
919549186 1:198963344-198963366 CCTAATACCAAAACCAGGAAAGG - Intergenic
919571572 1:199255499-199255521 CCTAATACCAAAACCAGGGAAGG - Intergenic
920423756 1:205856457-205856479 CCTAATAGCAAAACAAGAAAAGG + Intergenic
920726663 1:208442208-208442230 CCTAATACCAAAACCAGGAAAGG - Intergenic
921001056 1:211043605-211043627 CCTAATACCAAAACCAGGAAAGG + Intronic
921196762 1:212765251-212765273 CCTAATACCAAAACTAGGAAAGG + Intronic
921409650 1:214822171-214822193 CCTAATACCAAAACCAGGAAAGG - Intergenic
922395717 1:225198815-225198837 CCTAATACCAAAACCAGGAAAGG - Intronic
922927057 1:229357884-229357906 CCTAATACCAAAACCAGGAAAGG - Intergenic
923122536 1:231006132-231006154 CCTAATACCAAAACCAGGAAAGG + Intergenic
923459075 1:234192121-234192143 CCTAATACCAAAACCAGGAAAGG + Intronic
923648541 1:235849031-235849053 ACTAATATCAAAACCAGGAAAGG + Intronic
923661986 1:235965750-235965772 CCTAATACCAAAACCAGGAAAGG + Intergenic
923691644 1:236199365-236199387 CCTAATACCAAAACCAGGAAAGG - Intronic
923726932 1:236514228-236514250 CATAATATTAAAATAAAGGATGG - Intergenic
923808355 1:237285500-237285522 CCTAATACCAAAACCAGGAAAGG - Intronic
923875609 1:238043442-238043464 CCTAATACCAAAACCAGGAAAGG + Intergenic
923960827 1:239081655-239081677 CCTAATACCAAAACCAGGAAAGG - Intergenic
923998455 1:239523596-239523618 ATTAATATGACAACAAGAGAGGG - Intronic
924691841 1:246359479-246359501 CCTAGTACAAAAACCAGGGAAGG + Intronic
924830024 1:247583830-247583852 CCTAATAGTAAAACCAGGCAAGG + Intergenic
1062942595 10:1435297-1435319 CATAAAATGAACTCAAGGGAGGG + Intronic
1063081091 10:2767818-2767840 CCTAATACCAAAACCAGGAAAGG + Intergenic
1063328446 10:5129933-5129955 CCTAATACCAAAACGAGGAAAGG + Intronic
1064556922 10:16556219-16556241 CCTAATACCAAAAACAGGGAAGG - Intergenic
1065079687 10:22115722-22115744 CCTAATACCAAAACCAGGAAAGG + Intergenic
1065462731 10:25985859-25985881 CCTAATACCAAAACCAGGGTAGG + Intronic
1065470658 10:26077973-26077995 CCTAATACCAAAACCAGGAAAGG - Intronic
1066170649 10:32840668-32840690 CCTAATACCAAAACCAGGGAAGG + Intronic
1066619318 10:37327018-37327040 CCTTATAGGAAACAAAGGGATGG - Intronic
1067034835 10:42906193-42906215 CCTAATACCAAAACCAGGAAAGG + Intergenic
1068389806 10:56380452-56380474 ACTGATATCAAAGCAAGGGATGG - Intergenic
1069648510 10:70023511-70023533 CCTAATATGAAAACCAGGAAAGG + Intergenic
1070952953 10:80445480-80445502 CCAAATAAGACATCAAGGGAGGG - Intergenic
1071015543 10:80993178-80993200 CCCAATACCAAAACCAGGGAAGG - Intergenic
1071023896 10:81089686-81089708 CCTAATACCAAAACCAGGAAAGG - Intergenic
1071045699 10:81373515-81373537 CCTAATACCAAAACCAGGAAGGG - Intergenic
1071318639 10:84429070-84429092 CCTGATATCAAAACAAGACAAGG - Intronic
1071660576 10:87498215-87498237 CCTAATAAGCAAACAAGTAATGG - Intergenic
1071812037 10:89193057-89193079 CCTAATACCAAAACCAGGAAAGG - Intergenic
1071843760 10:89500305-89500327 CCTAATACTAAAACCAGGAAAGG + Intronic
1072381475 10:94876344-94876366 CCTAATACCAAAACAAGGAAAGG - Intergenic
1072768972 10:98120776-98120798 CCTGATACCAAAACCAGGGAAGG - Intergenic
1072928321 10:99636955-99636977 CCTAATACTAAAACCAGGAAAGG + Intergenic
1073820511 10:107257754-107257776 CCTAATACCAAAACCAGGAAAGG + Intergenic
1074984561 10:118645958-118645980 CCTAATACCAAAACCAGGAAAGG - Intergenic
1074985515 10:118655540-118655562 CCTAATACCAAAACCAGGAAAGG - Intergenic
1075472456 10:122702035-122702057 CCTAATGTAAAAACAATTGAGGG - Intergenic
1075947104 10:126443688-126443710 CTTAATACGAAAACCAGGAAAGG + Intronic
1075982446 10:126752352-126752374 CCTAATACCAAAACCAGGAAAGG - Intergenic
1076376177 10:129987500-129987522 CCTAATACCAAAACCAGGAAAGG + Intergenic
1076665245 10:132085048-132085070 CCTAACACCAAAACAAGGAAAGG - Intergenic
1077833940 11:5907068-5907090 ACTAATATCAAAACCATGGAAGG - Intronic
1078301915 11:10140137-10140159 CCAAATATTAAAACAAAAGATGG - Intronic
1078706932 11:13752997-13753019 CCTAATACCAAAACCAGGAAAGG + Intergenic
1078960136 11:16256215-16256237 CCTAATATCAAAACTAGACAAGG + Intronic
1079273360 11:19010038-19010060 CCTAATACCAAAACCAGGAAAGG - Intergenic
1079463937 11:20710521-20710543 CCTAATACCAAAACCAGGAAAGG - Intronic
1079704788 11:23600810-23600832 CCTAATAACAAAACCAGGAAAGG - Intergenic
1079830688 11:25263911-25263933 CCTTATAGGAAACGAAGGGATGG + Intergenic
1080117014 11:28632595-28632617 CAAAATATGAAAAAAAGGAAAGG - Intergenic
1080486208 11:32709687-32709709 CCTAATACCAAAACCAGGCAAGG - Intronic
1080510812 11:32969060-32969082 CCTCATATGAAAAAAATAGATGG + Exonic
1080672232 11:34391529-34391551 CCTAATACCAAAACCAGGAAAGG - Intergenic
1080923801 11:36735005-36735027 CCTAATACCAAAACCAGGAAGGG + Intergenic
1081195558 11:40155866-40155888 CCTAATACCAAAACCAGGAAAGG + Intronic
1081326397 11:41750681-41750703 CCTAATACCAAAACCAGGGAAGG - Intergenic
1081974153 11:47220855-47220877 CCTATTATAAAAACAATGTATGG + Intronic
1082104401 11:48205050-48205072 CCTAATACCAAAACCAGGAAAGG - Intergenic
1082120528 11:48374927-48374949 CCTAATACCAAAACTGGGGAAGG - Intergenic
1082183596 11:49150596-49150618 CCTATTATGAACACAACAGATGG + Intronic
1082301195 11:50508717-50508739 CCTTACATGAAACGAAGGGATGG - Intergenic
1083016977 11:59464242-59464264 CCTAATACCAAAACCAGGAAAGG + Intergenic
1083046374 11:59739525-59739547 CCTAATACCAAAACCAGGAAAGG - Intronic
1083064269 11:59907799-59907821 CCTAATCCCAAAACCAGGGAAGG - Intergenic
1083071867 11:59993144-59993166 CTTAATATCAAAACCAGGAAAGG - Intergenic
1083354546 11:62056461-62056483 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1083355475 11:62063054-62063076 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1083547639 11:63560873-63560895 GCTAAAATTAAAGCAAGGGATGG + Intronic
1085917467 11:80906683-80906705 CCTAATACTAAAACCAGGAAAGG + Intergenic
1086264940 11:84986439-84986461 CCTAATACCAAAACCAGGAAAGG + Intronic
1086682761 11:89694749-89694771 CCTATTATGAACACAAGAGATGG - Intergenic
1086844714 11:91734101-91734123 CCTAATATGAAAACCAGGAAAGG + Intergenic
1086868458 11:92008666-92008688 CCTAATATTGAAACCAGGAAAGG - Intergenic
1086997567 11:93375760-93375782 CCTAATATCAAAACCAGGAAAGG - Intronic
1087469156 11:98549191-98549213 CTTAATATGAAAACCAGGAAAGG + Intergenic
1087533245 11:99410389-99410411 TCTTTTATGAAAACAAGGAAAGG - Intronic
1087570011 11:99914330-99914352 CTTAATATGAAATCAAAGCATGG - Intronic
1087631165 11:100652151-100652173 CCTAATACCAGAACAAGGAAAGG + Intergenic
1087652344 11:100882576-100882598 CCTAATACCAAAACCAGGAAAGG - Intronic
1087865924 11:103226687-103226709 CCTAATATCAAAACCAGGAAAGG - Intronic
1087882786 11:103438388-103438410 CCTATTTGGAAAACAAAGGATGG + Intronic
1088206738 11:107400730-107400752 CCTAATACCAAAACCAGGAAAGG + Intronic
1088239987 11:107763587-107763609 CCTAATACCAAAACCAGGAAAGG + Intergenic
1088387166 11:109272106-109272128 CCTAATATCAAAACAAGGAAAGG - Intergenic
1089107683 11:116027304-116027326 CCTAATACCAAAACCAGGAAAGG + Intergenic
1089570045 11:119400918-119400940 CCTGATATGAAAACCAGACAAGG + Intergenic
1089952593 11:122543441-122543463 CCTAATATCAAAACCAGGAAAGG - Intergenic
1090894713 11:130961117-130961139 CCTAATACCAAAACCAGGAAAGG - Intergenic
1090970389 11:131637406-131637428 CCCAGTTTGAGAACAAGGGAGGG - Intronic
1091210167 11:133850850-133850872 CCTAATACCAAAACAAGGAAAGG - Intergenic
1091381106 12:60795-60817 CCTAATATCAAAACTAGGGAAGG + Intergenic
1092060104 12:5542535-5542557 CCTAATACAAAAACCAGGAAAGG - Intronic
1092150583 12:6245645-6245667 CCTTATGGGAAACCAAGGGATGG + Intergenic
1092316362 12:7419039-7419061 CCTAATACCAAAACCAGGAAAGG + Intronic
1092854755 12:12662643-12662665 CCTAAAATGAAAACAAAGTTGGG - Intronic
1093278160 12:17154535-17154557 CCTAATACCAAAACCAGGAAAGG + Intergenic
1093408908 12:18841715-18841737 CCTAATACCAAAACCAGGAAAGG - Intergenic
1093488404 12:19678125-19678147 CCTAATACCAAAACCAGGAAAGG - Intronic
1093598009 12:20985046-20985068 CCTAATACCAAAACCAGGAAAGG - Intergenic
1093720879 12:22440620-22440642 CCTAATACCAAAACCAGGAAAGG + Intergenic
1093948699 12:25139376-25139398 CCTAATACCAAAACCAGGAAAGG + Intronic
1093995269 12:25634350-25634372 CCTAATACCAAAACCAGGAAAGG + Intronic
1094447006 12:30542265-30542287 CCTAATACCAAAACCAGGAAAGG - Intergenic
1094447064 12:30542969-30542991 CCTAATACCAAAACCAGGAAAGG - Intergenic
1095117947 12:38378607-38378629 CCTAATATCAAAATCAGGAAAGG - Intergenic
1095569738 12:43670973-43670995 GCTAATATTAATACAAAGGAGGG + Intergenic
1095687721 12:45054065-45054087 CCTAATACCAAAACCAGGGAAGG + Intergenic
1096012120 12:48227636-48227658 CCTAATACCAAAACCAGGAAAGG + Intergenic
1096032173 12:48428832-48428854 GCTAATACCAAAACCAGGGAAGG + Intergenic
1096037023 12:48481526-48481548 TCTAAAATCAAAACAAGGGATGG + Intergenic
1096348186 12:50869664-50869686 CCTAATACCAAAACCAGGAAAGG + Intronic
1096450240 12:51734412-51734434 CCTTATGGGAAAAGAAGGGAAGG + Intronic
1096957170 12:55538322-55538344 CCTAATACCAAAACGAGGGAAGG + Intergenic
1097385570 12:58946603-58946625 CCTAATACCAAAACCAGGAAAGG - Intergenic
