ID: 1101315892

View in Genome Browser
Species Human (GRCh38)
Location 12:103628546-103628568
Sequence TAGAAGCTTCAAAAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101315892_1101315896 12 Left 1101315892 12:103628546-103628568 CCATGCTCCTTTTGAAGCTTCTA 0: 1
1: 0
2: 7
3: 63
4: 433
Right 1101315896 12:103628581-103628603 TCCTTGCTTCTTTCATCCTCTGG 0: 1
1: 0
2: 17
3: 137
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101315892 Original CRISPR TAGAAGCTTCAAAAGGAGCA TGG (reversed) Intronic
901561376 1:10074231-10074253 TCCAAGCTTCAACAGCAGCAGGG - Intronic
902154687 1:14475249-14475271 TATAAGGTTCAAAAGGAGATTGG - Intergenic
905128069 1:35729951-35729973 TACAAGCTGCAGAAAGAGCAAGG + Intronic
905835509 1:41116961-41116983 TAGCGTCTTCAAAAGGAACATGG + Exonic
906670862 1:47653636-47653658 GAGAAGCTTGAGAGGGAGCACGG - Intergenic
908382913 1:63613405-63613427 TAGAGCCTTCAGAGGGAGCATGG - Intronic
908467142 1:64407772-64407794 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
908498334 1:64717881-64717903 TAGAGCCTTCAGAAGAAGCATGG - Intergenic
908891269 1:68850754-68850776 TAGAAACTTAAAAGGGAGGAGGG - Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909461260 1:75917106-75917128 TAAAAGCTTCAAAGAGAGGAGGG + Intergenic
911319316 1:96393432-96393454 TACAAGTTTTAGAAGGAGCATGG + Intergenic
912094695 1:106123886-106123908 TACAAGTTTCAGAAGGAGCACGG + Intergenic
912365462 1:109129950-109129972 TAGAACCTTCAGAGGGTGCATGG - Intronic
912583855 1:110743931-110743953 TAGCACCTTCAAAGAGAGCATGG + Intergenic
915445844 1:155974528-155974550 TGGAAGCTCATAAAGGAGCAGGG - Intronic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915707155 1:157855641-157855663 TAGAGGCTTCAGAGAGAGCATGG - Intronic
917450615 1:175144636-175144658 TGGAAGCTTCAGAAGGAGAGGGG - Intronic
918000097 1:180485601-180485623 TACAACCTTCACAGGGAGCATGG + Intronic
918634291 1:186756277-186756299 TAGAGACTTTAAAAAGAGCAAGG - Intergenic
918730686 1:187991639-187991661 GATAAGCTTCAAAGGCAGCATGG + Intergenic
919508311 1:198428195-198428217 TAGAGCCTTCACAGGGAGCATGG + Intergenic
921540759 1:216411756-216411778 TAGAGGTTTCAGAAAGAGCATGG + Intronic
921631980 1:217444860-217444882 TAGTACCTTGAAAAGGAGCTTGG + Intronic
921790331 1:219282576-219282598 TAGAAGCTTCCAAAGGGGAGGGG + Intergenic
922656979 1:227393763-227393785 TAGCACCTTCAGAGGGAGCACGG + Intergenic
923396117 1:233566472-233566494 TAGAGGCTGCAAAAGGTGGAAGG + Intergenic
923434976 1:233959626-233959648 TAGAAGCTTTAAAAGTTTCATGG + Intronic
923589363 1:235305245-235305267 TAGAAGCTGGAAAAGAGGCAAGG + Intronic
1065491677 10:26288564-26288586 AAGCAGCTTTAAAATGAGCAGGG + Intronic
1065849775 10:29778078-29778100 TAGAGCCTTCAGAGGGAGCAGGG + Intergenic
1065925687 10:30432854-30432876 TAGAAACTGCAGAGGGAGCACGG + Intergenic
1066226490 10:33388324-33388346 TAGAAGCTTGACAAGGACCAGGG - Intergenic
1067067404 10:43111706-43111728 GAGAAGCTGCAAAAGTTGCATGG - Intronic
1068001048 10:51334780-51334802 AAGAAGCTTAAACAGGAGCATGG + Intronic
1068128233 10:52867253-52867275 TAAAGGTTTCAGAAGGAGCATGG - Intergenic
1070638708 10:78150124-78150146 TGAAAGCTTTAAAAGGAGTATGG - Intergenic
1070997096 10:80794592-80794614 TATAATCTTCAAAAGGAAGATGG + Intergenic
1071070688 10:81690021-81690043 TACAGACTTCAAAGGGAGCATGG + Intergenic
1074670631 10:115786396-115786418 TAGAACCTTCCAAGGAAGCATGG - Intronic
1075318068 10:121467958-121467980 CAGAGCCTTCAGAAGGAGCATGG + Intergenic
1075681002 10:124331162-124331184 TAGAGCCTTCAAAGAGAGCAGGG + Intergenic
1076019344 10:127058100-127058122 AAGATGCTTCAAAAGGATCACGG + Intronic
1076228217 10:128797982-128798004 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1077586943 11:3461043-3461065 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1078240257 11:9524692-9524714 TAGATGCTGCAAGAGGAGTATGG + Intronic
1078794568 11:14579243-14579265 TAGAACCTTCAGAAGGATCATGG - Intronic
1078807898 11:14725127-14725149 TAGATACCTCAAAAGTAGCATGG - Intronic
