ID: 1101302255

View in Genome Browser
Species Human (GRCh38)
Location 12:103495087-103495109
Sequence ATTGAATCTTGGAAGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101302255_1101302262 10 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302262 12:103495120-103495142 AGCAGGGAGCAGATGTGGGCAGG 0: 1
1: 0
2: 4
3: 69
4: 501
1101302255_1101302263 11 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302263 12:103495121-103495143 GCAGGGAGCAGATGTGGGCAGGG 0: 1
1: 0
2: 6
3: 74
4: 640
1101302255_1101302264 12 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302264 12:103495122-103495144 CAGGGAGCAGATGTGGGCAGGGG 0: 1
1: 0
2: 3
3: 97
4: 695
1101302255_1101302260 6 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302260 12:103495116-103495138 TGCCAGCAGGGAGCAGATGTGGG 0: 1
1: 1
2: 3
3: 23
4: 334
1101302255_1101302266 25 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302266 12:103495135-103495157 TGGGCAGGGGCTGCAGAACAGGG 0: 1
1: 0
2: 7
3: 64
4: 537
1101302255_1101302257 -7 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302257 12:103495103-103495125 ATTCAATATTAAATGCCAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 208
1101302255_1101302258 -6 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302258 12:103495104-103495126 TTCAATATTAAATGCCAGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 306
1101302255_1101302259 5 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302259 12:103495115-103495137 ATGCCAGCAGGGAGCAGATGTGG 0: 1
1: 0
2: 1
3: 37
4: 321
1101302255_1101302267 26 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302267 12:103495136-103495158 GGGCAGGGGCTGCAGAACAGGGG 0: 1
1: 0
2: 12
3: 410
4: 1729
1101302255_1101302265 24 Left 1101302255 12:103495087-103495109 CCTCTGGTCTTCCAAGATTCAAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1101302265 12:103495134-103495156 GTGGGCAGGGGCTGCAGAACAGG 0: 1
1: 0
2: 2
3: 64
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101302255 Original CRISPR ATTGAATCTTGGAAGACCAG AGG (reversed) Intronic
904515959 1:31055333-31055355 ATTGAATGAGGGAAGACGAGAGG - Intronic
905961172 1:42043853-42043875 CATGAATCTTGCAAGGCCAGAGG - Intergenic
906106746 1:43299330-43299352 TTTGGTTCTTGGAAGACCTGGGG - Intergenic
909935878 1:81550078-81550100 ATTGATTATTGGCAGAGCAGAGG + Intronic
911723105 1:101212708-101212730 ATTGACTCTTTGAAGACAATTGG + Intergenic
911753219 1:101522738-101522760 GTTGAATCTCTGAAGACAAGGGG + Intergenic
912261369 1:108114299-108114321 ACTGCATCTTGGAACACCATGGG + Intergenic
919174214 1:193999524-193999546 ATTGAACCTAGAAAGAACAGGGG - Intergenic
922061025 1:222091711-222091733 ACTAAATCTTGGAAATCCAGTGG + Intergenic
1064035942 10:11913390-11913412 ACTGAATCTTGAAAGGCAAGAGG + Intergenic
