ID: 1101299710

View in Genome Browser
Species Human (GRCh38)
Location 12:103466651-103466673
Sequence TGCAATCAGTGTACCACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101299710 Original CRISPR TGCAATCAGTGTACCACATG GGG (reversed) Intronic
902743697 1:18458662-18458684 TGCAATCCATGTCCCCCATGAGG + Intergenic
907988086 1:59552708-59552730 GGAAATCAGTGTATCACAGGAGG - Intronic
911203564 1:95070549-95070571 TGTAATCAGTGCTCCCCATGTGG - Intronic
915577187 1:156787121-156787143 TACAATCAGTTTTCCACATATGG + Exonic
915667772 1:157460456-157460478 TGCAGCTACTGTACCACATGTGG - Intergenic
919853396 1:201689280-201689302 TGCAATCAGTGAAATACATTTGG - Intronic
922272625 1:224048216-224048238 TGTAATAAGTGTACCCCATCTGG + Intergenic
1064127563 10:12676694-12676716 TGCTATCAGTGTATCATATTAGG - Intronic
1067402317 10:45988126-45988148 TCCAATCAATTTTCCACATGAGG - Intronic
1067870669 10:49957760-49957782 TCCAATCAATTTTCCACATGAGG - Intronic
1069011101 10:63373212-63373234 TACAATCAGAGTACCACTTGAGG - Intronic
1071093648 10:81948749-81948771 TGCAATCAGTGTGGGAAATGAGG - Intronic
1078443094 11:11383712-11383734 TGCAATCACCTTAACACATGGGG - Intronic
1081458632 11:43250302-43250324 TGTAATCAATCTACCACATTGGG + Intergenic
1082644955 11:55711713-55711735 TGCAACCAGGATATCACATGGGG + Intergenic
1091223593 11:133945077-133945099 TGCCATCTGTGTCTCACATGTGG + Intronic
1096985728 12:55755490-55755512 TGGAATCAGTTAACCACATCTGG + Exonic
1101299710 12:103466651-103466673 TGCAATCAGTGTACCACATGGGG - Intronic
1101459251 12:104873081-104873103 TCCAATGAATGTACAACATGAGG - Intronic
1105022329 12:132825304-132825326 TGCCATCACTGTACCTCACGTGG + Intronic
1105205220 13:18217669-18217691 TGCAAGCAGGGTGACACATGAGG - Intergenic
1105782503 13:23716514-23716536 AGCCTCCAGTGTACCACATGTGG - Intergenic
1105787328 13:23762500-23762522 TGCAATCAATTTAGGACATGGGG + Intronic
1111949517 13:94699723-94699745 TGCAATCAAGGTGCCACCTGGGG + Intergenic
1114144550 14:19959010-19959032 TGCATTTAGTTTTCCACATGTGG + Intergenic
1117995784 14:61476971-61476993 TGCAATCAGATTTCCTCATGCGG + Intronic
1121992214 14:98569368-98569390 TGCACTCAGTGTCTCATATGTGG + Intergenic
1122005502 14:98700191-98700213 TGCCAGCAGTGCACCAAATGAGG + Intergenic
1132168300 15:99619745-99619767 TGCATTATATGTACCACATGAGG - Intronic
1137545980 16:49403875-49403897 TGCAATCAGCCTACCTCAAGAGG + Intergenic
1137898124 16:52236290-52236312 TGCAATCAGTGTATGGCAAGTGG + Intergenic
1143166155 17:4898156-4898178 TGCAATGAGTGAGCCTCATGGGG + Exonic
1146108248 17:30062739-30062761 TGCAAGCACTCTTCCACATGAGG + Intronic
1151808665 17:76422795-76422817 TGCAGTCTGTGTGCCCCATGGGG + Intronic
1155340527 18:24809932-24809954 TGACATCAATGTCCCACATGAGG + Intergenic
1155697885 18:28705530-28705552 TGCAAACAGTGAAACACATAAGG - Intergenic
1156990412 18:43401619-43401641 TGCAGTTACTGTACCAGATGTGG - Intergenic
1168541318 19:57212792-57212814 TCCCATCAGTGTAACAGATGTGG + Exonic
1168546463 19:57254514-57254536 TCCTATCAGTGTAACAGATGTGG + Exonic
926551148 2:14302200-14302222 TGCAATCCTTGTACCACTTCTGG - Intergenic
929056517 2:37881653-37881675 TGCAAGCTGTGTGCTACATGTGG + Intergenic
930875418 2:56210179-56210201 TGTAATCTATGTACTACATGAGG + Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
935315940 2:101833878-101833900 TTCAATTAGTGAACCACATTAGG + Intronic
937542264 2:122971067-122971089 TGCAATCAGTCTACCATCAGTGG + Intergenic
938247189 2:129786965-129786987 TGCATTCAGTTGTCCACATGAGG + Intergenic
943543176 2:189242924-189242946 TGGAGTCAGGGTACCAAATGGGG + Intergenic