1097906688 12:64927153-64927175 CCTAATACCAAAACCAGGAAAGG - Intergenic
1098060578 12:66557105-66557127 CATAGACTGAAAACAAGGGATGG + Intronic
1098269541 12:68756476-68756498 CCTAATACCAAAACCAGGAAAGG + Intronic
1098656137 12:73032161-73032183 CCTGATGTGAAAACAAGATAGGG + Intergenic
1098960450 12:76734745-76734767 CCTAATACTAAAACCAGGAAAGG - Intergenic
1099168293 12:79334511-79334533 ACCAGTAGGAAAACAAGGGAAGG + Intronic
1099370455 12:81823584-81823606 CTTAATATGAAAATAACTGAAGG - Intergenic
1099472748 12:83071486-83071508 CCTAATACCAAAACCAGGAAAGG - Intronic
1099476774 12:83117285-83117307 CCTAATACCAAAACCAGGAAAGG + Intronic
1099516758 12:83606228-83606250 CCTAATACCAAAACCAGGAAGGG + Intergenic
1099631034 12:85145922-85145944 TCTCATGTAAAAACAAGGGATGG - Intronic
1099652984 12:85452538-85452560 CCTGATATGATACCATGGGAAGG + Intergenic
1100087842 12:90933397-90933419 CCTAATACTAAAACCAGGAAAGG - Intronic
1100252850 12:92847738-92847760 CCTAATATAAAAGCTAGGGTTGG - Intronic
1100421585 12:94439706-94439728 CCTAATAGCAAAACCAGGAAAGG + Intronic
1100621204 12:96275413-96275435 CCTAAGATCAAAACAAGACAAGG + Intergenic
1100706598 12:97207025-97207047 CCTAATACTAAAACAAGGAAAGG + Intergenic
1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG + Intronic
1102594264 12:113980604-113980626 CCTAATAAGAAAAAGAGGAAAGG - Intergenic
1102916418 12:116756804-116756826 CCTAATACCAAAACCAGGAAAGG - Intronic
1103734067 12:123047749-123047771 CCTAATGAGAAAAAAAGGGTGGG + Intronic
1103734122 12:123048146-123048168 CCTAATGAGAAAAAAAGGGTGGG + Intronic
1104332854 12:127863530-127863552 CCTAATACCAAAACCAGGAAAGG + Intergenic
1104504187 12:129315620-129315642 CCTAATACAAAAACCAGGAAAGG - Intronic
1105931103 13:25053014-25053036 CCTAATATCAAAACCAGGGAAGG + Intergenic
1107846477 13:44519253-44519275 TTTACTATGAAAAAAAGGGAAGG - Intronic
1107961041 13:45558908-45558930 CCTAATACCAAAACCAGGAAAGG - Intronic
1108134680 13:47342746-47342768 CCTAATACCAAAACCAGGAAAGG + Intergenic
1108189315 13:47921170-47921192 CCTAATACCAAAATAAGGAATGG + Intergenic
1108298398 13:49049284-49049306 CCTAATACCAAAACCAGGGAAGG - Intronic
1108469166 13:50751406-50751428 CCTAATACCAAAACCAGGAAAGG - Intronic
1108791700 13:53976811-53976833 CCTAATACCAAAACCAGGAAAGG + Intergenic
1108924123 13:55717009-55717031 CCTAATACCAAAACCAGGAAAGG - Intergenic
1109058047 13:57577831-57577853 CCTAATATCAAAACCAGAAAAGG - Intergenic
1109207617 13:59499670-59499692 CCTAATTTTAAAGCAAGGCAAGG + Intergenic
1109617932 13:64861504-64861526 CCTAATATCAAAACCAGGAAAGG - Intergenic
1109924757 13:69121851-69121873 CCTAATACCAAAACCAGGAAAGG + Intergenic
1109975913 13:69831614-69831636 CCTAATACCAAAACCAGGAAAGG + Intronic
1110182108 13:72629636-72629658 CCTAATACTAAACCCAGGGAAGG + Intergenic
1110340359 13:74383491-74383513 CCTAATACCACAACCAGGGAAGG - Intergenic
1110793360 13:79609731-79609753 CCTAATACTAAAACCAGGAAAGG - Intergenic
1110915358 13:81014271-81014293 CATAAAAAGAAAACAAGGCAGGG - Intergenic
1111157290 13:84344626-84344648 CCTAATACCAAAACCAGGAAAGG - Intergenic
1111160601 13:84390164-84390186 CCCAACATGAAAACCAGGAAAGG - Intergenic
1111165462 13:84452291-84452313 CCTAATACCAAAACCAGGAAAGG - Intergenic
1111309669 13:86467798-86467820 CCTAATATCAAAACCAGATAAGG + Intergenic
1111690047 13:91552574-91552596 CCTTATGTGAAACGAAGGGATGG + Intronic
1111871614 13:93839943-93839965 CCTAATACCAAAACCAGGAAAGG - Intronic
1112747618 13:102544712-102544734 CCTAATACCAAAACCAGGAAAGG + Intergenic
1113183100 13:107654660-107654682 CCTAATACCAAAACCAGGGAAGG + Intronic
1114030499 14:18574809-18574831 CCTAATACCAAAACAAAGAAAGG - Intergenic
1114691873 14:24590683-24590705 CCTAATACCAAAACCAGGAAAGG - Intergenic
1115014632 14:28595139-28595161 CCTTACATCAAAACAAGGGGTGG + Intergenic
1115299553 14:31868814-31868836 CCTAATACCAAAACCAGGAAAGG + Intergenic
1115436613 14:33382148-33382170 CCTAACATGAAAACAGAGGTCGG + Intronic
1115526880 14:34289889-34289911 CCTAATACCAAAACCAGGAAAGG - Intronic
1115839998 14:37459684-37459706 CCTAATAGCAAAGCCAGGGAAGG + Intronic
1115905337 14:38196797-38196819 ACTAACATGTTAACAAGGGAAGG - Intergenic
1115970153 14:38936130-38936152 CCTAATACCAAAACCAGGAAGGG + Intergenic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116088728 14:40276369-40276391 CCTAATACCAAAACCAGGAAAGG - Intergenic
1116918874 14:50551540-50551562 CCTAATACCAAAACCAGGAAAGG + Intronic
1117103512 14:52375115-52375137 CCTAATACTAAAACCAGGGAAGG - Intergenic
1117192848 14:53310041-53310063 CCTAATACCAAAACCAGGAAAGG + Intergenic
1117768824 14:59111357-59111379 CCTAATACCAAAACCAGGAAAGG + Intergenic
1118196884 14:63635143-63635165 CCTAATACCAAAACCAGGAAAGG + Intronic
1118423815 14:65635811-65635833 CCTAATACCAAAACCAGGAAAGG - Intronic
1118531823 14:66714953-66714975 CCTAATACCAAAACCAGGAAAGG - Intronic
1119987756 14:79158554-79158576 CTCAATATGAAAACCAGTGATGG - Intronic
1120776423 14:88442765-88442787 CCTAATACCAAAACCAGGAAAGG - Intronic
1120785616 14:88532276-88532298 CCTAATACCAAAACCAGGAAAGG + Intronic
1121040893 14:90746062-90746084 CCTAATATCAAAACCAGATATGG - Intronic
1121460167 14:94069526-94069548 CCTAATACCAAAACCAGGAAAGG + Intronic
1121503173 14:94455496-94455518 CCTAATACCAAAACCAGGAAAGG - Intergenic
1121516290 14:94553152-94553174 CCTAATACCAAAACCAGGAAAGG - Intergenic
1121575727 14:94984850-94984872 CCTAATACTAAAACCAGGAAAGG + Intergenic
1121848155 14:97193249-97193271 CCTAATACCAAAACCAGGGGAGG - Intergenic
1122419391 14:101565540-101565562 CATATTTTGAAAACAAGGGCAGG + Intergenic
1124020811 15:25921333-25921355 CCTTATGGGAAACCAAGGGATGG + Intergenic
1124110268 15:26779057-26779079 CCTAATATTGGAACAAGGCAAGG - Intronic
1124381029 15:29165836-29165858 CCTAATACCAAAACCAGGAAAGG + Intronic
1124386450 15:29211952-29211974 CCTAATACCAAAACCAGGAAAGG - Intronic
1124668161 15:31611814-31611836 CCTAATACCAAAACCAGGGAAGG + Intronic
1124673822 15:31666133-31666155 CCTAATACCAAAACCAGGAAAGG - Intronic
1125269058 15:37918103-37918125 CCTAATACCAAAACCAGGAAAGG - Intergenic
1125273155 15:37962514-37962536 CCTAATACCAAAACCAGGAAAGG - Intronic
1125908977 15:43419325-43419347 CCTTATATGATAACATGAGAAGG + Intronic
1126184376 15:45816992-45817014 TCTAATACCAAAACCAGGGAAGG - Intergenic
1126190846 15:45876970-45876992 CCTAATACCAAAACCAGGAAAGG + Intergenic
1126294371 15:47121045-47121067 CCTAATACCAAAACCAGGAAAGG + Intergenic
1126488262 15:49207313-49207335 CCTAATATCAAAACCAGGAAAGG - Intronic
1126566221 15:50102757-50102779 CCTAATACCAAAACCAGGGATGG + Intronic
1126573389 15:50173807-50173829 CCTAATACCAAAACCAGGAAAGG + Intronic
1126841897 15:52725491-52725513 CCTTATAGGAAACAAAGGGATGG + Intergenic
1127007898 15:54591265-54591287 CCTAATACCAAAACCAGGAAAGG - Intronic
1127050458 15:55077946-55077968 CCTAATACGAAAACCAGGAAAGG + Intergenic
1127090572 15:55462602-55462624 CCTAATACCAAAACCAGGAAAGG + Intronic
1127174760 15:56341605-56341627 CCTAAAAAGAAAGAAAGGGAAGG + Intronic
1127839268 15:62816649-62816671 CCTAAGCTCAAGACAAGGGAAGG - Intronic
1128239051 15:66088335-66088357 CCTAATACCAAAACCAGGAAAGG + Intronic
1128415363 15:67440383-67440405 CCTAATACCAAAACCAGGAAAGG + Intronic
1129290514 15:74563387-74563409 CCAAATTTGAAAATAAAGGAGGG + Intronic
1129749429 15:78050440-78050462 ACTAATAAGAAAACAAGCCAGGG - Intronic
1131175072 15:90204194-90204216 CCTAAGATGCATGCAAGGGAGGG - Intronic
1131326551 15:91453009-91453031 CCTAATACAAAAACCAGGAAAGG - Intergenic
1131842329 15:96450522-96450544 TCTAATAGGAAAACATGGAATGG + Intergenic
1132033703 15:98461142-98461164 CCTAATACCAAAACCAGGAAAGG + Intronic
1132173274 15:99685786-99685808 CCTAATACCAAAACCAGGAAAGG - Intronic
1132254056 15:100359240-100359262 CCTAATATCAAAACCAGAGAAGG + Intergenic
1133991222 16:10709116-10709138 CCTAATATGCAAAGAAGGAAAGG - Intergenic
1134038066 16:11047270-11047292 CCTAAAAAGAAAGGAAGGGAGGG - Exonic
1134334047 16:13278392-13278414 CCTAATACCAAAACCAGGAAAGG - Intergenic
1135394278 16:22119138-22119160 CCTAAAATCGAAACAAGGCAAGG + Intronic
1135885837 16:26306679-26306701 CCTCAAATGAAAACAAGAGCTGG + Intergenic
1135901947 16:26468421-26468443 CCTAATACCAAAACCAGGAAAGG + Intergenic
1135917586 16:26619513-26619535 CCTAATACCAAAACCAGGAAAGG - Intergenic
1136670983 16:31857159-31857181 CCTGATATGAAAACAATACAAGG + Intergenic
1136848471 16:33595109-33595131 CCTAGTATGAGAACAAGGTGCGG + Intergenic
1138781990 16:59799609-59799631 CCTAATACCAAAACCAGGAAAGG + Intergenic
1138994865 16:62438083-62438105 CCTAATATGAAAACCAGACAAGG + Intergenic
1139419058 16:66837590-66837612 CCTAATACCAAAACCAGGAAAGG + Intronic
1139850148 16:69946998-69947020 CCTAAGATCAAAACAAGGCAAGG - Intergenic
1139879133 16:70169911-70169933 CCTAAGATCAAAACAAGGCAAGG - Intergenic
1140064280 16:71597085-71597107 CCTAATACCAAAACCAGGAAAGG + Intergenic
1140373388 16:74425641-74425663 CCTAAGATCAAAACAAGGCAAGG + Intergenic
1141714894 16:85721182-85721204 CCTAAAATGGAAACAAGAGCAGG + Intronic
