ID: 1101293924

View in Genome Browser
Species Human (GRCh38)
Location 12:103401335-103401357
Sequence TTTCTATTCTTGGACATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101293920_1101293924 -6 Left 1101293920 12:103401318-103401340 CCCCTAATGCACTGTGATTTCTA 0: 1
1: 0
2: 0
3: 21
4: 197
Right 1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG 0: 1
1: 1
2: 1
3: 25
4: 209
1101293922_1101293924 -8 Left 1101293922 12:103401320-103401342 CCTAATGCACTGTGATTTCTATT 0: 1
1: 0
2: 1
3: 27
4: 348
Right 1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG 0: 1
1: 1
2: 1
3: 25
4: 209
1101293921_1101293924 -7 Left 1101293921 12:103401319-103401341 CCCTAATGCACTGTGATTTCTAT 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG 0: 1
1: 1
2: 1
3: 25
4: 209
1101293919_1101293924 16 Left 1101293919 12:103401296-103401318 CCACATACAGGCACTGCAAAGAC 0: 1
1: 0
2: 2
3: 16
4: 208
Right 1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG 0: 1
1: 1
2: 1
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101293924 Original CRISPR TTTCTATTCTTGGACATCAG TGG Intronic
901428159 1:9196693-9196715 TTTCGATTCTGGAAAATCAGGGG - Intergenic
901913498 1:12479765-12479787 TTTCGATTCTTGGATATGAAGGG + Intronic
906903901 1:49867184-49867206 TTTCTGTTCTTTGGCATCCGTGG + Intronic
907908119 1:58803265-58803287 TTACTATCCTTGGACACCACAGG - Intergenic
908672424 1:66562892-66562914 TTTCTATTCTTAAAAATCACAGG - Intronic
909326653 1:74359813-74359835 TTTCTTTGCTTGGATATCTGAGG + Intronic
909591259 1:77351792-77351814 TTTGTCTTCTTCTACATCAGAGG - Intronic
910790668 1:91046626-91046648 TTTCTCTTCATGGAAAGCAGAGG - Intergenic
912111576 1:106348969-106348991 TTTTCATTCTTGGACTTCTGAGG - Intergenic
912345261 1:108957755-108957777 AATCTCTACTTGGACATCAGTGG - Intronic
912434444 1:109650657-109650679 TTTCTACTTTTGGGAATCAGGGG - Intergenic
912944544 1:114074139-114074161 TTTCTGTTCTTGGATTTCATTGG + Intergenic
916355082 1:163896734-163896756 TTTCTTTTTTTGGATATTAGTGG - Intergenic
917240935 1:172948049-172948071 TTTTTATTCTTGACCATCATAGG + Intergenic
917587334 1:176440863-176440885 TTTCTACTGTAGGTCATCAGTGG - Intergenic
919185253 1:194138013-194138035 GTTGTATTCTTGAATATCAGAGG - Intergenic
919776412 1:201197011-201197033 TATCAATTCTTTGCCATCAGAGG - Intronic
920218837 1:204380566-204380588 TTTATATTCTTGGCCATCTCAGG - Intergenic
921063814 1:211608610-211608632 TTTCTTCTCCTGGACATGAGTGG + Intergenic
921317977 1:213909878-213909900 CTTCTATTTTTGGTCATCAGAGG + Intergenic
921357783 1:214302903-214302925 TTTCTAATCTCTTACATCAGGGG + Intronic
923408073 1:233682731-233682753 TTTCTTTTATTGGATATCTGTGG + Intergenic
923687638 1:236164336-236164358 TTTTCATTCTTGTACATCTGGGG + Intronic
1063568840 10:7196015-7196037 TTTCTCTTCCTGGTCATCAGTGG - Intronic
1064372746 10:14767390-14767412 TTTCTATTAATGCTCATCAGGGG - Intronic
1066528783 10:36313216-36313238 TTTCTAATCTGGGCCATTAGAGG - Intergenic
1067770455 10:49119024-49119046 TTTTTAGTCTTATACATCAGTGG - Intergenic
