ID: 1101294700

View in Genome Browser
Species Human (GRCh38)
Location 12:103409485-103409507
Sequence TTTACAATGCTGCAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101294700 Original CRISPR TTTACAATGCTGCAAGGGGG AGG Intronic
902321142 1:15667302-15667324 TTTACAATGCTGGAGGAGAGGGG + Exonic
905054736 1:35083346-35083368 CTCACTATGCTGCCAGGGGGTGG + Intronic
906894517 1:49756823-49756845 TTTACAATTCTGCATGGCTGGGG - Intronic
906991834 1:50747323-50747345 GGTACAATGATGCAAGGGGTGGG - Intronic
909167378 1:72246675-72246697 TCTACAATTCTGCAATTGGGAGG + Intronic
917634343 1:176920357-176920379 TTCACAAAACTGCAAGGGAGTGG + Intronic
917996422 1:180443541-180443563 TTTTCCAGGCTGCAAGGAGGGGG - Intronic
919394225 1:197024002-197024024 TTCACAATTCTGCATGGGTGGGG - Intergenic
919748826 1:201024237-201024259 TTTAAGATGCTGCAGGGTGGAGG - Intergenic
921377544 1:214490131-214490153 CTTACAATGAGGCAATGGGGTGG + Intronic
922069066 1:222173542-222173564 CTTACAATGGTGGAAGGGGAAGG + Intergenic
922737601 1:227996257-227996279 TTTACACTGCAGCAGGGAGGAGG + Intergenic
1063892850 10:10648116-10648138 TTTACATTGCTGCAAGGTGGTGG - Intergenic
1066058666 10:31703692-31703714 GTCACAATGATGCAAGGGGTGGG - Intergenic
1066654318 10:37684604-37684626 AATACAATGCTGCAATGAGGTGG + Intergenic
1067038902 10:42938228-42938250 AATACAATGCTGCAATGAGGTGG + Intergenic
1081224243 11:40501124-40501146 GTCACACTGGTGCAAGGGGGTGG + Intronic
1084944561 11:72631798-72631820 TTTGGAATGCTGCAGGGTGGTGG - Intronic
1085334561 11:75681504-75681526 TTTACAATGCTGCCATATGGTGG - Intergenic
1086338329 11:85822305-85822327 TGTACCTTGCTGCAAGGGGTGGG - Intergenic
1087552479 11:99668941-99668963 TTTAAAATGCTCCAACTGGGGGG + Intronic
1087921245 11:103869107-103869129 TTCACCATGCTCCAAGGGGCCGG - Intergenic
1087985909 11:104679219-104679241 GTTACAATGCTGAAAAGAGGAGG + Intergenic
1089445010 11:118545003-118545025 TTTAAAATGCTGCAAGGAAGAGG + Exonic
1092035446 12:5330623-5330645 TGTTCAATGCTGTAAGGGTGAGG + Intergenic
1092239332 12:6827787-6827809 TTTAAAATGCAGCAAGGAGGAGG - Intronic
1096885830 12:54718162-54718184 TTAAAAATGCTGCAATGGGCTGG - Intergenic
1098450697 12:70615356-70615378 TTTAAAATACTGCAAGGGAGGGG + Intronic
1098643907 12:72873508-72873530 TTTGCAATGCTTCCAGTGGGAGG + Intergenic
1101294700 12:103409485-103409507 TTTACAATGCTGCAAGGGGGAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104892362 12:132146568-132146590 TCTCAAATGCTGCCAGGGGGAGG - Intronic
1104908571 12:132228572-132228594 TTTGCAATTCTCCAAGGGGGTGG - Intronic
1106259701 13:28055618-28055640 TTTAGCATTCTGCAAGGTGGTGG - Intronic
1109691232 13:65892409-65892431 TTTCCATTGCTCCAAGTGGGGGG + Intergenic
1112249115 13:97762617-97762639 CTTACAAGGCTGCAGGGGGGCGG + Intergenic
1114852135 14:26394033-26394055 GTTACAATGGTGTAAGGTGGGGG + Intergenic
1115456638 14:33611870-33611892 TTTAAAAAGCTTCAAGGGAGAGG + Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116589647 14:46755328-46755350 TTTACAATCCTCCAAGGGGCAGG + Intergenic
1117057035 14:51922870-51922892 TTTCCAAGGCTGCAGGGTGGGGG + Intronic
1122323385 14:100868530-100868552 TTTACAAAGTTGCAATGAGGTGG - Intergenic
1126622668 15:50655699-50655721 TTTAAAGTGCTGCAATGGGCTGG + Intronic
1127045701 15:55023274-55023296 TTTACAATGTTGCAAATGGCAGG - Intergenic