1203110178 16_KI270728v1_random:1443758-1443780 CCTAGTATGAGAACAAGGTGCGG + Intergenic
1142840855 17:2628564-2628586 CCTAATACCAAAACCAGGAAAGG - Intronic
1142910497 17:3086017-3086039 TCTAATACCAAAACAAGGAAAGG - Intergenic
1143869976 17:9951116-9951138 GCAATCATGAAAACAAGGGACGG + Intronic
1144005645 17:11096622-11096644 CCTAAAATGAGGACGAGGGAGGG + Intergenic
1146583693 17:34063034-34063056 CCTAATACCAAAACCAGGAAAGG + Intronic
1146745656 17:35326635-35326657 CCTAATACCAAAACCAGGAAAGG - Intergenic
1147249756 17:39145946-39145968 CCTCATGTGAAACCCAGGGAAGG - Intronic
1147263670 17:39222986-39223008 CCTTATGTGATAAGAAGGGAAGG + Intronic
1149052892 17:52327369-52327391 CCTAATACCAAAACCAGGAAAGG + Intergenic
1149117698 17:53117831-53117853 CCTAATAGCAAAATGAGGGAAGG - Intergenic
1149172608 17:53829818-53829840 CCTGATTTGAAATCAAGAGAAGG - Intergenic
1149787320 17:59446915-59446937 ACTAATAGTAAAACAATGGATGG + Intergenic
1149935009 17:60796205-60796227 CCTAATACCAAAACCAGGGAAGG - Intronic
1150895979 17:69211455-69211477 CCTAATACCAAAACCAGGAAAGG - Intronic
1151048688 17:70951138-70951160 CCTAATACCAAAACCAGGCAAGG + Intergenic
1151079156 17:71308414-71308436 CCTAATATCACAACCAGGGAAGG + Intergenic
1153065761 18:1043028-1043050 CCTAATACCAAAACCAGGAAAGG + Intergenic
1153069189 18:1086024-1086046 CCTAATACCAAAACTAGGAAAGG - Intergenic
1153071601 18:1112330-1112352 CCTAATACCAAAACCAGGAAAGG - Intergenic
1153176018 18:2374242-2374264 CCTGATACCAAAACAAGGAAAGG - Intergenic
1153396104 18:4622705-4622727 CCTAATACCAAAACCAGGTAAGG - Intergenic
1155286773 18:24296976-24296998 CCTAATACCAAAACCAGAGAAGG - Intronic
1156010967 18:32497538-32497560 CCTAATACCAAAACCAGGAAAGG - Intergenic
1156344479 18:36243591-36243613 CCTAATACCAAAACCAGGAAAGG - Intronic
1156874642 18:41994164-41994186 CCTAATATCAAAGGAAGAGATGG + Intronic
1157399857 18:47378216-47378238 ATTAATATGAAAACCAGAGAGGG - Intergenic
1158002919 18:52639879-52639901 CCTAATACCAAAACCAGGAAAGG + Intronic
1158338423 18:56438452-56438474 CCTAATACCAAAACCAGGAAAGG + Intergenic
1159291681 18:66431358-66431380 CCCAATATGAAAACAAGCACAGG + Intergenic
1159453748 18:68635411-68635433 CCTAATACCAAAACCAGGAAAGG - Intergenic
1159707031 18:71703716-71703738 CCTGAGATGAAAAAAAGGAAGGG - Intergenic
1160128027 18:76196723-76196745 TCAAATATAAAAATAAGGGATGG + Intergenic
1162643031 19:12027583-12027605 CCTTATGTGAAACAAAGGGATGG - Intronic
1164051622 19:21588848-21588870 CCTTATGTGAAACGAAGGGATGG - Intergenic
1164261628 19:23572796-23572818 CCTTATAGGAAACAAAGGGATGG + Intronic
1166252546 19:41581312-41581334 CCTTATGGGAAACCAAGGGATGG - Intronic
1166428816 19:42704705-42704727 CCTAATACCAAAACCAGGAAAGG - Intronic
1168395723 19:56046435-56046457 CCTAATACCAACACCAGGGAAGG - Intronic
1202647350 1_KI270706v1_random:154529-154551 CCTAATACCAAAACCATGGAAGG + Intergenic
925447689 2:3942016-3942038 CCTAATACCAAAATCAGGGAAGG - Intergenic
925651964 2:6100323-6100345 CCTAATACCAAAACTAGGGAAGG - Intergenic
925795418 2:7536474-7536496 CCTAATTCCAAAACCAGGGAAGG - Intergenic
925944535 2:8848560-8848582 CCTAATATAAACATCAGGGAGGG + Intergenic
926708438 2:15854827-15854849 CCTAATATCAAAACCAGACAAGG - Intergenic
926915698 2:17889901-17889923 CCTAATACCAAAACCAGGAAAGG - Intronic
927024800 2:19055736-19055758 CCTAATACCAAAACCAGGGAAGG - Intergenic
927080238 2:19620684-19620706 CCTAATACCAAAACCAGGGAAGG + Intergenic
927303088 2:21538197-21538219 CCTAATATCAAAACCAGACAAGG + Intergenic
927328043 2:21829276-21829298 CCTAATACCAAAACCAGGAAAGG - Intergenic
927663389 2:25011935-25011957 CCTTACATCAAAACAAGAGAAGG - Intergenic
927722387 2:25392910-25392932 CCTAATACCAAAACCAGGGAAGG + Intronic
928442930 2:31308021-31308043 CCTAATACCAAAACCAGGAAAGG - Intergenic
928655158 2:33443305-33443327 CCTTAGATGAAAATGAGGGATGG + Intronic
928685044 2:33740841-33740863 CCTAATACCAAAACCAGGGATGG - Intergenic
928856271 2:35806302-35806324 CCTAATACCAAAACCAGGAAAGG + Intergenic
929009979 2:37431845-37431867 CCTAATACCAAAACCAGGGAAGG - Intergenic
929398988 2:41558031-41558053 CCTAATACCAAAACCAAGGAAGG + Intergenic
929806164 2:45146983-45147005 CCTAATACCAAAACCAGGAAAGG + Intergenic
930159728 2:48142613-48142635 CCTAATACCAAAACCAGGAAAGG - Intergenic
930549043 2:52808624-52808646 CCTAATATCAAAGCAATGAAAGG - Intergenic
930694437 2:54397000-54397022 CCTAAAATGACACTAAGGGATGG - Intergenic
931536149 2:63279148-63279170 CATAATACCAAAACCAGGGAAGG + Intronic
931548177 2:63412044-63412066 CCTAATACCAAAACCAGGAAAGG + Intronic
931553980 2:63479350-63479372 CCTAATACCAAAACCAGGAAAGG + Intronic
931902280 2:66803137-66803159 TCTAATATGAAAAAAATGCATGG - Intergenic
932100252 2:68892769-68892791 CCTAATACCAAAACCAGGAAAGG - Intergenic
932270620 2:70405853-70405875 CCTAATACCAAAACTAGGAAAGG + Intergenic
932384576 2:71319896-71319918 CCTAATACCAAAACCAGGAAAGG - Intronic
932653709 2:73588181-73588203 CCTAATACCAAAACCAGGAAGGG + Intronic
932859275 2:75272246-75272268 CCTGATATCAAAACCAGAGAAGG - Intergenic
933411066 2:81925663-81925685 CCTAATACCAAAACCAAGGAAGG + Intergenic
935135957 2:100302077-100302099 CCTAATGTGAACACAAGTGAAGG + Intronic
935436557 2:103041486-103041508 CCTAATACCAAAACCAGGAAAGG + Intergenic
935467412 2:103415493-103415515 CCTAATACCAAAACCAGGAAAGG + Intergenic
936164752 2:110110733-110110755 CCTAATATCAAAACCAGGAAAGG + Intronic
936555213 2:113490991-113491013 CCTAATACCAAAACCAGGAAAGG + Intronic
936633709 2:114232628-114232650 CCTAATACCAAAACCAGGAAAGG - Intergenic
936910856 2:117591823-117591845 CCTAATACCAAAACCAGGAAAGG - Intergenic
937529619 2:122812176-122812198 CCTAATACCAAAACCAGGAAAGG + Intergenic
937663304 2:124455581-124455603 CCTAATACCAAAACCAGGAAAGG + Intronic
937699251 2:124845461-124845483 CCTAATACAAAAACCAGGGAAGG - Intronic
937767328 2:125676915-125676937 CCTAATACCAAAACCAGGAAAGG - Intergenic
937971716 2:127554557-127554579 CCTAATATCAAAACCAGAAAAGG - Intronic
938103886 2:128516613-128516635 ACAATTATGAAGACAAGGGAAGG - Intergenic
938509742 2:131928089-131928111 CCTAATACCAAAACCAGGAAAGG + Intergenic
938597952 2:132808234-132808256 CCTAATACCAAAACCAGGAAAGG - Intronic
938996707 2:136686851-136686873 CCTAATACCAAAACCAGGGAAGG + Intergenic
939131947 2:138245551-138245573 ACTAAAATGAAAACAAAAGATGG + Intergenic
939305551 2:140405861-140405883 CCTAATACCAAAACCAGGAAAGG + Intronic
939744860 2:145956366-145956388 CCTATTATCAAAACCAGGAAAGG - Intergenic
939919418 2:148090355-148090377 CCTAATACCAAAACCAGGAAAGG + Intronic
940034402 2:149298524-149298546 CCTAATACCAAAACCAGGAAAGG - Intergenic
940056455 2:149517586-149517608 CCTAATACCAAAACCAGGAAAGG + Intergenic
940172069 2:150839859-150839881 CCTAATACCAAAACCAGGAAAGG - Intergenic
940423408 2:153504858-153504880 CCTAATACCAAAACCAGGGAAGG - Intergenic
940706556 2:157112022-157112044 CCTGATACCAAAACCAGGGAAGG + Intergenic
940709097 2:157140798-157140820 CCTAATACCAAAACCAGGAAAGG - Intergenic
940796526 2:158085978-158086000 CCTAATACCAAAACCAGGAAAGG - Intronic
941060955 2:160846394-160846416 CCTAATATCAAAACCAGGAAAGG + Intergenic
941230135 2:162901762-162901784 CCTAATACCAAAACTAGGAAAGG + Intergenic
941394903 2:164962369-164962391 CCTAATAAAAAAAAAACGGAGGG - Intergenic
941627739 2:167848256-167848278 CCTAATACCAAAACCAGGAACGG + Intergenic
941631318 2:167887929-167887951 CCTAATACCAAAACCAGGAAAGG - Intergenic
941828236 2:169923614-169923636 ATTATTATTAAAACAAGGGATGG - Intronic
942405611 2:175651214-175651236 CCTAATACAAAAACTAGGAAAGG + Intergenic
942703865 2:178746309-178746331 CCAAATATGGATTCAAGGGAGGG - Intronic
942726389 2:179012630-179012652 CCTAATACCAAAACCAGGAAAGG + Intronic
943131257 2:183855729-183855751 CATAATACGAAAACCAGGAAAGG + Intergenic
943167743 2:184351867-184351889 CCTAATATCAAAACCAAGAAAGG + Intergenic
943199106 2:184796193-184796215 CCTAATACCAAAACCAGGAATGG - Intronic
943580646 2:189679927-189679949 CCTAATATCCAAACCAGGAAAGG - Intronic
943589037 2:189775274-189775296 CCTTATATGAAACCTAAGGACGG + Intronic
943621020 2:190148482-190148504 CCTAATACCAAAACCAGGAAAGG - Intronic
943654586 2:190494514-190494536 CCTAATAACAAAACCAGGAAAGG + Intronic
943714771 2:191138772-191138794 CCTAATACCAAAACCAGGAAAGG + Intronic
943909587 2:193545916-193545938 CCTAATACCAAAACCAGGAAAGG + Intergenic
944072904 2:195693300-195693322 CCTAATACCAAAACGAGAGAAGG - Intronic
944231828 2:197402826-197402848 CCTAAAATGTAAACAAAGAAAGG + Exonic
944431733 2:199641142-199641164 CCTAATACCAAAACCAGGAAAGG - Intergenic
944528588 2:200645545-200645567 CCTAATAACAAAACCAGGAAAGG - Intronic
945131708 2:206580693-206580715 CCTAATACCAAAACCAGGAAAGG - Intronic
945292315 2:208138404-208138426 CCTTATGGGAAAAGAAGGGATGG + Intergenic
945508844 2:210675244-210675266 CCTCATATGAAAACAAAAAAAGG - Intronic
945865087 2:215165342-215165364 CCTAATACCAAAACCAGGAAAGG + Intergenic
946036785 2:216749542-216749564 CCTAATACCAAAACCAGGAAAGG + Intergenic
946204990 2:218098658-218098680 CCTAATACCAAAACCAGGAAAGG - Intergenic