1071255866 10:83871023-83871045 TTTCTATTCCTGCACATCCTAGG - Intergenic
1073638136 10:105220390-105220412 TTTATCTTCTTGGGTATCAGAGG + Intronic
1074594272 10:114846264-114846286 TTTTTATCCTTGGAGAACAGAGG + Exonic
1077823291 11:5774404-5774426 TTCCTATTCTTAGACATCTGTGG - Intronic
1079526505 11:21395746-21395768 ATTCTACTTTTTGACATCAGTGG + Intronic
1081497014 11:43622080-43622102 TTCCTATTTTTGGACAAAAGGGG - Intronic
1085167444 11:74415946-74415968 TTTCAGTCCTTGGACATCACTGG - Intergenic
1088838785 11:113604447-113604469 TTTCTTTTCTTGGAGAACAAAGG - Intergenic
1089059887 11:115617906-115617928 CTTCTATTTTTAGACACCAGTGG + Intergenic
1090180929 11:124698801-124698823 TCTCTGTCCTTGGACACCAGAGG - Intergenic
1090544003 11:127741539-127741561 TTTCTATTATTTTATATCAGTGG + Intergenic
1091019969 11:132090604-132090626 TTTCTCTTCTTTGACCTCACTGG + Intronic
1091155647 11:133369140-133369162 TCTCTTTTCTTGGAAATAAGAGG - Intronic
1091475525 12:768472-768494 TTTGTTTTCATGGACATAAGTGG + Intronic
1092310974 12:7352345-7352367 TTTCTATTTTTGGAGATGTGGGG - Intronic
1096534281 12:52261163-52261185 TTATTATTCTTGGAACTCAGGGG + Intronic
1096577661 12:52564075-52564097 TTTCTCCTCTTGGGCTTCAGGGG + Intergenic
1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG + Intronic
1101842289 12:108336700-108336722 TTGGTTTTCTTGTACATCAGTGG + Intronic
1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG + Intergenic
1102241560 12:111327747-111327769 TTCCTATTCTGGGAGAGCAGGGG - Intronic
1104397946 12:128451235-128451257 TTTCTATCCTTGAGCACCAGAGG + Intronic
1105543191 13:21332532-21332554 TTTCTCTTCTTGAACTTGAGGGG - Intergenic
1106429169 13:29663566-29663588 TTTATTTTCTTGGACTTCATGGG - Intergenic
1106891638 13:34252489-34252511 TTTCTATTCTTTGGCATAACAGG + Intergenic
1107230412 13:38103570-38103592 TTTATATTCATGTACATCAAAGG + Intergenic
1108161603 13:47645841-47645863 TTTCTTCTCTTTGACATCTGAGG - Intergenic
1108183664 13:47867015-47867037 TTTCAATTCTTGAACTTCATAGG - Intergenic
1109192565 13:59343081-59343103 TTTCTATTATTAAACATCAATGG - Intergenic
1109673576 13:65641837-65641859 TTTCTATTCTTGGTTTTCTGAGG - Intergenic
1110120627 13:71875991-71876013 CTTCTTTTCTTAGTCATCAGAGG + Intergenic
1110334160 13:74307325-74307347 TAGCTATTCTTGGAGACCAGAGG - Intergenic
1110589309 13:77236715-77236737 TTTTAATTCTTGGAAAACAGTGG - Intronic
1110860023 13:80337959-80337981 TTTGTATTGTTGTACATCACAGG - Intronic
1110968644 13:81733095-81733117 TTTCTATTTTTGTACCCCAGTGG - Intergenic
1111851213 13:93577466-93577488 TATCTATTTTTGAACAGCAGCGG - Intronic
1112594456 13:100795179-100795201 TTCTTATTCTTGTAGATCAGTGG - Intergenic
1112828180 13:103416553-103416575 TTTAAATTCTTTGACATTAGAGG + Intergenic
1113440295 13:110323235-110323257 TTCCTATGACTGGACATCAGAGG + Intronic
1115015541 14:28608132-28608154 TTTCTATTCTTTGCCATCTTTGG - Intergenic
1115190198 14:30739634-30739656 CTTCTATCCTTGGAGATCAAAGG + Intergenic
