ID: 1101312651

View in Genome Browser
Species Human (GRCh38)
Location 12:103597275-103597297
Sequence CCACGTCAGCAGCTCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101312651_1101312654 -3 Left 1101312651 12:103597275-103597297 CCATTTCAGAGCTGCTGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1101312654 12:103597295-103597317 TGGGTCTATCCTTCTTTCTGAGG 0: 1
1: 0
2: 0
3: 16
4: 218
1101312651_1101312656 23 Left 1101312651 12:103597275-103597297 CCATTTCAGAGCTGCTGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1101312656 12:103597321-103597343 CACATTCCCAAGCTCCAGAATGG 0: 1
1: 0
2: 0
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101312651 Original CRISPR CCACGTCAGCAGCTCTGAAA TGG (reversed) Intronic
900345697 1:2209266-2209288 CCATCTCAGCAGCCCTAAAATGG - Intronic
902790241 1:18762793-18762815 CCTCGGCACCAGCTGTGAAAAGG - Intergenic
903981674 1:27193126-27193148 CCAGGTCAGAAGCTGGGAAAAGG + Intergenic
907788204 1:57635009-57635031 CCAGTTCAGCATCTCTGAGATGG + Intronic
908491189 1:64645772-64645794 GCAGGTCAGCAGCTGGGAAAGGG + Intronic
909435927 1:75642391-75642413 TCACGTGAGCAGCTGTGAGATGG + Intergenic
909476109 1:76082467-76082489 CCTTGTTAGCAGCTCTGTAAAGG + Intronic
911378354 1:97079795-97079817 CCAGGCCTCCAGCTCTGAAACGG + Intronic
912775821 1:112505925-112505947 AAACATCAGCAGCTCTGAGAGGG - Intronic
913749798 1:121950433-121950455 CCACTTCCGTAGATCTGAAAAGG - Intergenic
1063168480 10:3484956-3484978 ACATGTCTGCATCTCTGAAATGG + Intergenic
1066267541 10:33790917-33790939 CCCAAACAGCAGCTCTGAAATGG - Intergenic
1069301793 10:66916951-66916973 CAACGTCAACAACTCAGAAAGGG + Intronic
1076769816 10:132656790-132656812 CCACCTGAGCAGCTGTGGAAGGG - Intronic
1084050920 11:66599388-66599410 CCTCTTCAGCAGCTCGGGAAGGG - Intronic
1085522170 11:77145359-77145381 CCATGTCCTCAGCTGTGAAATGG - Intronic
1085636485 11:78163218-78163240 CCATGACTGCATCTCTGAAATGG - Intergenic
1089765111 11:120757547-120757569 CCACCTCCACAGCTGTGAAAGGG + Intronic
1094090600 12:26644950-26644972 CCCCGTAGGCAGCTCTGGAATGG - Intronic
1094812223 12:34149641-34149663 CAATGTCAGCATCTCAGAAAAGG + Intergenic
1095810614 12:46371177-46371199 CCAAGCAAGCTGCTCTGAAAAGG - Exonic
1096242941 12:49968976-49968998 CCTCATCAGCAGCTCTCAACAGG + Intronic
1101312651 12:103597275-103597297 CCACGTCAGCAGCTCTGAAATGG - Intronic
1105841624 13:24258905-24258927 CCACGTCAGGAGCTTTGTCAGGG + Intronic
1107982090 13:45743642-45743664 CCACTTCTGCATTTCTGAAATGG + Intergenic
1110140675 13:72125506-72125528 CCAGTATAGCAGCTCTGAAATGG + Intergenic
1111676874 13:91398971-91398993 CCACGTCTGCAGCTCAGCCAGGG + Exonic
1113695818 13:112344580-112344602 TCTCGTTACCAGCTCTGAAAGGG + Intergenic
1118699293 14:68417424-68417446 ACACTTGAGCAGCTCTGGAAAGG - Intronic
1120925422 14:89792964-89792986 CCATGGCAGCTGCTCTCAAAGGG - Intergenic
1124655099 15:31501048-31501070 CAACATCAGCAGCACTGAAATGG + Intronic
1124686448 15:31786763-31786785 CCCCCTCAGGAGCTCTGAGAAGG + Intronic
1135740108 16:24967898-24967920 CCACATCAGCAGCGCTGATTTGG + Intronic
1137277242 16:46943884-46943906 CAACATCAGCAGTCCTGAAAAGG + Intergenic