946570907 2:221023155-221023177 CCTAATACCAAAACCAGGAAGGG - Intergenic
946718221 2:222576104-222576126 CCTAATCTGAAAACATCAGAAGG + Intronic
947460837 2:230303577-230303599 CCTAATACCAAAACCAGGAAAGG + Intronic
948577050 2:238960106-238960128 CCTAATACCAAAACCAGAGAAGG + Intergenic
948875718 2:240826753-240826775 GCAAATATCAAAACAAAGGATGG - Intergenic
1169397634 20:5247791-5247813 CCTAATACCAAAACCAGGAAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169840955 20:9936762-9936784 CCTAATACCAAAACCAGGAAAGG - Intergenic
1170245477 20:14217484-14217506 CCTAATACCAAAACCAGGAAAGG - Intronic
1170375564 20:15696520-15696542 CCTAATACCAAAACAAGGAAAGG - Intronic
1170598150 20:17820933-17820955 CCAAAGATGGAAACAAGGCAGGG + Intergenic
1170651130 20:18242913-18242935 CCTAATATCAAAACCAGGAAAGG + Intergenic
1170720727 20:18876155-18876177 CCTAATACCAAAACCAGGAAAGG - Intergenic
1170726631 20:18933941-18933963 CCTAATACAAAAACTGGGGAAGG - Intergenic
1171038405 20:21736408-21736430 CCTAATACCAAAACCAGGAAAGG - Intergenic
1171062216 20:21976694-21976716 CCTAATACCAAAACCAGGAAAGG - Intergenic
1171066661 20:22023468-22023490 CCTAATACCAAAACCAGGAAAGG - Intergenic
1171160172 20:22915020-22915042 CCTAATATCAAAACCAGGAAAGG - Intergenic
1171242009 20:23578081-23578103 CCTAATACCAAAACCAGGAAAGG - Intergenic
1171280673 20:23894198-23894220 CCTAATACCAACACAAGGAAAGG + Intergenic
1171375239 20:24689045-24689067 CCTAATACCAAAGCCAGGGAAGG - Intergenic
1172851033 20:37965215-37965237 CCTGATACCAAAACTAGGGAAGG - Intergenic
1173148541 20:40546213-40546235 CCTACTCTGAGAACAAGGGTGGG + Intergenic
1173299854 20:41792686-41792708 CCTAAGATGTAGACAAGAGAAGG - Intergenic
1173520791 20:43698841-43698863 TCTAATAAAAAAAAAAGGGAGGG - Intronic
1174360167 20:50023892-50023914 GCTAAGATGGAAACAAGGCAGGG + Intergenic
1175000138 20:55618879-55618901 CCTAATACCAAAACAAAGAAAGG - Intergenic
1176067026 20:63203182-63203204 CCTAAAATGAAAACAAAGAGCGG - Exonic
1176284095 20:64334027-64334049 CCTAATATCAAAACTAGGAAAGG - Intergenic
1176521386 21:7827083-7827105 CTCAATATGAAAACATGGGTGGG + Intronic
1176604514 21:8818243-8818265 CCTAATACCAAAACCATGGAAGG - Intergenic
1176783739 21:13230477-13230499 CCTAATACCAAAACCAGGAAAGG - Intergenic
1176968592 21:15239625-15239647 CCCAATATGAAAACTAGAGTGGG - Intergenic
1177069311 21:16482868-16482890 CCAAATACGAAAACCAGGAAAGG - Intergenic
1177195215 21:17897292-17897314 CCTAATACCAAAACCAGGAAAGG - Intergenic
1177301536 21:19251698-19251720 CCTAATACCAAAACCAGGAAAGG + Intergenic
1177364261 21:20113883-20113905 CCTAATACCAAAACCAGGAAAGG - Intergenic
1177661466 21:24089105-24089127 CCTAATACCAAAACCAGGAAAGG + Intergenic
1177749951 21:25268729-25268751 CCTAATACCAAAACCAGGGAAGG + Intergenic
1177935097 21:27335230-27335252 CCTAATACAAAAACCAAGGAAGG + Intergenic
1178655406 21:34457095-34457117 CTCAATATGAAAACATGGGTGGG + Intergenic
1178733166 21:35123966-35123988 CCTAATACCAAAACCAAGGAAGG + Intronic
1178801981 21:35804575-35804597 CCTCATATCAAAACCAGGAAAGG + Intronic
1179268575 21:39828811-39828833 CCTAATACCAAAACCAGTGAAGG - Intergenic
1179443592 21:41414623-41414645 CCTAATACCAAAACCAGGAAAGG + Intergenic
1180218625 21:46343595-46343617 CCTAATACCAAAACCAGGAAAGG - Intronic
1180295298 22:10928871-10928893 CCTAATAGGGAAAAAAGGGGGGG - Intergenic
1180346805 22:11709851-11709873 CCTAATACCAAAACCATGGAAGG - Intergenic
1180354562 22:11827967-11827989 CCTAATACCAAAACCATGGAAGG - Intergenic
1180383693 22:12164392-12164414 CCTAATACCAAAACCATGGAAGG + Intergenic
1180454613 22:15501865-15501887 CCTAATACCAAAACAAAGAAAGG - Intergenic
1180536881 22:16401269-16401291 CCTAATACCAAAACCATGGAAGG + Intergenic
1180896694 22:19340036-19340058 CCTAATACCAAAACCAGGAAAGG + Intronic
1181660093 22:24340091-24340113 CGTAATTTAAAAAGAAGGGAAGG + Intronic
1182199076 22:28551394-28551416 CCTAATAACAAAACTGGGGAAGG + Intronic
1182682706 22:32094316-32094338 CCTAATACCAAAACCAGGAAAGG - Intronic
1183166319 22:36149658-36149680 CCTATTGTGAAAACATGGCAAGG - Intronic
1184482535 22:44756238-44756260 CGTAAAATGAAAACAAGCAAAGG + Intronic
1184916319 22:47571508-47571530 TCTAATATTAAAGAAAGGGAAGG - Intergenic
1185077514 22:48691233-48691255 CCTACTTGGCAAACAAGGGAAGG - Intronic
949141357 3:637168-637190 CCTAAAAAAAAAAAAAGGGAGGG + Intergenic
949799454 3:7887549-7887571 CCTAATATCAAAACCAGGAAAGG + Intergenic
949814558 3:8044225-8044247 CTTAATATGAAAACCAGGAAAGG + Intergenic
949967472 3:9370240-9370262 ACTAAAATGAAAACAAGTGTAGG - Intronic
950592090 3:13944648-13944670 CCTAATACCAAAACCAGGAAAGG - Intronic
950819995 3:15746681-15746703 CCTAATACCAAAACCAGGGAAGG - Intronic
951260381 3:20500712-20500734 CCTAATACCAAAACCAGGAAAGG - Intergenic
951302401 3:21014363-21014385 CCTAATACCAAAACCAGGGAAGG - Intergenic
951749988 3:26024285-26024307 CCTAATACCAAAACCAGGGAAGG - Intergenic
951859170 3:27232001-27232023 CCTAATACAAAAACCAGGAAAGG + Intronic
952275741 3:31874535-31874557 CTTAATAGAAAAACAAGTGAAGG + Intronic
952689560 3:36188926-36188948 CCTAATATCAAAACCAGGAAAGG - Intergenic
952703564 3:36352214-36352236 CCTAATAACAAAACCAGGAAAGG + Intergenic
952994094 3:38860407-38860429 CCTAATACCAAAACCAGGAAAGG + Intronic
953254543 3:41277265-41277287 CCTAATACCAAAACCAGGAAAGG + Intronic
953277031 3:41511802-41511824 CCTAATACCAAAACTAGGAAAGG + Intronic
953639441 3:44692570-44692592 CCTAATACAAAAACTAGGAAAGG + Intergenic
955175335 3:56608109-56608131 CCTAATACCAAAACCAGGAAAGG - Intronic
956062209 3:65358888-65358910 CCTACTTTTAAGACAAGGGAAGG + Intronic
956426504 3:69140987-69141009 CCAAATATATAAACAAGGGAGGG - Intergenic
957142148 3:76374160-76374182 CCTTCCATGAAAACATGGGAGGG - Intronic
957433201 3:80140697-80140719 CCTAATACCAAAACCAGGAAAGG + Intergenic
957971984 3:87393923-87393945 TCTAATATGAAAATCAGGAAAGG + Intergenic
958064269 3:88522813-88522835 CCTAATATCAAAACCAGAAAAGG - Intergenic
958070406 3:88603471-88603493 CCTAATACCAAAACCAGGGAAGG + Intergenic
958646833 3:96885200-96885222 CCTAATACCAAAACCAGGAAAGG - Intronic
958770970 3:98425222-98425244 CCTAATACAAAAACCAGGAAAGG + Intergenic
959009445 3:101058033-101058055 CCTAATACCAAAACCAGGAAAGG - Intergenic
959113629 3:102150691-102150713 TATAAAATGAAAACAAGAGATGG + Intronic
959125620 3:102287121-102287143 CCTAATACCAAAACCAGGGAAGG - Intronic
959131997 3:102367713-102367735 CCTAATACTAAAACCAGGAAAGG - Intronic
959362199 3:105407219-105407241 CCTAATACCAAAACCAGAGAAGG + Intronic
960296383 3:115949749-115949771 CCTAATACTAAAACCAGGAAAGG + Intronic
960558206 3:119052657-119052679 CCTAATACCAAAACCAGGAAAGG + Intronic
960578398 3:119250311-119250333 CCTAATATCAAAATCAGGAAAGG + Intergenic
960756748 3:121022424-121022446 CCTAATATCAAAACCAAGAAAGG + Intronic
960778532 3:121290572-121290594 CCTAATATCAAAACCAAGAAGGG + Intronic
962013257 3:131414444-131414466 CCTAATACCAAAACCAGGAAAGG + Intergenic
962034735 3:131639672-131639694 CCTAATACCAAAACCAGGGAGGG + Intronic
962503076 3:136015293-136015315 CCTAATATCAAAACCAGGAAAGG - Intronic
962504598 3:136033362-136033384 CCTAATACCAAAACCAGGAAAGG - Intronic
962651639 3:137499713-137499735 CCTAATACCAAAACCAGGAAAGG - Intergenic
962673393 3:137732604-137732626 CCTAATACCAAAACCAGGAAAGG - Intergenic
963623226 3:147638326-147638348 CCTAATACCAAAACCAGGAAAGG + Intergenic
963832821 3:150026588-150026610 CCTAATATTAAAATGAAGGAAGG + Intronic
964146971 3:153475443-153475465 CCTAATACCAAAACCAGGAAAGG - Intergenic
964275408 3:155004183-155004205 CCTTATGGGAAAAGAAGGGATGG - Intergenic
964332009 3:155613314-155613336 CCCAATACCAAAACAAGGAAAGG + Intronic
964600944 3:158500342-158500364 CCTAATACCAAAACCAGGAAAGG - Intronic
965052431 3:163668124-163668146 CCTAATACCAAAACCAGGAAAGG - Intergenic
965102181 3:164311736-164311758 CCTACTACCAAAACCAGGGAAGG + Intergenic
965154314 3:165027469-165027491 CCTAATACCAAAACCAGGAAAGG + Intronic
965291258 3:166884687-166884709 CCTGATACCAAAACAAGGAAAGG + Intergenic
965296341 3:166952034-166952056 CCTAGTACCAAAACCAGGGAAGG - Intergenic
965321627 3:167258948-167258970 CCTAATACCAAAACCAGGAAAGG - Intronic
965992590 3:174837984-174838006 CCTAATACCAAAACCAGGAAAGG + Intronic
966020606 3:175204110-175204132 CCTAATACCAAAACCAGGAAGGG + Intronic
966153326 3:176890076-176890098 CCTAATATGAAAATCAGGGAAGG + Intergenic
966229597 3:177637330-177637352 CCTAATACCAAAACCAGGGAAGG - Intergenic
966292060 3:178371127-178371149 CCTAATACCAAAACCAGGAAAGG - Intergenic
967236403 3:187388393-187388415 CCTAATACCAAAACCAGGAAAGG + Intergenic
967400068 3:189050597-189050619 CCTAATACCAAAACCAGGAAAGG + Intronic
967958406 3:194897651-194897673 CCTAATACCAAAACCAGGAAAGG - Intergenic
969947205 4:10796321-10796343 CCTAATACCAAAACCAGGAAAGG + Intergenic
970016401 4:11517178-11517200 CCTTATAAGAAAAAAAGGGGAGG - Intergenic
970064052 4:12070987-12071009 CCTTATAAGTAAGCAAGGGAAGG + Intergenic
970346426 4:15157139-15157161 CCTAATACCAAAACCAGGAAAGG - Intergenic
970856493 4:20655056-20655078 CCTAATACCAAAACCAGGAAAGG + Intergenic