1115231042 14:31161173-31161195 TTTCTATTCTGAGACATTTGTGG + Intronic
1116865923 14:50031569-50031591 TTTCCATTCTGGGACCTGAGGGG + Intergenic
1121057331 14:90868988-90869010 TTTCTATTCTAGTAATTCAGTGG + Exonic
1122356408 14:101125669-101125691 TTAATATTTTTGGACCTCAGTGG + Intergenic
1124797807 15:32799563-32799585 TATCTGTTTTTGTACATCAGTGG - Intronic
1126659377 15:51017008-51017030 TTGTTATTCTTGGCCATAAGAGG + Intergenic
1132630593 16:915436-915458 TTTCTATTTATGGGAATCAGAGG + Intronic
1134117586 16:11560894-11560916 TTTCTGTTCCTGTACGTCAGAGG - Intronic
1134468715 16:14502354-14502376 TTTCTCCTCTAGGACATCAGAGG + Intronic
1139164998 16:64555429-64555451 TTGCTCTTCTTGTACTTCAGTGG + Intergenic
1141274685 16:82576618-82576640 TTTCTATTCAGGGAGACCAGGGG + Intergenic
1142370832 16:89680529-89680551 TATCTCTTTTTGGACTTCAGGGG - Intergenic
1143714729 17:8758666-8758688 TCTCTTTTCTTGGAGATCCGGGG + Intergenic
1143739384 17:8941558-8941580 TTGCTTTTCTTGGAAATCATTGG - Intronic
1144282799 17:13743551-13743573 TTTCTTTTCTTGGAAAGCTGAGG - Intergenic
1145765221 17:27454459-27454481 TTTCTAATTTTGTAGATCAGAGG - Intergenic
1147523347 17:41195975-41195997 TTATTATTATTGGACTTCAGAGG + Intronic
1147773303 17:42882784-42882806 TTAATTTTCTTTGACATCAGTGG + Intergenic
1149402674 17:56313991-56314013 TTTCAGTACTTGGTCATCAGGGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153166536 18:2267942-2267964 TCTCTATTAGTGGAGATCAGAGG - Intergenic
1154391883 18:13944452-13944474 TTTCTATTTATGTACAGCAGTGG - Intergenic
1155097857 18:22577218-22577240 GTGCTATTCTTAGACCTCAGTGG + Intergenic
1155235627 18:23816308-23816330 TTTCCTTTCTTGTACAGCAGGGG + Intronic
1155939628 18:31790556-31790578 TTTCTATTCTCCAACAACAGGGG - Intergenic
1156603207 18:38635331-38635353 CTTCTCTTCCTGGACCTCAGTGG - Intergenic
1156732643 18:40213079-40213101 TTTCTTCTCTTGTTCATCAGTGG + Intergenic
1157439579 18:47700359-47700381 TTACTATTCTTGAACCTCAGAGG - Intergenic
1158094228 18:53752795-53752817 TTTCATTTCATGGACCTCAGAGG - Intergenic
1158587855 18:58756742-58756764 TGGCTATTCTAGGACATCACAGG - Intergenic
1159268631 18:66119167-66119189 TTTCTATTCTTTTGCAGCAGAGG + Intergenic
1160070530 18:75623969-75623991 TTTCTTTTCATTGACAACAGTGG + Intergenic
1160166908 18:76521854-76521876 TTTGGATTGTTGGAAATCAGAGG - Intergenic
1167609626 19:50500900-50500922 TTGCTATTCTTGGGCCTGAGTGG - Intergenic
1168447441 19:56432575-56432597 TTTGCATTCTTGCACATCACTGG - Intronic
927214067 2:20656576-20656598 TTGCTATTGTTGAACAGCAGAGG + Intergenic
929157932 2:38804558-38804580 TTTTTATCCTTGGACACCATTGG - Intronic
931172397 2:59817286-59817308 CTTTTATTCTTGGGCTTCAGAGG - Intergenic
931219452 2:60276207-60276229 TTTTTTTTCTCGGACATCAGAGG + Intergenic
932506740 2:72240784-72240806 TTTCTATTCTAGCATATAAGAGG + Intronic
932703108 2:74004089-74004111 TCTCTGCTCTTGGACTTCAGAGG - Intronic
932933090 2:76065915-76065937 TTTCTATTTTTGAACAACAATGG + Intergenic
940313438 2:152303431-152303453 TTTCTTTGCTTGGAAATTAGGGG + Intergenic