1139523361 16:67497974-67497996 CCACGACAGAAGTTCTGAACTGG - Intergenic
1141460922 16:84178511-84178533 CCTCATCAGCAGCTCTGCAGGGG + Exonic
1141510141 16:84506572-84506594 CCACTTCGGTAGCTCTCAAACGG - Intronic
1141824171 16:86467606-86467628 CCATGTCAGCAGATCTGCGAAGG + Intergenic
1150021924 17:61625390-61625412 CAACTAAAGCAGCTCTGAAAGGG - Intergenic
1157772226 18:50359116-50359138 CCACATCAGCATTTCAGAAAGGG + Intergenic
1158783969 18:60686327-60686349 CCACTTCAGGACCTCTCAAATGG - Intergenic
1159600818 18:70427148-70427170 CACAGTCAGCAGCTCTGACATGG - Intergenic
1161165523 19:2785317-2785339 CCACCCCAGCGGCTCTGGAATGG + Intergenic
1163490019 19:17611953-17611975 CCAGGTCATCAGCCCTGATAGGG + Intronic
1164680872 19:30132876-30132898 CCAGGACAGCAGCTCAGAAGGGG - Intergenic
1165444892 19:35851304-35851326 CCAGGTCGGCCGCTCTGAGATGG - Exonic
925390320 2:3489944-3489966 CCAGGTCAGCGGCTCTGACAGGG - Intergenic
925918458 2:8623684-8623706 CCACAACAGCAGCTCCGAAGCGG - Intergenic
927705615 2:25294758-25294780 CCAAGTCATCTGCTCTGAAGTGG + Intronic
932014477 2:68010420-68010442 CGAAGTCAGCATCTCTCAAAAGG - Intergenic
935837006 2:107065668-107065690 CCACCTTAACAGCTCTTAAAAGG - Intergenic
941128062 2:161610900-161610922 CCAGTTTAGTAGCTCTGAAATGG - Intronic
942620641 2:177842171-177842193 CTAGGTCAGCAGCTTCGAAACGG - Intronic
947367968 2:229416341-229416363 CCACGCCAGCAACTCAGAGAGGG - Intronic
947956993 2:234200872-234200894 GGAAGTCAGCAGCTCTGAGAGGG + Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1169874386 20:10280922-10280944 CCACATCTGCATATCTGAAAAGG - Intronic
1172500792 20:35425611-35425633 CCAAGTCAGCACCTCTCAGAAGG + Intergenic
1172713652 20:36947106-36947128 CCAGGTCAGCAGCTTTGAGTTGG + Intronic
1174517870 20:51107121-51107143 CCAGGTCAGCAGTTCTCAACTGG + Intergenic
1177913454 21:27058236-27058258 CCACGTGACCAGCTGAGAAATGG + Intergenic
1178408385 21:32344717-32344739 CCATTTCAGCAGCTCTGGAAGGG - Exonic
1179912261 21:44456489-44456511 CCACTCTGGCAGCTCTGAAAGGG - Exonic
1181177312 22:21045108-21045130 CCACGCCAGCCGCTGTTAAAGGG + Intergenic
1183194868 22:36346467-36346489 CAGAGACAGCAGCTCTGAAAGGG - Intronic
1184413908 22:44341138-44341160 CCAAGACAGAAGCTCTGAGAAGG - Intergenic
950935511 3:16835095-16835117 CCACGTCACCAGCTCTGTGATGG + Intronic
953488084 3:43321792-43321814 CCATGGAAGCAGCTCTAAAAGGG + Intronic
953926620 3:46985844-46985866 CCAAGGCAGAAGCTCTGAGAGGG + Intronic
955744661 3:62128156-62128178 CCACGAAAGCTGCTCTGAAGTGG + Intronic
957564844 3:81871109-81871131 CAACTTCAGCAGTTCTAAAAAGG + Intergenic
960089369 3:113623619-113623641 ACAGCTCCGCAGCTCTGAAAAGG + Exonic
966448517 3:180030891-180030913 CCCCGCCAGCAGCTCCAAAATGG - Intronic
967668875 3:192207858-192207880 CCACTTCAGCGTGTCTGAAATGG - Intronic
967820009 3:193831666-193831688 CCGCGTTGGCAGTTCTGAAATGG - Intergenic
967925149 3:194640068-194640090 CCATGGCAGCAGCTCTGCAGAGG + Intergenic
968477383 4:818377-818399 CCATGTCAGCCTCTCTGAGACGG - Intronic
971010809 4:22432259-22432281 CCATTTCAGCAGGTCTGAAATGG - Intronic
975901879 4:79163183-79163205 GCAGCACAGCAGCTCTGAAAAGG + Intergenic