971182816 4:24346256-24346278 CCTAATACCAAAACCAGGAAAGG - Intergenic
971554685 4:27998917-27998939 CCTAGTACCAAAACCAGGGAAGG - Intergenic
971694914 4:29888437-29888459 CCTAATACCAAAACCAGGAAAGG - Intergenic
971900770 4:32655273-32655295 CCTAATACCAAAACCAGGGAAGG - Intergenic
971921601 4:32947244-32947266 CCTAATATCAAACCCAGGGAAGG - Intergenic
971965358 4:33548323-33548345 CCTAAAAGGAAATCAAAGGAGGG - Intergenic
972013680 4:34216788-34216810 CCTAATACCAAAACCAGGAAAGG + Intergenic
972097057 4:35361202-35361224 CCTAATACCAAAACCAGGAAAGG - Intergenic
972156754 4:36172659-36172681 CCTAAAAAGAAAAATAGGGAAGG + Intronic
973036992 4:45419647-45419669 CCTAATAACAAAACCAAGGAAGG - Intergenic
973044157 4:45514114-45514136 CCTAATATTCAAACCAGGAAAGG - Intergenic
973070553 4:45853113-45853135 CCTAATATCAAAACCAGGAAAGG - Intergenic
973179287 4:47248481-47248503 CCTAATACCAAAACCAGGAAAGG - Intronic
973244223 4:47993164-47993186 CCTAATACCAAAACCAGGAAAGG - Intronic
973373606 4:49272696-49272718 CCTAATACCAAAACCATGGAAGG + Intergenic
973387409 4:49522515-49522537 CCTAATACCAAAACCATGGAAGG - Intergenic
973853869 4:54990678-54990700 CCTCATATGAAAACCAGACAAGG + Intergenic
974133180 4:57781672-57781694 CCTAATACCAAAACCAGGAAAGG - Intergenic
974327645 4:60435531-60435553 CCTAATACCAAAACCAGGAAAGG - Intergenic
974352292 4:60764678-60764700 CCTAAGATGAAAAAGATGGAAGG - Intergenic
974533991 4:63151095-63151117 CCTAATAGCAAAACCAGGAAAGG - Intergenic
974568442 4:63610093-63610115 CCTGATGTGAAAACAAGACAAGG + Intergenic
974849147 4:67384773-67384795 CCTAATACCAAAACCAGGAAAGG + Intergenic
975068280 4:70097783-70097805 CCTAATACCAAAACCAGGGAAGG + Intergenic
975204405 4:71627859-71627881 CCTAATACCAAAACCAGGAAAGG + Intergenic
975517599 4:75263833-75263855 CCTAATACCAAAACCAGGAAAGG + Intergenic
975623520 4:76318783-76318805 CCTAATACTAAAACCAGGAAAGG + Intronic
975944755 4:79692450-79692472 CCTAATACCAAAACCAGGAAAGG - Intergenic
976032115 4:80769015-80769037 CCAAAAGTGAAGACAAGGGAGGG + Intronic
976228444 4:82815518-82815540 CTTAATTTTAAAACAAGGGAAGG - Intergenic
976363751 4:84210116-84210138 CCTAATACCAAAACCAGGAAAGG + Intergenic
976368789 4:84262715-84262737 CCTGATATGAAAATCAGGCAGGG + Intergenic
976455390 4:85240845-85240867 CCTAATACCAAAACCAGGAAAGG - Intergenic
976464430 4:85351883-85351905 CCAAATATTAAAACCAGGAAAGG - Intergenic
976562448 4:86517685-86517707 CCTAATATTAAAACTAAGAAAGG - Intronic
976791536 4:88884174-88884196 CCTAATACCAAAACCAGGAAAGG + Intronic
976869880 4:89778457-89778479 CCTAATATCAAAACCAGAAAAGG + Intronic
976907627 4:90259942-90259964 CCTAATAGCAAAACCAGGAAAGG - Intronic
977019596 4:91743052-91743074 CCTAATACCAAAACCAGGAAAGG - Intergenic
977325883 4:95574050-95574072 CCTGATATCAAAACCAGAGAAGG - Intergenic
977417010 4:96746647-96746669 CCTAATACCAAAACCAGGAAAGG + Intergenic
977481604 4:97585028-97585050 CCTAATACTAAAACCAGGAAAGG + Intronic
977481611 4:97585064-97585086 CCTAATACTAAAACCAGGAAAGG + Intronic
977510794 4:97959862-97959884 CCTAATACCAAAACATGGAAAGG + Intronic
977549620 4:98426884-98426906 CCTAATACCAAAACCAGGAAAGG + Intronic
977554211 4:98472240-98472262 CCAAAAAAGAAAAAAAGGGAGGG - Exonic
977813584 4:101387166-101387188 CCTAATACCAAAACCAGGAAAGG - Intergenic
977817697 4:101434226-101434248 CCAAATAGGAAAGGAAGGGAAGG - Intronic
977975799 4:103265324-103265346 CCTAATACCAAACCCAGGGAAGG - Intergenic
978158210 4:105513744-105513766 CCTAATACCAAAACCAGGAAAGG - Intergenic
978199582 4:106009993-106010015 CCTAATACCAAAACAAGGAAAGG - Intergenic
978629196 4:110723669-110723691 CCTAATACCAAAACCAGGAAAGG - Intergenic
978726374 4:111974399-111974421 CCTAATACCAAAACTAGGAAAGG - Intergenic
978757598 4:112320520-112320542 CCTAACATCAAAACCAGGAAAGG - Intronic
978999141 4:115196216-115196238 CCTAATACCAAAACCAGGAAAGG - Intergenic
979202160 4:117991510-117991532 CCTAATAACAAAACCAGGAAAGG + Intergenic
979435033 4:120677990-120678012 CCTAATACCAAAACCAGGAAGGG + Intergenic
979984763 4:127300032-127300054 CCTAATACCAAAACCAGGAAAGG + Intergenic
979995727 4:127428492-127428514 CCTAATACCAAAACCAGGAAAGG + Intergenic
980086909 4:128400612-128400634 CCTAATACCAAAACCAGGAAAGG - Intergenic
980087453 4:128406073-128406095 CCTAATACCAAAACCAGGAAAGG - Intergenic
980097473 4:128506537-128506559 TCTAAATAGAAAACAAGGGACGG - Intergenic
980186789 4:129472138-129472160 CCTAATACCAAAACCAGGAAGGG - Intergenic
980401314 4:132289634-132289656 CCTAATACCAAAACCAGGGAAGG - Intergenic
980762212 4:137250293-137250315 CCTAATATTAAAACAATGTTTGG - Intergenic
981461690 4:145020100-145020122 CCTAATACCAAAACCAGGAAAGG + Intronic
981626283 4:146759450-146759472 CCTAATACCAAAACCAGGAAAGG + Intronic
981825143 4:148931769-148931791 CCTAATACCAAAACCAGGAAAGG + Intergenic
982050212 4:151493486-151493508 CCTAATACCAAAACCAGGAAAGG + Intronic
982128136 4:152202075-152202097 CATCATATGCAAACAAGGGAAGG - Intergenic
982189456 4:152839256-152839278 CCTAATACCAAAACCAGGAAAGG - Intronic
982218454 4:153103874-153103896 CCTAATACCAAAACCAGGAAAGG - Intergenic
982318328 4:154054254-154054276 CCTAATACCAAAACCAGGCAAGG - Intergenic
982426013 4:155261546-155261568 CCTGATATCAAAACAAGACAAGG - Intergenic
982531687 4:156552772-156552794 CATAATATCAAAACCAGGAAAGG - Intergenic
982630941 4:157828239-157828261 CCTAATACCAAAACCAGGAAAGG + Intergenic
982656194 4:158152510-158152532 CCCAATAGGAAAACCAGGAAAGG + Intronic
982740241 4:159050381-159050403 TATAATATAAAAAGAAGGGAGGG + Intergenic
982960121 4:161825367-161825389 CCTAATACCAAAACCAGGAAAGG - Intronic
982992077 4:162289358-162289380 TCTCATATGAAAACCAGGGAAGG + Intergenic
983347278 4:166542992-166543014 TCTAATATCAAAACCAGGAAAGG + Intergenic
983569584 4:169190737-169190759 CCTAATACCAAAACCAGGAAAGG + Intronic
983776343 4:171611971-171611993 CCTAATACCAAAAGAAGGAAAGG + Intergenic
984324052 4:178228956-178228978 CCTAATACCAAAACCAGGAAAGG + Intergenic
984474785 4:180222376-180222398 CCTAATACCAAAACCAGGAAAGG - Intergenic
984722026 4:182981922-182981944 CCTAATACCAAAACCAGGAAAGG + Intergenic
984964034 4:185125854-185125876 CCTTATGGGAAAAGAAGGGATGG - Intergenic
985093206 4:186385099-186385121 CCTAATAGCAAAACCAGGAAAGG + Intergenic
985107968 4:186517259-186517281 CCTAATACTGAAACCAGGGAAGG - Intronic
985240422 4:187925617-187925639 CCTAATACCAAAACCAGGAAAGG - Intergenic
985284344 4:188319762-188319784 CCTAATATCAAAACCAGGAAAGG + Intergenic
985326118 4:188772642-188772664 CCTAATACCAAAACCAGGAAAGG - Intergenic
985826583 5:2196296-2196318 CCTGAAATAAAAACCAGGGATGG - Intergenic
986227672 5:5831432-5831454 CCTAATACCAAAACCAGGAAAGG + Intergenic
986259294 5:6129472-6129494 CCTAATACCAAAGCAAGGGAAGG + Intergenic
986617596 5:9635422-9635444 CCTAATGTCAAAACCAGGAAAGG - Intronic
987713675 5:21537359-21537381 CCTAATATGAAAGCCAGACAAGG + Intergenic
987846430 5:23293096-23293118 CCTAATACCAAACCCAGGGAAGG - Intergenic
988002477 5:25366322-25366344 CCTAATACCAAAACCAGGAAAGG + Intergenic
988017990 5:25584542-25584564 CCTAACATCAAAACCAGGAAAGG - Intergenic
988148286 5:27340098-27340120 CCTAATACCAAAACCAGGAAAGG + Intergenic
988278174 5:29110306-29110328 CCTAATATCAAAACTAGGAAAGG - Intergenic
988781028 5:34521950-34521972 CCTAACAAGAAACCAAGGCAAGG + Intergenic
989221635 5:38971872-38971894 CCAAATATGGAAATAAGGGTAGG - Exonic
989431359 5:41359192-41359214 CCTAATACCAAAACCAGGGAAGG - Intronic
989533500 5:42536640-42536662 CCTAATACCAAAACCAGGAAAGG - Intronic
989663709 5:43826396-43826418 TCTAATATGAAAACCAGAAAAGG - Intergenic
989694081 5:44179144-44179166 CCTAATACCAAAACCAGGAAAGG - Intergenic
989742907 5:44793296-44793318 CCTTATGGGAAACCAAGGGATGG - Intergenic
989758596 5:44986197-44986219 CCTTATGGGAAACCAAGGGATGG - Intergenic
989817956 5:45759588-45759610 CCTAATATCAAAACCAGGAAAGG - Intergenic
991947296 5:71911639-71911661 CATAATAAGAAAACAAGGCCGGG + Intergenic
992026878 5:72679102-72679124 CCTAATATCAAAACCAGACAAGG - Intergenic
992339787 5:75811309-75811331 CCTAATACCAAAACCAGGAAAGG - Intergenic
992520637 5:77546788-77546810 CCTAATACCAAAACCAGGAAAGG + Intronic
992599563 5:78384927-78384949 CCTAATACCAAAACCAGGAAAGG - Intronic
992647594 5:78826840-78826862 CCAAATTTGAAAATAAGGGCAGG + Intronic
992663402 5:78983773-78983795 CCTAAGATCAAGAGAAGGGAGGG - Intronic
993404139 5:87489837-87489859 CCTAATGTGAAAACAATCTATGG - Intergenic
993743569 5:91568186-91568208 CCTAATACCAAAACCAGGAAAGG + Intergenic
993796928 5:92279089-92279111 CCTAATACCAAAACCAGGAAAGG + Intergenic
994236541 5:97369497-97369519 CCTAAAATGGAAACAAGGAGTGG + Intergenic
994277073 5:97851996-97852018 CCTAATACCAAAACCAGGAAAGG + Intergenic
994304324 5:98183884-98183906 CCTAATACCAAAACCAGGGAAGG + Intergenic
994330164 5:98495484-98495506 CCTAATACCAAAACCAGGAAAGG + Intergenic
994555299 5:101292088-101292110 CCTAATATGAAAAACAGGGAAGG - Intergenic
994659258 5:102633858-102633880 CCTAATACCAAAACCGGGGAAGG + Intergenic
994823520 5:104682651-104682673 CCTAATACGAAAACCAGGAACGG + Intergenic