1132058595 15:98671410-98671432 TTTACAATGCTGCTAAGGAGAGG - Intronic
1140272172 16:73476592-73476614 TTAACATTGCAGCAAGTGGGAGG + Intergenic
1140990136 16:80202747-80202769 TCTAGAATGTTCCAAGGGGGTGG - Intergenic
1144460344 17:15453571-15453593 TCTGCAATGCTGCACGAGGGTGG - Intronic
1144605300 17:16659388-16659410 CTTACAATGCTGCATGGCTGGGG + Intergenic
1145723002 17:27090191-27090213 TCTACAATGCTGGCAGTGGGGGG + Intergenic
1149311439 17:55397835-55397857 TTTAAAATGCTGAAAGGGTCCGG - Intronic
1150225340 17:63521745-63521767 TTTACAATGGTGGGTGGGGGAGG - Intronic
1153342817 18:3993039-3993061 TTTACATTTCTGCCAGGGGGAGG - Intronic
1153590430 18:6668851-6668873 TTTAAAAAGCTCCAAGGAGGGGG + Intergenic
1155124300 18:22856257-22856279 TTAAAAATGCTGAAAGGGGGAGG + Intronic
1156624359 18:38890484-38890506 TTCTCTCTGCTGCAAGGGGGAGG - Intergenic
1156959016 18:43000720-43000742 CTTACATGGCTGCAGGGGGGTGG - Intronic
1160570534 18:79814577-79814599 TTTACAGAGCTGGGAGGGGGTGG + Intergenic
1164897385 19:31888756-31888778 TTTACAATTCTGCAAAAGTGTGG + Intergenic
1165158706 19:33803469-33803491 TTTACAATGCTGCCTAGGGCAGG - Intronic
1166533323 19:43555383-43555405 TTTGCAAGGCTGCAGGAGGGAGG + Intronic
1168250891 19:55141364-55141386 TTCACCATCCTGCATGGGGGAGG - Intronic
926432801 2:12806701-12806723 TTTCCAGTGCTGCAATGGAGTGG - Intergenic
927073561 2:19554121-19554143 TTTATAATGCAGCAAAGGTGAGG - Intergenic
927619756 2:24641645-24641667 ATTAAAATGCTGAAGGGGGGTGG - Intronic
927728748 2:25450999-25451021 TTCACTATGCTGCCAGAGGGTGG + Intronic
935899494 2:107775481-107775503 TTTGCAATGCTTCAAGGGAGCGG + Intergenic
937253454 2:120538871-120538893 TTTACAAGGCTCCAGTGGGGTGG - Intergenic
939699883 2:145377064-145377086 TTTACATTCCTACAAGGGGGTGG + Intergenic
940554112 2:155200882-155200904 TTTAAAATGCTGCAATGCTGTGG + Intergenic
941447037 2:165615134-165615156 TTTCCAATGCTGAAATGTGGTGG + Intronic
942749025 2:179267196-179267218 TTTACAAGGCTGCATATGGGGGG - Intergenic
943062305 2:183051839-183051861 TTTACATGGCTGCAACTGGGGGG + Intergenic
945953882 2:216067088-216067110 TCTACACTGCAGCAAGGGAGGGG + Intronic
946022728 2:216652471-216652493 TTAACAATTCTGCTAAGGGGCGG - Intronic
946948994 2:224851805-224851827 TCTACAAAGCTGCAACGGGATGG - Intronic
1170365800 20:15597336-15597358 TTTACAGTGGTGCAAAGGGTAGG + Intronic
1171430618 20:25081483-25081505 TTTAGGATGCAGCAAGGGGCAGG + Intronic
1175261852 20:57679702-57679724 TTTGTTATGCTGGAAGGGGGTGG + Intronic
1177828190 21:26107176-26107198 TTTACAAAGCTCTAAGGGTGTGG - Intronic
1178015048 21:28335231-28335253 TTGACCAGGCTGCAAGGGGGAGG + Intergenic
1179317557 21:40257930-40257952 TTGATAATGCAGCAAGGGGAAGG - Intronic
1180913460 22:19469496-19469518 TCTAAAATGCTGCATGGGGAGGG - Intronic
1181045108 22:20210677-20210699 CTCACAAAGCAGCAAGGGGGAGG - Intergenic
1181597488 22:23925886-23925908 TTTAGAATGCTCCAAATGGGAGG + Intergenic
1184072910 22:42157160-42157182 TTTCCACAGCTGCAAGGGGACGG + Intergenic
953465983 3:43119914-43119936 TTTGCAAAGCTGCAAAGGAGAGG - Intergenic
953479191 3:43234899-43234921 TATATGATGCTGCAAGTGGGAGG - Intergenic
954363467 3:50134396-50134418 TTTACTATCCTGCACGTGGGGGG - Intergenic
957361415 3:79164104-79164126 TTTAAAATGGTCCAAGGGTGGGG + Intronic