981844710 4:149154397-149154419 CCATGTCAGCAGCCCTTAAAGGG + Intergenic
982070117 4:151687290-151687312 CGAAGTCAGCACGTCTGAAATGG + Intronic
988636956 5:32995131-32995153 TCAGGTCAGCTGCCCTGAAATGG + Intergenic
988734472 5:34007214-34007236 CAGCGTCTGCCGCTCTGAAAGGG + Intronic
989592788 5:43127436-43127458 CCAATTCAGCAGGTCTGGAATGG - Intronic
990253965 5:53945930-53945952 ACAAGTCAGCAGCACTGAAGTGG + Intronic
993772975 5:91954203-91954225 CAACATCAGCACCTCTGGAAAGG - Intergenic
994246824 5:97488342-97488364 CCACGCCAGCTGCTGTGACAGGG + Intergenic
995800097 5:115984679-115984701 CCACGTCAACAGAACAGAAAGGG + Exonic
997364395 5:133316464-133316486 CCACCTCAGCAGCTCCGAACTGG - Exonic
997459761 5:134043971-134043993 CAGCTTCAGCATCTCTGAAATGG - Intergenic
998285262 5:140853752-140853774 CCACCTCAGAAATTCTGAAATGG + Intronic
1001255707 5:170182062-170182084 CCACAGCAGCAGCTGTGAGATGG - Intergenic
1002331956 5:178449296-178449318 CCACGTCTGCCGCTGGGAAATGG + Intronic
1003481108 6:6534294-6534316 CCACGTGAGCAGCTCTGAGCTGG + Intergenic
1004090053 6:12491959-12491981 CCTCTTCAGCAGCTCCGAAAAGG + Intergenic
1004637488 6:17483058-17483080 CCACCTGAGCAGGTCTGAATGGG - Intronic
1005123032 6:22412166-22412188 CCACATCAGAAGAACTGAAATGG - Intergenic
1006433123 6:34010334-34010356 ACACACCAGCAGCTCAGAAAAGG - Intergenic
1006986870 6:38181445-38181467 CCACATCAGCCACTGTGAAAGGG - Intronic
1007515481 6:42407246-42407268 CCACATCTCCAGATCTGAAATGG + Intronic
1008508496 6:52254168-52254190 CCAGGTGAGCAGAACTGAAATGG - Intergenic
1008584023 6:52932790-52932812 CCAGGCCAGCAGCCCAGAAAGGG - Intergenic
1010259929 6:73804108-73804130 CCATGTGACCAGCTCTGAGAAGG - Intronic
1013614185 6:111826259-111826281 CCTCCACACCAGCTCTGAAAAGG - Intronic
1017025967 6:150180843-150180865 CTACATCAGCAGGTCTGACAGGG + Intronic
1019406740 7:887965-887987 CCAGGTCTGCAGCTCTGAGGCGG + Intronic
1022797531 7:33744127-33744149 CCACGCCAGCAGCCCTGAGGTGG + Intergenic
1023841547 7:44101269-44101291 CCATGGCAGCAGCTCAGACACGG - Intergenic
1029271745 7:99381095-99381117 CCATGTCAGCAGGTCTGATGGGG - Intronic
1034501815 7:151455512-151455534 ACATGTCAGCAGCCCTGAGATGG - Intergenic
1034968493 7:155405480-155405502 CCAAGCCAGCAGCACAGAAAAGG - Intergenic
1035304365 7:157921714-157921736 GCATGGCAGCAGCTCTGACAAGG - Intronic
1041533732 8:58902365-58902387 CCAAGTCAGCAGTTCTAAATCGG + Intronic
1050456175 9:5836706-5836728 CCAACTCTGAAGCTCTGAAATGG + Intergenic
1056092698 9:83219705-83219727 CCTCCCCAGCGGCTCTGAAATGG + Intergenic
1059046882 9:110878616-110878638 CCATCTCAGCACCTCTGAAGTGG + Intronic
1060991791 9:127853774-127853796 CCTCCTCAGCAGCTCTGAGAGGG + Intronic
1186608596 X:11116333-11116355 CCACATCACCAGCTAGGAAATGG + Intronic
1187226169 X:17376518-17376540 CCACGTCTGCATCACTGAATCGG - Intronic
1194399198 X:93421967-93421989 CCAAGTCTGCTGCTCTGATATGG + Intergenic
1195685069 X:107577986-107578008 CCAGGTGAACAGCTCTGAAGGGG + Intronic
1199573334 X:149289728-149289750 CCACCTCCGCAGCTTGGAAAAGG + Intergenic
1201757353 Y:17500714-17500736 CAATGTCAGCATCTCAGAAAAGG + Intergenic
1201844201 Y:18405268-18405290 CAATGTCAGCATCTCAGAAAAGG - Intergenic