1064779836 10:18822919-18822941 AATGAATCATGAAAGGCCAGAGG + Intergenic
1068520117 10:58068583-58068605 AATGATCCTTGGAAGACAAGTGG + Intergenic
1069576114 10:69529631-69529653 ATGGAATCTTGAAATACCATTGG - Intergenic
1070485353 10:76925225-76925247 ATTGAAATTGGGAAGTCCAGTGG - Intronic
1078457020 11:11483308-11483330 ATAGACTCATGGGAGACCAGAGG - Intronic
1078770154 11:14342128-14342150 TTTGAATCTGGGAGGAGCAGTGG - Intronic
1078813232 11:14793018-14793040 AATGAATCTTTGAAGACAAATGG + Intronic
1079612185 11:22446961-22446983 AATGACTATTGGAAGAACAGTGG + Intergenic
1080430216 11:32190982-32191004 AGTGATTCTTTGAAGAACAGAGG - Intergenic
1091184485 11:133635682-133635704 ATTGCATCCTTGATGACCAGAGG - Intergenic
1095630162 12:44367078-44367100 GTTGAATTTTGGTAGAACAGAGG - Intronic
1096534114 12:52259899-52259921 ATTAAATCTTAGAACTCCAGAGG + Intronic
1097402134 12:59141328-59141350 ATTGAAAATTGAAAGAACAGAGG + Intergenic
1100236938 12:92670886-92670908 TTTGGATATTGGGAGACCAGCGG - Intergenic
1101302255 12:103495087-103495109 ATTGAATCTTGGAAGACCAGAGG - Intronic
1102227938 12:111242298-111242320 ACTGAATCCTTCAAGACCAGAGG + Intronic
1102941340 12:116945293-116945315 ATTGATTTTTGGATGACAAGGGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105225585 13:18428589-18428611 AATGAATATTGTCAGACCAGAGG + Intergenic
1106873414 13:34046046-34046068 AGAGAGTCTTGGAAGACCTGAGG - Intergenic
1107880297 13:44826704-44826726 ATTGAATCCCTGAAGCCCAGTGG - Intergenic
1110308169 13:74014793-74014815 ATTGAAACTTTGAAAACCAAAGG + Intronic
1110904923 13:80874948-80874970 ATGGAATCTTTGAATACCAAGGG + Intergenic
1111252741 13:85624950-85624972 ATTGAATCTTTGAAGACGCATGG - Intergenic
1111829331 13:93306977-93306999 AATGAAGCTTAGAAGATCAGTGG + Intronic
1113426440 13:110212426-110212448 ATTGCATCCTGGAATACCTGGGG + Exonic
1114711023 14:24778366-24778388 AGTGAAACTAGGAACACCAGAGG - Intergenic
1115874936 14:37850416-37850438 AAAGAATCTTGGGAGGCCAGTGG + Intronic
1116555533 14:46300186-46300208 TCTGAATATTGGAGGACCAGAGG + Intergenic
1120197902 14:81506282-81506304 ATTGAATCCATGAATACCAGAGG - Intronic
1121223330 14:92302780-92302802 ATGTATTCTTGGAGGACCAGGGG + Intergenic
1121649767 14:95549353-95549375 AATGATTCTTGGGAGAGCAGAGG + Intergenic
1124439803 15:29677744-29677766 ACTGCTTCTGGGAAGACCAGAGG + Intergenic
1125203781 15:37127882-37127904 ATTTTATCTTGAAAGAACAGTGG + Intergenic
1125845664 15:42850792-42850814 TTTGAATCTTGTATGACCTGTGG + Intronic
1126738284 15:51752665-51752687 GGAGAATCTTGGAAGAACAGAGG - Intronic
1126866447 15:52942293-52942315 AGTAAATCCTGGAATACCAGGGG - Intergenic
1127027896 15:54828329-54828351 ATTGAATCTTGGAACAGAAGAGG + Intergenic
1128361705 15:66966311-66966333 ATGGAATCTTGGAAGAGCAAAGG - Intergenic