940877619 2:158913946-158913968 TTTCTATTTTTGCACATCAGAGG + Intergenic
942720213 2:178942906-178942928 TTTTTGTTTATGGACATCAGAGG + Intronic
943997842 2:194794692-194794714 TTTGTATTCCTTTACATCAGTGG - Intergenic
944104655 2:196066984-196067006 TTACTATTTTTGAACAGCAGAGG - Intronic
944396784 2:199277077-199277099 TTCCTATTCTTTCACATAAGTGG - Intronic
945155966 2:206838099-206838121 TTTCTATTTTTGGAGATCAATGG - Intergenic
945169644 2:206982229-206982251 TTTCTTTTATTGGTCTTCAGAGG - Intergenic
948192550 2:236071151-236071173 GTTCATTTCTTTGACATCAGTGG + Intronic
1168836133 20:878564-878586 TTCCTGTTCTTGAACTTCAGAGG - Intronic
1170476281 20:16718112-16718134 TTTCTATCCATCTACATCAGTGG - Intergenic
1171067070 20:22027494-22027516 TTCACATTCTTGGACAGCAGAGG - Intergenic
1173748769 20:45459227-45459249 TTTCTATCCTTGGAAATCTTAGG - Intergenic
1175163063 20:57023019-57023041 TTTTCATTCTTCCACATCAGGGG + Intergenic
1176639999 21:9293462-9293484 TTTCTATTCCTTTACATCAGTGG - Intergenic
1177277828 21:18938019-18938041 TTTCTCTTCTTTGTAATCAGTGG + Intergenic
1178102765 21:29287687-29287709 TTTCTATTCTAGGCCATCTGTGG + Intronic
1178484412 21:33008911-33008933 TTTCTATTCTGGGATGTCAAAGG - Intergenic
1179184260 21:39072331-39072353 TTTCTATTCTTAAACTTCATGGG - Intergenic
1180349012 22:11782842-11782864 TTTCTATTCCTTTACATCAGTGG - Intergenic
1180373300 22:12066296-12066318 TTTCTATTCCTTTACATCAGTGG - Intergenic
1180424045 22:12900925-12900947 TTTCTATTCCTTTACATCAGTGG - Intergenic
1182171110 22:28230518-28230540 TTTATTCTCCTGGACATCAGAGG + Intronic
949102606 3:164043-164065 TTGCTATTCCTGGAAAACAGTGG - Intergenic
949147481 3:720118-720140 GTTCTATTTTTGAACATTAGAGG + Intergenic
949933963 3:9102152-9102174 TTTCTATTCTTAGGGATCACTGG + Intronic
950227056 3:11244395-11244417 GTTCTAGTCTTAGACATGAGAGG + Intronic
951583228 3:24187552-24187574 TTCTTATGCTTGGACATCAAGGG + Intronic
951630860 3:24718488-24718510 TTTGTATTCTTGGACATCAGTGG + Intergenic
957396303 3:79643210-79643232 TCTGTACTCTTGGACACCAGTGG + Intronic
957574026 3:81986428-81986450 TTTTTATCCTTGGAGTTCAGAGG + Intergenic
957775384 3:84751947-84751969 TTTCTTTCCCTGAACATCAGTGG + Intergenic
959658262 3:108835168-108835190 TGTCTATTCTTGTACATAGGAGG + Intronic
963194440 3:142510787-142510809 TTTCCATTCTTGGCAATAAGTGG - Intronic
964208091 3:154196825-154196847 GTTCTAGTCTTGGACATAAATGG + Intronic
964530059 3:157657827-157657849 TTTCTTTTCCTGGATATCTGTGG - Intronic
964812630 3:160682420-160682442 TGTTTAATCTTGGAAATCAGAGG - Intergenic
965364492 3:167781984-167782006 TTTCTCTTCTTGGTTACCAGTGG - Intronic
965909455 3:173753595-173753617 TTTCTATTCTTGTACCTCTAGGG + Intronic
966739972 3:183223526-183223548 TTGCTTTTCCTGGACAACAGGGG + Intronic
967258259 3:187615479-187615501 CTTCTGTTCTTTGAGATCAGTGG - Intergenic
967371969 3:188756763-188756785 TTTCTATTCTTGGGATACAGTGG - Intronic
1202746896 3_GL000221v1_random:111560-111582 TTTCTATTCCTTTACATCAGTGG + Intergenic