947622601 2:231600379-231600401 TGCATGCAGTGGACCACATGGGG - Intergenic
951502642 3:23406931-23406953 TGAAGTCAGTGTCCCCCATGAGG + Intronic
951665827 3:25122608-25122630 TGATATCAGAGTACCAGATGGGG - Intergenic
955151941 3:56376078-56376100 TGCAATCAATGTGCCACCTGGGG - Intronic
961292205 3:125856905-125856927 TGCAATTAGTGTCTCATATGAGG + Intergenic
962955605 3:140263434-140263456 AGCAACCAGTGAACCCCATGGGG - Intronic
963340848 3:144031220-144031242 TGCAATGTGTGTCCCTCATGAGG - Intronic
964644646 3:158946102-158946124 TGCAATCATTGTAGCATATTTGG - Intergenic
964944529 3:162203655-162203677 TGCAATGAGAGTACCAAATAAGG - Intergenic
966566266 3:181384936-181384958 TTAACTCAGTGTAGCACATGAGG + Intergenic
971049635 4:22846630-22846652 TGCAATCAGTTTTCCCAATGTGG + Intergenic
973370361 4:49241630-49241652 TCCAAACAGTTTACCACATATGG - Intergenic
975014324 4:69394567-69394589 TGTAAACAGTGCACCACATATGG - Intronic
976708475 4:88043178-88043200 TACAATCAGTGGAACACTTGAGG - Intronic
979283924 4:118899466-118899488 TTGAATCATTGTACCCCATGGGG - Intronic
979515825 4:121608876-121608898 GGCAACCAAGGTACCACATGAGG - Intergenic
979888658 4:126062997-126063019 TGCAGCCACTGTACCAGATGTGG - Intergenic
982944720 4:161605777-161605799 TGAAATCAGTCTACCACAAAAGG - Intronic
983582563 4:169323975-169323997 TGCAATTGCTGTACCAGATGTGG + Intergenic
983867802 4:172789324-172789346 TCCAATCCGTGTCTCACATGTGG + Intronic
989152797 5:38316964-38316986 AGCAAGCAGACTACCACATGGGG - Intronic
991538278 5:67697443-67697465 TGCAATCAGAGAAGCACATGAGG - Intergenic
993817021 5:92561313-92561335 TGCAATCAGTATGCCACAAGCGG - Intergenic
997681014 5:135750695-135750717 TGCTACCAGTCTACCACCTGGGG - Intergenic
998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG + Intronic
998669124 5:144333863-144333885 TGCCATCAGTTTGCCACATCTGG + Intronic
1000678991 5:164159757-164159779 TGCAAACAATGTACCACACTAGG - Intergenic
1003431249 6:6039928-6039950 TGTAAGCTGTGTACCAAATGAGG - Intergenic
1008520247 6:52356208-52356230 TGCTATCAGTATACCAGCTGGGG + Intergenic
1014197614 6:118577439-118577461 TGCCATCAGAGTTCCACAAGGGG + Intronic
1017800345 6:157890084-157890106 AGTAATCATTATACCACATGGGG - Intronic
1018535643 6:164816249-164816271 ATCAATCAGTGAAACACATGTGG + Intergenic
1027008695 7:74722739-74722761 TGCAGTAAGTGTGCCACGTGTGG - Intronic
1027337534 7:77169649-77169671 TGCTATCATTGTCCCACATTTGG + Intronic
1029778206 7:102701153-102701175 TGCTATCATTGTCCCACATTTGG - Intergenic
1031474553 7:122206169-122206191 TGCAATTGCTGTACCAGATGTGG - Intergenic
1032833868 7:135655399-135655421 TGCCTTCAGTGTATCACATCAGG + Intergenic
1036228946 8:6983314-6983336 TGCAATCAGTGGAAAACATCAGG - Intergenic
1036231397 8:7002419-7002441 TGCAATCAGTGGAAAACATCAGG - Intronic
1037280854 8:17240268-17240290 TGCAGCCAGTGGGCCACATGTGG + Intronic
1039385780 8:37134364-37134386 TGCAAGCAGTGTGACACATTTGG - Intergenic
1057221706 9:93261044-93261066 TGCATTCAGGGTACCCCATGGGG - Intronic
1186215746 X:7298701-7298723 TGCAATAATTGTACCACCTGGGG - Intronic
1189077607 X:37933627-37933649 TGCAATCTATGTACCACCTCAGG - Intronic
1190120549 X:47655859-47655881 TGCAACCAGTGGGCCACATGCGG + Intronic
1191831556 X:65420831-65420853 TGCATTTACTGTACCAAATGTGG + Intronic
1192057084 X:67784030-67784052 TGCAATCAGTCTACCACAGTTGG - Intergenic
1193454772 X:81717311-81717333 TGCAATCAGTGGCCAACATGAGG - Intergenic
1196911460 X:120488417-120488439 TGCCATCAGTGTCCCACAATGGG + Intergenic
1199310533 X:146315244-146315266 TGCAGCCACTGTACCAGATGTGG - Intergenic