1132251374 15:100337893-100337915 ACTGGATCGTGGAAGGCCAGTGG - Intronic
1135002953 16:18792134-18792156 ATGAAATCTTTGTAGACCAGAGG + Exonic
1137710993 16:50566742-50566764 ATTGGATCTTGGAAGAACCTAGG + Intronic
1138844219 16:60545618-60545640 ATTGAATTTTGGAAACCAAGGGG + Intergenic
1138851526 16:60635254-60635276 ATGGAATCTTGGAACAACGGAGG - Intergenic
1140682175 16:77395886-77395908 ATTGAAGCTTGGAGTAGCAGTGG - Intronic
1141215715 16:82021239-82021261 GTTGAGTCTTGGAGGACAAGGGG + Intergenic
1141887553 16:86902980-86903002 ATTGTATTTTGAAGGACCAGAGG - Intergenic
1144408633 17:14977113-14977135 ATTGAATCTTGGAACAAAAAAGG - Intergenic
1149113300 17:53061472-53061494 CATAAATCTTGGAAGGCCAGAGG + Intergenic
1149334012 17:55616866-55616888 ATTGCCTCAGGGAAGACCAGGGG + Intergenic
1150348082 17:64420151-64420173 TTTGGAACTTGAAAGACCAGAGG + Intergenic
1150429976 17:65107259-65107281 ATGGAAGCTGGGAAGACCAAGGG + Intergenic
1150708229 17:67507724-67507746 ATTGAAGGCTGGGAGACCAGGGG + Intronic
1154527793 18:15310933-15310955 AATGAATATTGTCAGACCAGAGG - Intergenic
1164968570 19:32509927-32509949 AAGGAAGCTGGGAAGACCAGAGG + Intergenic
1167290653 19:48623562-48623584 AGAGAATATTGGAAGCCCAGGGG - Intronic
925960961 2:9015548-9015570 ATTTCAACTTGGAAGTCCAGGGG - Intergenic
929967262 2:46544416-46544438 AGTGAATCTTGGAGGAGGAGGGG + Intronic
932461814 2:71886963-71886985 GTTGGATCTTGGAAGTCCAAAGG - Intergenic
932668108 2:73713511-73713533 ACTGAATCTTGGAAGTCTAAAGG + Intergenic
935049694 2:99514326-99514348 ATTGATTTATGCAAGACCAGAGG - Intergenic
935418699 2:102844656-102844678 ACTGCCTCTAGGAAGACCAGAGG + Intergenic
938526889 2:132142390-132142412 AATGAATATTGTCAGACCAGAGG - Intergenic
939870974 2:147525511-147525533 GTTGAATCCTCAAAGACCAGTGG - Intergenic
940962290 2:159798624-159798646 ATTGAATCTTGGAACAGAAAAGG - Intronic
941729842 2:168904867-168904889 ATTGCATTTTGGAAACCCAGAGG - Intronic
943837632 2:192533564-192533586 AATGAATCTTGAAAGAGAAGTGG - Intergenic
944183577 2:196924056-196924078 AGTGAATCTGGGAAAACCAGAGG + Intronic
944643522 2:201754092-201754114 CTTGAATCTGGGAAGGGCAGAGG - Intronic
945478399 2:210315102-210315124 AATGATTCTTGGAAGAGGAGTGG + Exonic
946343650 2:219089948-219089970 ATGGAATGTTGAAAGACCACAGG + Intronic
1169633924 20:7666121-7666143 TTTGAATATTGGCTGACCAGAGG - Intergenic
1171166377 20:22975468-22975490 ATGGAACTTTGGAAGAGCAGAGG + Intergenic
1176769639 21:13057612-13057634 AATGAATATTGTCAGACCAGAGG + Intergenic
1179239178 21:39573847-39573869 ATTGTATCTTGGAGGCTCAGAGG + Intronic
949791783 3:7800907-7800929 ACTGAATCTTGAAAGAACAGTGG - Intergenic
954868335 3:53748430-53748452 ATTTAATCCTGGGAGAACAGAGG + Intronic
959519522 3:107309375-107309397 AAGCAATCTGGGAAGACCAGAGG - Intergenic
960298627 3:115974647-115974669 GGTGAATCTTTGAAGACAAGGGG + Intronic