969105750 4:4805969-4805991 TTCCTCTTCCTGGACTTCAGGGG + Intergenic
970528024 4:16952578-16952600 TTTCTGTTCCTGGGAATCAGCGG - Intergenic
972370783 4:38421246-38421268 CTTCTGTTCTTGGGCATCAGTGG - Intergenic
974338618 4:60585181-60585203 TTTCTGTTCTTGGATACAAGTGG - Intergenic
974492215 4:62581042-62581064 TGGCCATTCTTGGATATCAGTGG + Intergenic
979991149 4:127377207-127377229 TCCCTAGTGTTGGACATCAGTGG - Intergenic
980478032 4:133345587-133345609 TTTTTTTTCTTGGATATAAGTGG + Intergenic
980536002 4:134124578-134124600 TTTCTATATTTTGACTTCAGTGG + Intergenic
980537080 4:134140088-134140110 TTTATATTCTTTGACCACAGGGG - Intergenic
980708496 4:136532208-136532230 TTTCCATTATTGGAAATCACAGG - Intergenic
981176008 4:141684237-141684259 TTACAATTCCTGGTCATCAGTGG - Intronic
983820633 4:172189486-172189508 TTTCTATTCTTAGAAATAAGTGG + Intronic
984436398 4:179715755-179715777 TGTCTATTCTTTGACAACATTGG + Intergenic
985353453 4:189092289-189092311 TTTCCATTCTTGGAGAGAAGGGG - Intergenic
985797760 5:1976089-1976111 TTTTTTTTCTTTGACAGCAGGGG + Intergenic
985904077 5:2819332-2819354 CTTCTACTTCTGGACATCAGGGG - Intergenic
986213341 5:5694906-5694928 TTTTCATCCTTGGACATCTGAGG + Intergenic
986231886 5:5872384-5872406 TTTCAATCTTTGGAAATCAGTGG + Intergenic
986251598 5:6063291-6063313 TTTCTTTTCTTACACATCTGAGG - Intergenic
986379101 5:7165261-7165283 TATCTCCTCTTGGAAATCAGAGG + Intergenic
986843494 5:11725221-11725243 TTTCTGTTGCTGGGCATCAGTGG - Intronic
994207016 5:97046723-97046745 TTTCTATTCTAGTGCAGCAGTGG - Intergenic
994724043 5:103413785-103413807 TTTCCACTCCTGGACTTCAGTGG - Intergenic
995259443 5:110084718-110084740 ATTCTATTCTTTGACTTCTGTGG + Intergenic
995469401 5:112484558-112484580 TTTCCATTCTTGGACCTGAAGGG - Intergenic
997523451 5:134537915-134537937 TTCCTATTCTTGGGCATGAGTGG + Intronic
997866270 5:137466223-137466245 ATTTTATTCTTGGACACAAGTGG + Intronic
997933759 5:138093164-138093186 TATCTATTCTCTGACATCTGTGG - Intergenic
998751038 5:145321610-145321632 TTTGTTTTATTGGACATAAGAGG + Intergenic
998884049 5:146675729-146675751 TTTCTTTGCATGGACAGCAGAGG + Intronic
1000652670 5:163836384-163836406 TTTAGATTCTTGGAAATGAGAGG + Intergenic
1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG + Intergenic
1003408794 6:5845268-5845290 TTTCTCTTCTTGAACTTGAGGGG + Intergenic
1004337656 6:14778903-14778925 TTTTCATTCCTGAACATCAGCGG - Intergenic
1005432246 6:25770349-25770371 ATTCCATTCTTGGAGATCTGAGG - Intronic
1006094958 6:31650288-31650310 TTTTTAATCTTGGAAATCACAGG - Intronic
1008120560 6:47611447-47611469 TTTCTTTACTTGGAGTTCAGAGG + Intronic
1008302294 6:49856080-49856102 TTTGTATTCTTGGTCAAAAGCGG + Intronic
1008924935 6:56881797-56881819 TTTCTATAATTTGCCATCAGTGG + Intronic
1010113832 6:72276214-72276236 TTTCTTTTCTTGGGGATCGGAGG - Intronic
1011527307 6:88278620-88278642 TTTCTTTTCTTTAACAACAGTGG + Intergenic
1013867321 6:114714202-114714224 TTTCTATTTCTGGAGTTCAGAGG - Intergenic
