ID: 1101302883

View in Genome Browser
Species Human (GRCh38)
Location 12:103499516-103499538
Sequence ATGGAGAAGAGAAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3020
Summary {0: 1, 1: 0, 2: 30, 3: 358, 4: 2631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101302880_1101302883 3 Left 1101302880 12:103499490-103499512 CCATGAACTGTGAGCAAAACAAA 0: 1
1: 0
2: 4
3: 39
4: 347
Right 1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG 0: 1
1: 0
2: 30
3: 358
4: 2631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101302883 Original CRISPR ATGGAGAAGAGAAAGGAAGA TGG Intergenic
Too many off-targets to display for this crispr