994875611 5:105417078-105417100 CCTAATAGCAAAACCAGGAAAGG + Intergenic
994925061 5:106105021-106105043 CCTAAAACCAAAACCAGGGAAGG + Intergenic
995293452 5:110487778-110487800 CCTAATACCAAAACCAGGAAAGG - Intronic
995317616 5:110794050-110794072 CCTAATACCAAAACCAGGAAAGG - Intergenic
995375174 5:111465865-111465887 CCTAATATCAAAACCAGGAAAGG + Intronic
995592747 5:113716381-113716403 CCTTATGGGAAAAGAAGGGATGG - Intergenic
995722865 5:115154849-115154871 CCTAATACCAAAACCAGGAAAGG + Intronic
995955623 5:117773070-117773092 CCTAATACCAAAACCAGGAAAGG + Intergenic
996011059 5:118482350-118482372 CCTAATACCAAAACCAGGAAAGG + Intergenic
996032263 5:118718883-118718905 CCTAATACCAAAACCAGGAAAGG + Intergenic
996144644 5:119959154-119959176 CCTGATATCAAAACCAGAGAAGG + Intergenic
996288644 5:121825937-121825959 CCTAATATCAAAACCAGGAAAGG - Intergenic
996325719 5:122270719-122270741 CCTAACACCAAAACCAGGGAAGG + Intergenic
996561540 5:124834909-124834931 CCTAATACACAAACCAGGGAAGG + Intergenic
996632121 5:125645890-125645912 CCTAATACCAAAACCAGGGAAGG + Intergenic
996835056 5:127782292-127782314 CCTAATACCAAAACCAGGAAAGG - Intergenic
997003800 5:129794712-129794734 CCTAATACCAAAACCAGGGAAGG - Intergenic
997107448 5:131036314-131036336 CCTTAGATCAAAACAAGGCAAGG + Intergenic
997765262 5:136496852-136496874 CCTAATACCAAAACCAGGAAAGG - Intergenic
998708578 5:144794080-144794102 CCTAATAGGAAAACAAGGAAAGG - Intergenic
999086401 5:148895078-148895100 CCTAATATCAAAACCAGGGAAGG + Intergenic
999484387 5:151980643-151980665 CCTAATAACAAAACCAGGAAAGG - Intergenic
999552561 5:152705047-152705069 CCTTATGGGAAACCAAGGGATGG - Intergenic
999942388 5:156558001-156558023 CCTAATATTAATACCTGGGATGG + Intronic
1000511315 5:162186989-162187011 CCTAATGTCAAAACCAGGAAAGG - Intergenic
1000688595 5:164285653-164285675 CCTAATACCAATACCAGGGAAGG - Intergenic
1000943175 5:167387994-167388016 CTTAATATCAAAACCAGGAAAGG - Intronic
1001169400 5:169404468-169404490 CCTTCCATGAATACAAGGGAAGG + Intergenic
1001176871 5:169477801-169477823 CCTAATACCAAAACCAGGAAAGG - Intergenic
1001189279 5:169612496-169612518 CCTAATACCAAAACCAGGAAAGG - Intergenic
1001291008 5:170460353-170460375 CCTAATACCAAAACCAGGAAAGG + Intronic
1001443392 5:171763484-171763506 ACTCATATGAAAATTAGGGATGG + Intergenic
1001458254 5:171884600-171884622 CCTAATACCAAAACCAGGAAAGG - Intronic
1001767749 5:174266124-174266146 CCTAATACCAAAACCAGGAAAGG + Intergenic
1002814201 6:663453-663475 CCTAATATCAAAACCAGGAAAGG + Intronic
1003063463 6:2880952-2880974 CCTAATAGCAAAACCAGGAAAGG + Intergenic
1003451182 6:6233613-6233635 CCTAATACAAAAACCAGGAAAGG + Intronic
1003465250 6:6373763-6373785 CCTAATACCAAAACCAGGAAAGG + Intergenic
1003711681 6:8599436-8599458 CCTAATACCAAAACCAGGAAAGG - Intergenic
1003819556 6:9881115-9881137 CCTAATATGAAAGCCAGACAAGG + Intronic
1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG + Intergenic
1004711655 6:18176950-18176972 CCTAATACCAAAACCAGGAAAGG - Intronic
1004888839 6:20078098-20078120 CCTAATACTGAAACCAGGGAAGG + Intergenic
1005072804 6:21877855-21877877 CCTAATACCAAAACCAGGAAAGG + Intergenic
1005107633 6:22242115-22242137 CTTAATACCAAAACCAGGGAAGG + Intergenic
1005760743 6:28965379-28965401 CCTAATACCAAAACCAGGAAAGG + Intergenic
1005857757 6:29875863-29875885 CCTTATAGGAAACGAAGGGATGG + Intergenic
1006286550 6:33100122-33100144 CCTAATACCAAAACCAGGAAAGG + Intergenic
1007893016 6:45313807-45313829 CCTAATAACAAAACCAGGGAAGG + Intronic
1008220457 6:48847990-48848012 CCTAAAACCAAAACAAGGAAAGG - Intergenic
1008372030 6:50743726-50743748 GATAATATGAAGAAAAGGGAGGG - Intronic
1008528322 6:52430684-52430706 CCTAATACCAAAACCAGGAAAGG - Intronic
1008580557 6:52903090-52903112 CCAAGCATGAAAACAAGGAAAGG + Intronic
1008730947 6:54481581-54481603 AATAATATGGAAGCAAGGGAAGG - Intergenic
1008775110 6:55028845-55028867 CCTAATACCAAAACCAGGAAAGG - Intergenic
1008781513 6:55111808-55111830 CCTAATACCAAAACCAGGAAAGG + Intronic
1009003042 6:57744536-57744558 CCTAATATGAAAGCCAGGCAAGG - Intergenic
1009589367 6:65646193-65646215 CCTAATACCAAAACCAGAGAAGG + Intronic
1009638160 6:66294217-66294239 CATAATAGGAAAACAAGTGTAGG + Intergenic
1009867340 6:69413778-69413800 CCTAATACCAAAATCAGGGAAGG + Intergenic
1009965303 6:70571611-70571633 CTTAATATTAAAACCAGGGAAGG - Intronic
1009969326 6:70609847-70609869 CCTAATACCAAAACCAGGGAAGG + Intergenic
1010008693 6:71025686-71025708 CCTAATACCAAAACCAGGAAAGG - Intergenic
1010101785 6:72118489-72118511 CCTAATACAAAAACCAGGAAAGG + Intronic
1010181596 6:73092887-73092909 CCTAATACCAAAACCAGGAAAGG - Intronic
1010358298 6:74962263-74962285 CCTAATACAAAAACCAGGAAGGG - Intergenic
1010518076 6:76799302-76799324 CCTAATACCAAAACCAGGGAAGG - Intergenic
1010707426 6:79131633-79131655 CCTAATACCAAAACCAGGAAAGG - Intergenic
1010862776 6:80934255-80934277 CCTAATACCAAAACCAGGAAAGG - Intergenic
1010903972 6:81462971-81462993 CCTAATACCAAAACCAGGAAAGG + Intergenic
1011005533 6:82640762-82640784 CCTAATACCAAAACCAGGAAAGG + Intergenic
1011168937 6:84482677-84482699 CCTAATACCAAAACCAGGAAAGG + Intergenic
1011225481 6:85100671-85100693 CCTGATACGAAAACCAGGAAAGG + Intergenic
1011319678 6:86077298-86077320 CCTAATACCAAAACTAGGAAAGG - Intergenic
1011327449 6:86165102-86165124 CCTAATACCAAAACCAGGAAAGG + Intergenic
1011394920 6:86896510-86896532 CCTAATACCAAAACCAGGAAAGG + Intergenic
1011564607 6:88661831-88661853 CCTAATATTAAAACCAGGGAAGG + Intronic
1011619835 6:89232500-89232522 CCTAATATCAAAACCAGGAAAGG - Intergenic
1011789416 6:90882283-90882305 CCTAATATCAAAATCAGGAAAGG - Intergenic
1011817279 6:91207459-91207481 CCTAATATCAAAACCAGGAAAGG - Intergenic
1011869451 6:91874283-91874305 GGAAATATGAAATCAAGGGATGG + Intergenic
1012079698 6:94740420-94740442 CCTGATATCAAAACCAGGAAAGG + Intergenic
1012183417 6:96183919-96183941 CCTAATACCAAAACCAGGAAAGG - Intronic
1012192014 6:96291618-96291640 CCTAATATCAAAACCAGGAAAGG + Intergenic
1012193553 6:96311024-96311046 CCTAATATGTAAAGTAGGAATGG - Intergenic
1012481146 6:99668552-99668574 GCTAATATGCAGACAAGAGAGGG - Intergenic
1012794099 6:103737913-103737935 CCTAATTCCAAAACCAGGGAAGG + Intergenic
1013434697 6:110091360-110091382 CCTATGACGAAAAAAAGGGAGGG - Intergenic
1013850659 6:114510574-114510596 CCTAATACCAAAACTAGGAAAGG + Intergenic
1013985256 6:116184375-116184397 CCTAATACCAAAACCAGGAAAGG - Intronic
1014055773 6:117014176-117014198 CCTAATACCAAAACCAGGAAAGG + Intergenic
1014481762 6:121947760-121947782 CCTAATAGCAAACCTAGGGAAGG - Intergenic
1014853616 6:126371560-126371582 CCTAATATCAAAACCAGGAAAGG - Intergenic
1014997739 6:128172218-128172240 CCTATTATTAAAACAAAGGTAGG - Intronic
1015116366 6:129654143-129654165 CCTAACATGAATATGAGGGACGG + Intronic
1015286113 6:131488395-131488417 CCAAATGAGAAAACAAAGGAGGG + Intergenic
1015348146 6:132183761-132183783 CCTAATATCAAAACTAGGAAAGG + Intergenic
1015565877 6:134570533-134570555 CCTAATACCAAAACCAGGAAAGG + Intergenic
1015663008 6:135597210-135597232 CCTAATACCAAAACCAGGGAGGG - Intergenic
1015839065 6:137456747-137456769 CCTTATGGGAAACCAAGGGATGG - Intergenic
1015849395 6:137556290-137556312 CCTAATACCAAAACCAGGAAAGG - Intergenic
1015877671 6:137839845-137839867 CCTAATACCAAAACCAGGAAAGG - Intergenic
1016197151 6:141358286-141358308 CCTAATACCAAAACCAGGAAAGG - Intergenic
1016289664 6:142515096-142515118 CCTAATACCAAAACCAGGAAAGG - Intergenic
1016351361 6:143172542-143172564 CCTAATACCAAAACCAGGAAAGG - Intronic
1016365829 6:143317174-143317196 CCTAATACCAAAACGAGGAAAGG + Intronic
1016484750 6:144525162-144525184 CCTAATACCAAAACCAGGAAAGG - Intronic
1016703398 6:147079085-147079107 TCTAATGTGAAAACAAGCCATGG + Intergenic
1017221632 6:151972318-151972340 CCTAATACCAAAACCAGGAAAGG + Intronic
1018353255 6:162985220-162985242 CCTAATACCAAAACCAGGGAAGG + Intronic
1019122812 6:169817379-169817401 CCTAATACCAAAACCAGGAAAGG - Intergenic
1020052007 7:5087895-5087917 CCTTATATTAATAAAAGGGATGG - Intergenic
1020374696 7:7471384-7471406 CCTAATACCAAAACCAGGAAAGG + Intronic
1020608852 7:10370415-10370437 CCTAATACCAAAATAAAGGAAGG + Intergenic
1020635207 7:10688216-10688238 CCTAATACCAAAACCAGGGAAGG + Intergenic
1020866585 7:13571632-13571654 CCTAATATCAAAAACAGGGAAGG - Intergenic
1021176323 7:17453859-17453881 CCTAATACCAAAACCAGGAAAGG - Intergenic
1021388021 7:20056047-20056069 CCTAATACCAAAACCAGGAAAGG + Intergenic
1021462225 7:20901334-20901356 CCTAATGGGAAAATATGGGAAGG - Intergenic
1022295651 7:29049680-29049702 CCTAATACCAAAACCAGGAAAGG + Intronic
1023657347 7:42437662-42437684 CCTAATACCAAAACCAGGGAAGG - Intergenic
1023748624 7:43347995-43348017 CCTAATACCAAAACCAGGAAAGG - Intronic
1024665268 7:51540442-51540464 CCTAATACCAAAACCAGGAAAGG - Intergenic
1024668988 7:51574275-51574297 CCTAATACCAAAACCAGGAAAGG - Intergenic
1024863325 7:53872591-53872613 CCTAATACCAAAACCAGGAAAGG + Intergenic
1025102229 7:56145170-56145192 CCTTATGGGAAACCAAGGGATGG - Intergenic