959320384 3:104866626-104866648 TTCACAATGCTTAAATGGGGAGG + Intergenic
962137255 3:132747778-132747800 TTTAAAATGCTGAAAGAGGCTGG - Intergenic
963363166 3:144302898-144302920 ATCACAATGATGCAAGGGGTGGG + Intergenic
965684222 3:171284363-171284385 TTTAAAATGCTGCATGTGAGAGG - Intronic
970018792 4:11543134-11543156 TTTACAAAGCACCAACGGGGAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
981503044 4:145473090-145473112 GTTACATTGATGCAAGGGGTGGG + Intergenic
982644493 4:158006174-158006196 TATAAAATTGTGCAAGGGGGAGG - Intergenic
983985886 4:174060383-174060405 GTAACACTGGTGCAAGGGGGTGG + Intergenic
984864723 4:184271867-184271889 TTTCCCATGCTGGAAGGGGAAGG + Intergenic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
986220411 5:5763827-5763849 TTTACAAAGCTGCAGGGAGGAGG - Intergenic
996351848 5:122552367-122552389 TTTACAATTCTGGAAGGCAGAGG - Intergenic
996724671 5:126663835-126663857 GTTACAATGTTGCAAAGGGCTGG - Intergenic
998348709 5:141486800-141486822 GTTACAGTGCTGCTAAGGGGTGG - Exonic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
999525054 5:152395980-152396002 TTTAAAATTCTGCAATGGGTAGG + Intronic
1001252880 5:170162118-170162140 TTTACAATCCTGAAAGGGTCTGG - Intergenic
1005672142 6:28117418-28117440 TTTAAAATACTGCATTGGGGGGG - Intergenic
1010498561 6:76566732-76566754 GGCACACTGCTGCAAGGGGGTGG + Intergenic
1011172483 6:84521511-84521533 TTTAAAAGGCTGAAAGAGGGAGG + Intergenic
1011661817 6:89601281-89601303 TTTAGGATGCTGAAGGGGGGAGG + Intronic
1012867109 6:104631884-104631906 TTTACTATGCTGTAAGGGATGGG - Intergenic
1014926159 6:127272765-127272787 TTTTCAATTGTGCAAGGGGTTGG - Intronic
1018510584 6:164520298-164520320 GGCACAATGCTGCAAGGGGCAGG - Intergenic
1026535492 7:71235481-71235503 TGTCCAGTGTTGCAAGGGGGAGG + Intronic
1029683957 7:102132599-102132621 TGTACAATGTTGCAAGAAGGCGG - Intronic
1031295236 7:119993737-119993759 TTTAAAATGCTAAAAGGAGGAGG - Intergenic
1033098294 7:138449565-138449587 GTAAGAAAGCTGCAAGGGGGTGG - Intergenic
1034212103 7:149372991-149373013 TTTACATTGATGCAAGGAGTGGG + Intergenic
1034695873 7:153053104-153053126 TTAATAAAGCTGAAAGGGGGAGG - Intergenic
1035889123 8:3324607-3324629 TTAACAATGATGAAAGGTGGGGG - Intronic
1038781923 8:30575465-30575487 TTTACACTGCAGCCAGAGGGGGG + Intergenic
1039231287 8:35451456-35451478 TTTACAATGGTCCAAAGTGGTGG + Intronic
1040413982 8:47181287-47181309 TGGAGAAGGCTGCAAGGGGGTGG - Intergenic
1046597015 8:116272930-116272952 CTAACAATGCAGCAAGGTGGTGG + Intergenic
1050062760 9:1727587-1727609 TTTTGAATCCTGCAAGGGGGAGG - Intergenic
1051254351 9:15197381-15197403 TTCAAAATCCTGGAAGGGGGTGG - Intronic
1052303695 9:26981714-26981736 TTTAAAATGCTACAAGGGGTTGG - Intronic
1058877187 9:109254393-109254415 TTTTAAATGCTCCAAGGGGTCGG - Intronic
1185913198 X:4005156-4005178 TTTCCAATGAAGCAATGGGGAGG + Intergenic
1189904791 X:45746730-45746752 CTTTCAATACTACAAGGGGGAGG - Intergenic
1195434298 X:104824966-104824988 TTCACAATGCTTAAATGGGGAGG + Intronic
1196099185 X:111830076-111830098 GTTACAATGATGCAAGTGGTGGG - Intronic
1196121369 X:112054454-112054476 TCTACAATACTGCAAGAGAGAGG + Intronic
1197903703 X:131400524-131400546 TTTACAAATCTGTAAGGGAGGGG + Intergenic
1198629202 X:138616416-138616438 GTCACAATGATGCAAGGGGTGGG + Intergenic