960574168 3:119213322-119213344 ATGGAATCTGGGAAGACAAGTGG + Intronic
960713982 3:120558190-120558212 CCTGAATCTTGGAGGACAAGAGG + Intergenic
962687945 3:137865489-137865511 ATTGAAATTTGGGAGACTAGGGG - Intergenic
963182326 3:142371960-142371982 GTTGAATCTTGAACTACCAGTGG + Intronic
963639347 3:147839209-147839231 ATTGTTTCTGGGAATACCAGGGG + Intergenic
965338159 3:167453811-167453833 TTGGAATCGTGGAAGATCAGTGG - Intronic
966064486 3:175801581-175801603 ATTGCATCTTGAAAGATGAGGGG - Intronic
969225931 4:5798426-5798448 ATTGATTTTTGCAAGCCCAGAGG + Intronic
970300366 4:14675156-14675178 ATTGATTCTTTGTAGCCCAGGGG - Intergenic
973318856 4:48789605-48789627 TTTGAATCTTGGATAAACAGAGG - Intergenic
975428535 4:74259385-74259407 ACAGAAGCTGGGAAGACCAGGGG + Intronic
976378869 4:84376806-84376828 ATTGACTCTGGGAAGACAATTGG + Intergenic
976499629 4:85772478-85772500 AATGAATCTAGGAAGGCAAGAGG - Intronic
977279477 4:95021589-95021611 AGTGAATTTTGGTAGACCAATGG - Intronic
984269115 4:177529290-177529312 GTAGATTCTTGGAAGACCTGTGG + Intergenic
985043453 4:185916247-185916269 ATTGAAACTAAGAAAACCAGGGG + Intronic
985246115 4:187981165-187981187 ATTAAAACTTGGTAGGCCAGGGG - Intergenic
985646231 5:1085947-1085969 CTTGAATCTGGGCAGAACAGAGG - Intronic
990015669 5:51059063-51059085 ATTCAATATTGGAAGTCCAGTGG + Intergenic
991613329 5:68470466-68470488 ATTTAATGTTGGAAAACCTGAGG - Intergenic
992361820 5:76046411-76046433 ATTGAGTCTTGAAAGAGGAGAGG + Intergenic
995446364 5:112248660-112248682 AAAGAAACTGGGAAGACCAGAGG - Intronic
996516639 5:124377456-124377478 GTAGAATCATGGAAGTCCAGAGG + Intergenic
997418426 5:133747488-133747510 ATTGAATCTGGGAGAACCCGAGG - Intergenic
997794460 5:136794865-136794887 ATTGTATCTTAGAAGCCCATGGG + Intergenic
998666280 5:144301363-144301385 ATTGAATTGAGTAAGACCAGAGG + Intronic
999352030 5:150881177-150881199 ATTGAATCTGGGGAGACCTTTGG - Intronic
999506334 5:152201328-152201350 ATTGTATCTCTGAAGACTAGTGG - Intergenic
1000284505 5:159815534-159815556 CATGAATTTTGGAAGGCCAGGGG + Intergenic
1003026873 6:2562878-2562900 AGTTAATCCTGGAAGACCGGAGG + Intergenic
1003723841 6:8736461-8736483 TTTGAATCTTGGAGGAGCAGAGG + Intergenic
1004137765 6:12984582-12984604 ATTCTTTCTTGGAACACCAGAGG - Intronic
1004889491 6:20086031-20086053 ATTGAATCTTAGGAGAGTAGAGG + Intergenic
1005119219 6:22371638-22371660 CTTGAAACTTTGAAGAACAGTGG + Intergenic
1007424625 6:41739020-41739042 TTTTAATTTTGGGAGACCAGTGG - Intronic
1007848937 6:44784695-44784717 AGTGAATTTTGGAAGGCTAGAGG + Intergenic
1008003185 6:46382141-46382163 AATAACTCTTGGAAGACAAGAGG - Intronic
1008856382 6:56093229-56093251 TGTGAATCTTTGAAGGCCAGAGG - Intronic
1009989762 6:70827395-70827417 ATTGAATTTTAGATGACCAAAGG + Intronic
1011512988 6:88121864-88121886 ATTGAATAGTGTAAAACCAGTGG - Intergenic