1025159754 7:56646275-56646297 TCTAATATGAACAAAAGGTAAGG + Intergenic
1025726950 7:64073039-64073061 TCTAATATGAACAAAAGGTAAGG - Intronic
1025801114 7:64786963-64786985 CCTAATACAAAAACTAGGAAAGG + Intergenic
1027295730 7:76767700-76767722 CCTAATACTAAAACCAGGAAAGG + Intergenic
1027328675 7:77068176-77068198 CCTAATACCAAAACCAGGAAAGG - Intergenic
1027350060 7:77302658-77302680 CCTAATACCAAAACCAGGAAAGG - Intronic
1027406159 7:77863497-77863519 CCTTATATGAAATCAATGTAAGG - Intronic
1027573320 7:79899899-79899921 AGTAATATGTAAACAAGAGACGG - Intergenic
1027699536 7:81452567-81452589 CCTAATACCAAAACCAGGAAAGG + Intergenic
1027732961 7:81899306-81899328 CCTAATACCAAAACCAGGGAAGG - Intergenic
1028197546 7:87924621-87924643 CCTAATACCAAAACCAGGGAAGG + Intergenic
1028261959 7:88677440-88677462 CCTAATAGCAAAACCAGGAAAGG + Intergenic
1028299238 7:89176616-89176638 CCTAATACCAAAACCAGGCAAGG - Intronic
1028347800 7:89804700-89804722 CCTAATACCAAAACAAGGAAAGG - Intergenic
1028502169 7:91531157-91531179 CCTAATACCAAAACCAGGGCAGG + Intergenic
1028626115 7:92879674-92879696 CCTAATAGGAAAAGAAGGATTGG + Intergenic
1028936574 7:96471221-96471243 CCTAATACCAAAACCAGGAAAGG - Intergenic
1029053468 7:97714700-97714722 CCTAATACCAAAACCAGGGAAGG + Intergenic
1029056435 7:97749324-97749346 CCTGATATAAAACCAAAGGAAGG + Intergenic
1029787089 7:102803196-102803218 CCTAATACCAAAACCAGGAAAGG + Intronic
1030100095 7:105938157-105938179 GATTATATGAAAACAAGGGGTGG - Intronic
1030326049 7:108219365-108219387 CCTAATACCAAAACCAGGAAAGG + Intronic
1030390144 7:108917822-108917844 CCTAATACAAAAACCAGGAAAGG - Intergenic
1030456152 7:109776463-109776485 CCTAATACTAAAACCAGGAAAGG + Intergenic
1030552646 7:110983079-110983101 CCTGAAATGAAAACATTGGATGG + Intronic
1030889857 7:114986236-114986258 CCTAAAAAGAAAACAAAGAAAGG - Intronic
1030936286 7:115588492-115588514 CCTAATACCAAAACCAGGCAAGG + Intergenic
1030972606 7:116078845-116078867 CCTAATACCAAAACCAGGGAAGG + Intronic
1031090171 7:117345136-117345158 CCTAATACCAAAACCAGGAAAGG - Intergenic
1031625682 7:123990181-123990203 CCTAATACCAAAACCAGGAAAGG - Intergenic
1031760952 7:125712680-125712702 CCTAATACCAAAACCAGGAAAGG - Intergenic
1032465601 7:132142664-132142686 CCTAATAGGAAATAATGGGATGG + Intronic
1032658763 7:133960325-133960347 CCTAATACCAAAACCAGGAAAGG - Intronic
1032922335 7:136563771-136563793 CCTAATACCAAAACCAGGAAAGG - Intergenic
1032935976 7:136731993-136732015 CCTAATATCGAAACCAAGGAAGG + Intergenic
1033027116 7:137785639-137785661 CCTAATACCAAAACCAGGGAAGG + Intronic
1034229844 7:149514457-149514479 CCTAATACTAAAAAAAGGAAAGG - Intergenic
1034232391 7:149541060-149541082 GCTAATAAGATAACAAAGGAGGG + Intergenic
1034682894 7:152943789-152943811 CCTAATACCAAAACCAGGAAAGG - Intergenic
1035922216 8:3689983-3690005 CCTAATATTTTAACAAGGTAAGG + Intronic
1037055083 8:14430210-14430232 CCTAATACCAAAACCAGGAAAGG + Intronic
1037064405 8:14558649-14558671 CCTAATACCAAAACCAGGAAAGG + Intronic
1037320522 8:17637546-17637568 CCTAATACCAAAACCAGGAAAGG - Intronic
1037713306 8:21373336-21373358 CCTAATACCAAAACCAGGAAAGG - Intergenic
1038366938 8:26946092-26946114 CCTAACACCAAAACCAGGGAAGG - Intergenic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1038770947 8:30479122-30479144 TCTAATATGAATCAAAGGGATGG - Intronic
1038999371 8:32962875-32962897 CCTAATATAAAATCCAGGGCTGG - Intergenic
1039082992 8:33752129-33752151 CCTAATACCAAAACCAGGAAAGG - Intergenic
1039123888 8:34178867-34178889 CCGAATACCAAAACCAGGGAAGG + Intergenic
1039653450 8:39371279-39371301 CCTAATACCAAAACCAGGAAAGG + Intergenic
1039691005 8:39864682-39864704 CCAATAATGAAAACAAGAGAAGG + Intergenic
1040370952 8:46773399-46773421 CCTGATATAAAACCAAAGGAAGG - Intergenic
1040966966 8:53092575-53092597 CCTAATACCAAAACCAGGAATGG - Intergenic
1041083847 8:54238861-54238883 CCTGATATTAAAAGAAGGGAAGG + Intergenic
1041293361 8:56329678-56329700 CCTAATACCAAAACCAGGAAAGG - Intergenic
1041363925 8:57081788-57081810 CCTAATACCAAAACCAGGAAAGG - Intergenic
1041637426 8:60159737-60159759 CCTAATACCAAAACCAGGAAAGG + Intergenic
1041832303 8:62168193-62168215 CCTAATACCAAAACCAGGGAAGG + Intergenic
1042122517 8:65503858-65503880 CCTAATAACAAAACCAGGAAAGG - Intergenic
1042160868 8:65893606-65893628 CCTAATACCAAAACCAGGGAAGG + Intergenic
1042188593 8:66162495-66162517 CCTAATACCAAAACCAGGGGAGG - Intronic
1042521632 8:69718454-69718476 CCTAAGATCAGAACAAGGAAAGG - Intronic
1042644635 8:70972941-70972963 CCTAATACCAAAACTAGGGAAGG - Intergenic
1043041074 8:75262680-75262702 CCTAATATCAAAACCAAGAAAGG + Intergenic
1043047785 8:75349582-75349604 CCTAATACCAAAACCAGGAAAGG + Intergenic
1043071357 8:75640072-75640094 CCTAATACCAAAACCAGGAAAGG - Intergenic
1043084155 8:75806482-75806504 ATTAAAATGAAATCAAGGGAAGG - Intergenic
1043529975 8:81138769-81138791 CCTAATATGAGAAGTAGGGATGG + Intergenic
1043616653 8:82133457-82133479 CCTAATACCAAAACCAGGAAAGG + Intergenic
1043679178 8:83000282-83000304 CCTAATACCAAAACCAGGGAAGG + Intergenic
1043816578 8:84809458-84809480 CCTAATACCAAAACCAGGAAAGG - Intronic
1043876084 8:85488022-85488044 CCTAATATCAAAACCAGGGAAGG - Intergenic
1044907536 8:97020887-97020909 CCTAATACCAAAACCAGGAAAGG + Intronic
1045095194 8:98790190-98790212 CCTAATACCAAAACCAGGAAAGG + Intronic
1045121908 8:99047003-99047025 CCTAATACCAAAACCAGGAAAGG - Intronic
1045671313 8:104556782-104556804 CCTAATAACAAAACCAGGGAAGG + Intronic
1045780124 8:105853060-105853082 CCTAATACCAAAACCAGGAAAGG + Intergenic
1045813877 8:106257183-106257205 CCTAATATCAAAACCAGGGAAGG - Intergenic
1045881168 8:107042368-107042390 CCTAATATCAAAACCAGGAAAGG - Intergenic
1046352141 8:113029290-113029312 CCTAATACCAAAACCAGGGAAGG + Intronic
1046369284 8:113280142-113280164 CCTAATACCAAAACCAGGAAAGG - Intronic
1046467499 8:114625343-114625365 CCTAATATCAAAACCAGAAAAGG - Intergenic
1046496126 8:115015963-115015985 CCTCATATCAAAACCAGGCAAGG - Intergenic
1046510119 8:115191618-115191640 ACTAGTAAGAAAACAATGGAAGG + Intergenic
1046574240 8:116006008-116006030 CCTAATATCAAAACTAGACAAGG + Intergenic
1046675110 8:117099343-117099365 CCTCATTTTAAAACAAGGGAAGG - Intronic
1046841102 8:118858194-118858216 CCTAATGGGAGAACAAGGGCTGG - Intergenic
1047271512 8:123364440-123364462 CCTAATACCAAAACTAGGAAAGG + Intronic
1047332194 8:123900978-123901000 CCTAATACCAAAACCAGGGAAGG - Intronic
1047606950 8:126484439-126484461 CCCAATACCAAAACCAGGGAAGG - Intergenic
1047671721 8:127155317-127155339 CCTAATACCAAAACCAGGAAAGG + Intergenic
1047842651 8:128770237-128770259 CCTAATACCAAAACCAGGAAAGG - Intergenic
1047901539 8:129427823-129427845 CCTAATACCAAAACTAGGAAAGG - Intergenic
1048414942 8:134217090-134217112 CCAAACATGAAATCAAAGGAGGG - Intergenic
1048530753 8:135247600-135247622 CTTAATACCAAAACCAGGGAAGG - Intergenic
1048945202 8:139440566-139440588 CCTAATTTGGAAACAAGGCAAGG + Intergenic
1049897783 9:126187-126209 CCTAATACCAAAACCAGGAAAGG - Intronic
1050070517 9:1807838-1807860 CCTATGATGGAAACAAGGCAAGG - Intergenic
1050111205 9:2218405-2218427 CCCACTATTAAATCAAGGGACGG + Intergenic
1050147681 9:2586875-2586897 CCTAATACCAAAACCAGGAAAGG + Intergenic
1050428847 9:5540878-5540900 CCTAATACAAAAACCAGGGAAGG + Intronic
1050503111 9:6319138-6319160 CCTAATACCAAAACCAGGAAAGG + Intergenic
1051190360 9:14505330-14505352 CCTAATACTAAAACCAGGGAAGG - Intergenic
1051271498 9:15359802-15359824 CCTTATGGGAAAAAAAGGGATGG + Intergenic
1051277588 9:15411935-15411957 CCTAATACCAAAACCAGGAAAGG - Intergenic
1051601073 9:18874742-18874764 CCTAATACCAAAACCAGGAAAGG - Intronic
1051755985 9:20401340-20401362 CCTAATTAGAAAACACAGGAAGG + Intronic
1051929753 9:22370724-22370746 CCTAATATCCAAACCAAGGAGGG + Intergenic
1052247267 9:26350959-26350981 CCTAATACCAAAACCAGGAAAGG + Intergenic
1052325166 9:27209653-27209675 TGTAATATGAAAACTAAGGATGG + Intronic
1052624610 9:30959167-30959189 CCTAATACCAAAACCAGGAAAGG - Intergenic
1052731169 9:32288048-32288070 CCTAATACCAAAACCAGGGAAGG - Intergenic
1053161124 9:35814132-35814154 TCTAATATAAAATAAAGGGATGG + Intronic
1053212240 9:36240627-36240649 CCTAATACCAAAACCAGGAAAGG - Intronic
1053435655 9:38072423-38072445 TCTAATAAGAAAACTAGGGTGGG - Intergenic
1053740875 9:41136481-41136503 CCTAATACCAAAACCAGGAAAGG - Intronic
1054443863 9:65292628-65292650 CCTAATACCAAAACCAGGAAAGG - Intergenic
1054486410 9:65728875-65728897 CCTAATACCAAAACCAGGAAAGG + Intronic
1054687476 9:68294816-68294838 CCTAATACCAAAACCAGGAAAGG + Intronic
1054844528 9:69779226-69779248 CCTAATACCAAAACTAGGAAAGG - Intergenic
1055138195 9:72847580-72847602 CCTAGTATCAAAACCAGGAAAGG + Intergenic
1055204665 9:73713491-73713513 CCTAATACCAAAACCAGGAAAGG + Intergenic
1055905504 9:81289235-81289257 CCTAATACCAAAACCAGGAAAGG - Intergenic
1055906699 9:81302859-81302881 CCTAATACCAAAAGAAGGGAAGG + Intergenic
1056322425 9:85448866-85448888 CCTAATACCAAAACCAGGAAAGG - Intergenic
1056397008 9:86191040-86191062 CCTAATACCAAAACCAGGGAAGG + Intergenic