1013920893 6:115402366-115402388 TTTATATTGTTTGATATCAGGGG + Intergenic
1017429831 6:154360153-154360175 TAAATATTCTTGGACTTCAGGGG - Intronic
1020570913 7:9859885-9859907 TCTCTCTTCTTGGATATCAAAGG + Intergenic
1021196126 7:17676164-17676186 TTGCAATTCTTGGACTTCAGAGG + Intergenic
1024076879 7:45825554-45825576 TCTCTGTTTTTGGACAGCAGTGG + Intergenic
1025127540 7:56355869-56355891 TCTCTGTTTTTGGACAGCAGTGG - Intergenic
1025618752 7:63148498-63148520 TTTTCTTTCTTGGATATCAGGGG - Intergenic
1027166673 7:75839501-75839523 ATTCTATTTTTTGACATCTGGGG + Intergenic
1027808866 7:82866438-82866460 TTTCTCTTCTTGGACATGTGAGG - Intronic
1032510651 7:132469715-132469737 TTTCTATTCTTGGAGATTTTAGG - Intronic
1032558405 7:132861886-132861908 TTTCTATTCCTTGACACCTGAGG - Intronic
1033970068 7:147028101-147028123 TTTGTATTCTTGGACAAGAACGG - Intronic
1034435378 7:151060573-151060595 TTTGTGTTCTGGGACAGCAGGGG + Intronic
1038162559 8:25053976-25053998 TTTATCTTCTTGGACCTCAGGGG - Intergenic
1042061796 8:64826095-64826117 TTGATATTCTGGGACTTCAGTGG + Intergenic
1044202061 8:89449935-89449957 TTTATATTCTTGGACAAAGGTGG - Intergenic
1044799932 8:95943743-95943765 TTTCTTTTCTTGGAAATATGTGG - Intergenic
1044800378 8:95947915-95947937 TTTTCCTTCTTGGACATCTGCGG + Intergenic
1046749511 8:117912323-117912345 TTTCTATTTTAGGACCTAAGGGG + Intronic
1050789706 9:9451050-9451072 TTTTTATTCTTTGACCTCTGTGG - Intronic
1055801913 9:80047237-80047259 TTTATATTTTAGTACATCAGTGG - Intergenic
1056552799 9:87664967-87664989 TTGCTATTCTTGGGCCTGAGTGG + Intronic
1059234008 9:112747096-112747118 TTTCTTTCCTGGGACATCATTGG + Intergenic
1059474273 9:114531640-114531662 TTTCTGTTTATGGAAATCAGGGG + Intergenic
1059687677 9:116653088-116653110 TATCAACTCTTGGAGATCAGGGG + Intronic
1061646510 9:132006902-132006924 TTTCTGTTCTTGAAAGTCAGAGG - Intronic
1203715532 Un_KI270742v1:141653-141675 TTTCTATTCCTTTACATCAGTGG + Intergenic
1203649781 Un_KI270751v1:105233-105255 TTTCTATTCCTTTACATCAGTGG + Intergenic
1187779427 X:22801517-22801539 TGTCTGTTCTTGGACTTCAATGG + Intergenic
1188351088 X:29131628-29131650 TTTCTATTCCTCTAAATCAGTGG + Intronic
1189184640 X:39042985-39043007 TTCCTCTTATTGGACCTCAGAGG - Intergenic
1189554090 X:42124204-42124226 TTTCTAGTCTTGGAGGACAGTGG + Intergenic
1193828412 X:86256354-86256376 ATTCTCATCTTGGACATCAGTGG - Intronic
1194310511 X:92300807-92300829 TTTCTTTTCTTTGACATCCTTGG + Intronic
1194360837 X:92948733-92948755 TCTCTATTCTTGAACTTCAGGGG + Intergenic
1196112859 X:111965587-111965609 TTTCTATTCTTTTACATTTGCGG - Intronic
1197700912 X:129598893-129598915 TTTCTATCCATGGACATTTGGGG - Intergenic
1199672421 X:150158563-150158585 TTTCTATTCCAGGCCCTCAGGGG - Intergenic
1200016652 X:153169761-153169783 TTTCTATTCTGTCACATCATTGG - Intergenic
1200618797 Y:5415093-5415115 TTTCTTTTCTTTGACATCCTTGG + Intronic
1200669038 Y:6064548-6064570 TCTCTATTCTTGAACTTCAGGGG + Intergenic
1202624824 Y:56846567-56846589 TTTCTAGTCTTTGACTACAGAGG + Intergenic