1012143637 6:95654066-95654088 GCTGAATCTTTGAAGAACAGGGG + Intergenic
1012164185 6:95927591-95927613 ATTAAATATTGCTAGACCAGAGG + Intergenic
1012176537 6:96093473-96093495 ATTGAAGCATTTAAGACCAGAGG + Intronic
1013553863 6:111236718-111236740 ATTAAATTTTAGATGACCAGGGG - Intergenic
1014769787 6:125447669-125447691 ATGGAATCTGGGATGGCCAGAGG - Intergenic
1014797715 6:125746320-125746342 AGTCGATCTTGGAAAACCAGAGG + Intergenic
1015540346 6:134307353-134307375 ATTTAATCTTTGAAGGCAAGTGG + Intronic
1017705372 6:157117864-157117886 AATGCATCTGGGAAGAACAGAGG - Intronic
1020583481 7:10034416-10034438 ATTGGGTCTTGGGACACCAGGGG - Intergenic
1021337129 7:19417460-19417482 AGTGAATATCGGAATACCAGGGG - Intergenic
1024366099 7:48522161-48522183 ATTGAATCTTGCAAGAAAATAGG + Intronic
1026125418 7:67575243-67575265 ATCGAGCCTTGGAAGACCACAGG - Intergenic
1027649309 7:80845731-80845753 ATTGAATGGTGGAAAACCATGGG + Intronic
1030842554 7:114373966-114373988 CTGGAATATTGGAAGATCAGAGG - Intronic
1031099426 7:117461050-117461072 AATGGATCTTGAAAGACAAGGGG - Intergenic
1033592907 7:142828811-142828833 ATGGTATCTTGGAAGTTCAGAGG + Intergenic
1035060478 7:156065789-156065811 ATTTAATCTGGGTAGATCAGGGG + Intergenic
1035636234 8:1146420-1146442 ATGGAATCTTTGATGATCAGAGG + Intergenic
1036103463 8:5813790-5813812 ATTGAATCTGGGAAGTGCTGTGG - Intergenic
1037486919 8:19356618-19356640 AATGAATCTGGGAACCCCAGTGG + Intronic
1037639548 8:20730300-20730322 ATTGAATCTTGTGAGACTACGGG + Intergenic
1038641782 8:29334718-29334740 CTTGATTCCTGGAAGTCCAGTGG - Exonic
1041196354 8:55405485-55405507 ATAGAATCTTGGAAGCCAAGAGG - Intronic
1042763760 8:72298552-72298574 GTTGAATCTTGGAAGCAGAGAGG - Intergenic
1044888685 8:96808544-96808566 GTTGAATTTGGGAACACCAGGGG + Intronic
1045544982 8:103120425-103120447 ACTGAATCTTGAAAGACAAACGG + Intergenic
1047215015 8:122869208-122869230 ATGGAGCCTTGGAAGACCACTGG - Intronic
1048848985 8:138626506-138626528 ACTGAATATTGGAATGCCAGTGG + Intronic
1051103427 9:13549324-13549346 ATTGACTCCTGGAAGAGCTGAGG + Intergenic
1054521874 9:66080456-66080478 ATTTAATCATGGATGAGCAGGGG - Intergenic
1185725030 X:2412745-2412767 ATTCAGTCTTTGAAAACCAGAGG + Intronic
1188889444 X:35591914-35591936 ATTAAATCTTTCAAGACCTGGGG - Intergenic
1188989812 X:36803711-36803733 ATTGAGACCTGTAAGACCAGGGG + Intergenic
1190434620 X:50411054-50411076 ATTCAAGCCTGGAAGACCCGTGG - Intronic
1194625451 X:96221478-96221500 CTTGACTCTTGGAAGATAAGTGG + Intergenic
1196735832 X:118980212-118980234 TCTGAATCTTGTAAGACCAGAGG + Intronic
1197487353 X:127069750-127069772 TTTGAATCTTTGAAGACCTGTGG + Intergenic
1197535732 X:127687433-127687455 ATTGAATCTTGTAACTTCAGGGG + Intergenic
1197691878 X:129509993-129510015 TTTGAATCTTGGTAGAACATAGG - Intronic