1056948400 9:91021296-91021318 CCTAATACCAAAACCAAGGAAGG + Intergenic
1057004137 9:91541451-91541473 CCTAATACCAAAACCAGGAAAGG + Intergenic
1057413212 9:94837420-94837442 CCTAATACCAAAACCAGGAAAGG + Intronic
1057476015 9:95402677-95402699 CCTAATACCAAAACCAGGAAAGG + Intergenic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1058156422 9:101521194-101521216 CCTAATACCAAAACTAGGAAAGG - Intronic
1058308104 9:103468195-103468217 CCTAATACCAAAACCAGGAAAGG - Intergenic
1058410768 9:104728616-104728638 CCTAATACCAAAACCAGGAAAGG + Intergenic
1058520458 9:105810446-105810468 CCTCATGTGAAATAAAGGGATGG + Intergenic
1058583867 9:106486070-106486092 CCCAGGAGGAAAACAAGGGAAGG + Intergenic
1059077972 9:111215140-111215162 CCTAATACCAAAACCAGGAAAGG - Intergenic
1059283249 9:113152096-113152118 CCTTATTTGTAAACAAGGGTTGG - Intronic
1059642889 9:116234819-116234841 CCTAAGATGAAAAGAAGTAAAGG - Intronic
1060306268 9:122415301-122415323 CCTAAGATAGGAACAAGGGAAGG - Intergenic
1060383523 9:123200392-123200414 CCTAATTAGAAAACTAGGAAAGG - Intronic
1061318200 9:129810759-129810781 GCTTATTTTAAAACAAGGGAAGG + Exonic
1062014822 9:134286022-134286044 CCTAAAATGAAAACAATGAGGGG - Intergenic
1062713918 9:137993862-137993884 CCTAATACCAAAACCAGGGAAGG + Intronic
1062728078 9:138089140-138089162 CCTAATATAAAAACCAGAGAAGG + Intronic
1203551903 Un_KI270743v1:170327-170349 CCTAATACCAAAACCATGGAAGG - Intergenic
1187218855 X:17304279-17304301 CCTAATACCAAAACCAGGAAAGG - Intergenic
1187589143 X:20696818-20696840 CCTAATACCAAAACCAGGGAAGG + Intergenic
1187695854 X:21919228-21919250 CCTAATACCAAAACCAGGAAAGG - Intergenic
1187749066 X:22441665-22441687 CCTAATACCAAAACCAGGAAAGG + Intergenic
1187776988 X:22771327-22771349 CCTAATACCAAAACCAGGAAAGG + Intergenic
1188045582 X:25422829-25422851 CCTAATACCAAAACCAGGAAAGG - Intergenic
1188389074 X:29597520-29597542 CCTAATACCAAAACCAGAGAAGG - Intronic
1188719285 X:33503506-33503528 CCTAATACCAAAACCAGGAAAGG + Intergenic
1188787627 X:34367733-34367755 CCTAATAGCAAAACCAGGAAAGG + Intergenic
1188889866 X:35596429-35596451 CCTAATACCAAAACTAGAGAAGG + Intergenic
1189218476 X:39348282-39348304 CCTAATACCAAAACCAGGAAAGG + Intergenic
1189413967 X:40798107-40798129 CCTAATACCAAAACCAGGAAAGG + Intergenic
1189604109 X:42657909-42657931 CCTAATACCAAAACCAGGGAAGG + Intergenic
1189650109 X:43179542-43179564 CCTAATACCAAAACCAGGAAAGG - Intergenic
1189932059 X:46023050-46023072 CCTAATACCAAAACCAGGAAAGG + Intergenic
1191037819 X:56046322-56046344 CCTAATACCAAAACCAGAGAAGG - Intergenic
1191065784 X:56345902-56345924 CCTAATATCAAAACTAGGAAAGG + Intergenic
1191223021 X:58011067-58011089 CCTAATACTAAAACCAGGGAGGG - Intergenic
1191770195 X:64747318-64747340 CCTAATACCAAAACCAGGAAGGG - Intergenic
1191806757 X:65143980-65144002 CCTAATATGAAAACCAGAAAAGG - Intergenic
1191820092 X:65296670-65296692 CTTAATACCAAAACCAGGGAAGG + Intergenic
1191888614 X:65917028-65917050 CCTAATACCAAAACCAGGAAAGG - Intergenic
1191903288 X:66061170-66061192 CCTAATACCAAAACCAGGAAGGG - Intergenic
1191909120 X:66128497-66128519 CCTAATACCAAAACCAGGGAAGG - Intergenic
1191918412 X:66226949-66226971 CCTAATACCAAAACCAGGAAAGG + Intronic
1192164254 X:68816231-68816253 CCTGATACCAAAACCAGGGAAGG + Intergenic
1192610000 X:72558255-72558277 CCTAATACCAAAACTAGGGAAGG + Intronic
1192674252 X:73178018-73178040 CCTAAGATGACAGCAAGGTAAGG + Intergenic
1192876899 X:75239615-75239637 CCTAATACCAAAACCAGGAAAGG + Intergenic
1192880800 X:75281740-75281762 CCTGATAGCAAAACCAGGGAAGG - Intronic
1192901057 X:75497493-75497515 CCTAATACCAAAACCAGGAAAGG + Intronic
1192944762 X:75953895-75953917 CCTAATACCAAAACCAGGAAAGG - Intergenic
1192978499 X:76313460-76313482 CCTAATACCAAAACCAGGAAAGG - Intergenic
1192985133 X:76390674-76390696 CCTAATATCAAAACCAGGAAAGG - Intergenic
1193016947 X:76744802-76744824 CCTAATACCAAAACCAGGGAAGG + Intergenic
1193307717 X:79969317-79969339 TCTAATACCAAAACAAGGAAAGG - Intergenic
1193382949 X:80837619-80837641 CCTAATACAAAAACCAGGAAAGG + Intergenic
1193405247 X:81092853-81092875 CCTAATACCAAAACCAGGAAAGG + Intergenic
1193469649 X:81884282-81884304 CCTAATACCAAAACCAGGAAGGG - Intergenic
1193517601 X:82488531-82488553 CCTAATACCAAAACCAGGAAAGG + Intergenic
1193636090 X:83950453-83950475 CCTAATACCAAAACCAGGAAAGG + Intergenic
1193662356 X:84272887-84272909 CCTAATACCAAAACCAGGAAAGG + Intergenic
1193703094 X:84787817-84787839 CCTGATACCAAAACAAGGAAAGG - Intergenic
1193775132 X:85631882-85631904 CCTAATACTAAAACCAGGAAAGG + Intergenic
1193785097 X:85751214-85751236 CCTAATACCAAAACTAGGAAAGG - Intergenic
1194028158 X:88779877-88779899 CCTAATACCAAAACCAGGAAAGG - Intergenic
1194232307 X:91339602-91339624 CCTAATACCAAAACCAGGGAAGG + Intergenic
1194602374 X:95938207-95938229 CCTAATACCAAAACCAGGAAAGG - Intergenic
1194606322 X:95983290-95983312 CCTAATATCAAAACCAGGAAAGG - Intergenic
1194882278 X:99268813-99268835 CCTAATACCAAAACCAGGAAAGG - Intergenic
1194887799 X:99339276-99339298 CCTAATACCAAAACCAGGGAAGG + Intergenic
1194906662 X:99585390-99585412 CCTAATACCAAAACTAGGAACGG + Intergenic
1194907024 X:99590513-99590535 CCTAATACCAAAACTAGGAATGG - Intergenic
1194926371 X:99829887-99829909 CCTAATACCAAAACCAGGAAAGG - Intergenic
1194967639 X:100307064-100307086 CCTAATACCAAAACCAGGGAAGG + Intronic
1195013648 X:100756953-100756975 CCTAATACCAAAACCAGGAAAGG + Intergenic
1195015779 X:100779089-100779111 CCTAATATCAAAACCAGCAAAGG - Intergenic
1195015940 X:100780853-100780875 CCTAATATCAAAACCAGCAAAGG + Intergenic
1195231677 X:102856050-102856072 CTTAATACCAAAACCAGGGAAGG - Intergenic
1195237395 X:102914820-102914842 CATAATATCAAAACCAGGGAAGG + Intergenic
1195812201 X:108846678-108846700 CCTAATACCAAAACCAGGAAAGG + Intergenic
1195838575 X:109147281-109147303 CCTAATACCAAAACCAGGGAAGG + Intergenic
1195855248 X:109324722-109324744 CCTAATACCAAAACCAGGAAAGG - Intergenic
1195984870 X:110618512-110618534 CCTAATATCAAAACCAGGAGAGG - Intergenic
1196101950 X:111855924-111855946 CATAATGGGAACACAAGGGAGGG + Intronic
1196171838 X:112596969-112596991 CCTAATACTAAAACCAGGAAAGG + Intergenic
1196465133 X:115964286-115964308 CCTAATACCAAAACTAGGAAAGG + Intergenic
1196519070 X:116651425-116651447 CCTAATACCAAAACCAGGAAAGG - Intergenic
1196575455 X:117312901-117312923 CCTAATACCAAAACCAGGAAAGG - Intergenic
1196599068 X:117580674-117580696 CCTAATATCAAAATCAGGAAAGG - Intergenic
1196648201 X:118140717-118140739 CCCAATATAAAAAAAAAGGAGGG + Intergenic
1196737856 X:118996007-118996029 CCTAATAACAAAACCAGGAAAGG + Intronic
1196935164 X:120723086-120723108 CCTAATACCAAAACCAGGAAAGG - Intergenic
1196947931 X:120846753-120846775 GCTAATATTAAAACCAGAGAAGG - Intergenic
1197054555 X:122101014-122101036 CCTAATACTAAAACCAGGAAAGG + Intergenic
1197081475 X:122423218-122423240 CCTAATACCAAAACCAGGAAAGG - Intergenic
1197132761 X:123023648-123023670 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197476018 X:126926443-126926465 CCTAATACCAAAACCAGGAAAGG - Intergenic
1197504243 X:127281826-127281848 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197519224 X:127476391-127476413 CCTAATACCAAAACAAGAAAAGG + Intergenic
1197545553 X:127819549-127819571 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197575972 X:128211896-128211918 CCTAATATCATAACCAGGAAAGG + Intergenic
1197589190 X:128387456-128387478 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197953996 X:131927085-131927107 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197956306 X:131952237-131952259 CCTAATACCAAAACCAGGAAAGG + Intergenic
1197956463 X:131954656-131954678 CCTAATACCAAAACCAGGAAAGG - Intergenic
1198559590 X:137834706-137834728 TCTAATACAAAAACCAGGGAAGG - Intergenic
1198604209 X:138318903-138318925 CCTAATACCAAAACCAGAGAAGG - Intergenic
1198616809 X:138466849-138466871 CCTAATACCAAAACCAGGGAAGG + Intergenic
1198987131 X:142467667-142467689 CCTAATACCAAAGCCAGGGAAGG - Intergenic
1199001546 X:142643919-142643941 CCTAATACCAAAACCAGGAAAGG - Intergenic
1199242077 X:145558920-145558942 CCTGATACTAAAACCAGGGAAGG + Intergenic
1199521192 X:148738093-148738115 CCTAATACTAAAACCAGGAAAGG - Intronic
1199553801 X:149084460-149084482 CCTAATACCAAAACCAGGAAAGG + Intergenic
1199587142 X:149427093-149427115 CCTAATACCAAAACCAGGAAAGG + Intergenic
1199668854 X:150124478-150124500 CCTAATACCAAAGCCAGGGAAGG + Intergenic
1199821417 X:151452419-151452441 CCTAATACCAAAACCAGGAAGGG - Intergenic
1199926626 X:152473533-152473555 CCTAATACCAAAACCAGGAAAGG + Intergenic
1200332999 X:155317723-155317745 CCTAATACCAAAACCAAGGAAGG + Intronic
1201352809 Y:13064530-13064552 CCTAAAACCAAAACCAGGGAAGG + Intergenic
1201369952 Y:13252804-13252826 CCTTATGGGAAATCAAGGGATGG - Intronic
1201971988 Y:19807952-19807974 CCTAATATTAAATCCAGGGAAGG + Intergenic
1202036091 Y:20637737-20637759 CCTAATATCAAAACCAGGAAAGG - Intergenic
1202132304 Y:21624308-21624330 CCTTATAGGAAATGAAGGGATGG + Intergenic