ID: 1101303981

View in Genome Browser
Species Human (GRCh38)
Location 12:103509049-103509071
Sequence TTAGCTGCACACCTTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101303981_1101303985 -7 Left 1101303981 12:103509049-103509071 CCTTGCTCAAGGTGTGCAGCTAA No data
Right 1101303985 12:103509065-103509087 CAGCTAATAGGTGACGGAGGTGG No data
1101303981_1101303984 -10 Left 1101303981 12:103509049-103509071 CCTTGCTCAAGGTGTGCAGCTAA No data
Right 1101303984 12:103509062-103509084 GTGCAGCTAATAGGTGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101303981 Original CRISPR TTAGCTGCACACCTTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr