ID: 1101302883 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:103499516-103499538 |
| Sequence | ATGGAGAAGAGAAAGGAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3020 | |||
| Summary | {0: 1, 1: 0, 2: 30, 3: 358, 4: 2631} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1101302880_1101302883 | 3 | Left | 1101302880 | 12:103499490-103499512 | CCATGAACTGTGAGCAAAACAAA | 0: 1 1: 0 2: 4 3: 39 4: 347 |
||
| Right | 1101302883 | 12:103499516-103499538 | ATGGAGAAGAGAAAGGAAGATGG | 0: 1 1: 0 2: 30 3: 358 4: 2631 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1101302883 | Original CRISPR | ATGGAGAAGAGAAAGGAAGA TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||