1079246027 11:18752962-18752984 TAGAGGCTTAAAGATGAGCATGG - Intronic
1079619501 11:22535878-22535900 TAGAGGCTTTAGAAAGAGCACGG - Intergenic
1079756921 11:24275557-24275579 TAGAATCTTCACTGGGAGCATGG - Intergenic
1079887891 11:26011708-26011730 TAGAGACTTCAGAGGGAGCATGG + Intergenic
1080139860 11:28903823-28903845 TAGAGCCTTCAGAAGGAGAATGG - Intergenic
1080222323 11:29920477-29920499 TAGAAGCTGGAAAAAGAGAATGG + Intergenic
1080516970 11:33032369-33032391 TAAAAGCTTTAGAAGGAGCTGGG - Exonic
1081105644 11:39065507-39065529 TAGAGACTTCAAAGGGAGCAAGG + Intergenic
1081322497 11:41708244-41708266 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1082079710 11:48002850-48002872 GAGCAGCTTCAAAATGAGCTTGG + Intronic
1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG + Intergenic
1084242942 11:67835075-67835097 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1084533000 11:69740278-69740300 TGGAGCCTTCAGAAGGAGCAGGG - Intergenic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1086353448 11:85966892-85966914 TAGAAAATTCAGAGGGAGCATGG + Intronic
1087140714 11:94763046-94763068 GATAAGCTTCAAATGGAGCAGGG + Intronic
1088073631 11:105820086-105820108 TCCAAGCTTCAGAGGGAGCATGG + Intronic
1089479635 11:118793545-118793567 TATAACCTACAAAAGGAGCCCGG + Intergenic
1090212781 11:124934614-124934636 TAGAAGCTTCAGAGAGAGCATGG + Intronic
1090244981 11:125209791-125209813 TAGAAACGTCAAAAGCAGGAGGG + Intronic
1090375634 11:126286863-126286885 TGGAGCCTTCAGAAGGAGCACGG - Intronic
1090781156 11:130007828-130007850 TAGAGGCTTCAGAGGGAACAGGG + Intergenic
1091002414 11:131921437-131921459 TACAAGTTTCAAAGGGAGTATGG + Intronic
1091783509 12:3228846-3228868 TAGAGCCTTCGAAGGGAGCATGG - Intronic
1092679902 12:10967471-10967493 TAGGGGCTTGAAAAGCAGCATGG - Intronic
1093896449 12:24579975-24579997 GAGAAGTTTCAGATGGAGCATGG + Intergenic
1093938877 12:25031136-25031158 TTGAAACTTCAAAATGTGCATGG - Intronic
1094027966 12:25979077-25979099 TAGAAGCTCAAAAAGAAGCTTGG + Intronic
1094171201 12:27493990-27494012 TAGAAGTTTTTTAAGGAGCAAGG + Intronic
1094550075 12:31442302-31442324 TAGAAGCCTCGAAGGGAGCGTGG + Intronic
1094616840 12:32043563-32043585 TGGAGCCTTCAGAAGGAGCATGG - Intergenic
1095902001 12:47337458-47337480 TAGAAAATTCAAGAGGAGAAGGG + Intergenic
1097132206 12:56820230-56820252 TATAAAGTTCAAAAGCAGCAAGG + Intergenic
1097241698 12:57580187-57580209 TATAGGTTGCAAAAGGAGCAGGG - Intronic
1097631200 12:62064800-62064822 TAATAGCTTCCAAATGAGCATGG + Intronic
1098186145 12:67898319-67898341 TGGAAGCTTCAAATGGATAAGGG - Intergenic
1098338901 12:69431655-69431677 TACAGACTTCAGAAGGAGCACGG + Intergenic
1099504117 12:83450904-83450926 AAGTAGCTGCAAAAGAAGCAGGG + Intergenic
1099655441 12:85483594-85483616 GAGAAGCTCCAAAAGGTGAATGG + Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1099771350 12:87062037-87062059 TAGCACCTTCAGAGGGAGCATGG + Intergenic
1100140730 12:91615954-91615976 AAGCAGCTTCATAGGGAGCATGG + Intergenic
1100839546 12:98598596-98598618 TAGCAGCTTCCATAGGAGCCAGG - Exonic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1101315892 12:103628546-103628568 TAGAAGCTTCAAAAGGAGCATGG - Intronic
1101319758 12:103663343-103663365 TAGAGCCTTCAGAGGGAGCATGG - Intronic
1102586187 12:113924576-113924598 GAGAACCTTCAAAATGTGCAAGG + Intronic
1102888962 12:116543327-116543349 TAGAGCCTTCAGAAGGAGCTTGG - Intergenic
1103041788 12:117701852-117701874 TAGAGCCTTCGGAAGGAGCATGG + Intronic
1103300860 12:119925551-119925573 AAAAAGCTTCAATGGGAGCAAGG - Intergenic
1103859075 12:123997433-123997455 TAAAGCCTTCAAAGGGAGCACGG - Intronic
1104797274 12:131528433-131528455 TAGTAGCTGGGAAAGGAGCAGGG + Intergenic
1105602784 13:21901978-21902000 GAGAAGCTTGAGAAGGAGCCAGG - Intergenic
1105813568 13:24014125-24014147 TGGCACCTGCAAAAGGAGCATGG - Intronic
1106131950 13:26948292-26948314 CAGAAGCTTCGAGAGGAGCGGGG - Intergenic
1106655653 13:31743617-31743639 GAGAGGCTTGAACAGGAGCAAGG - Intronic
1106973608 13:35177405-35177427 TAGTACCTGCAAATGGAGCAAGG - Intronic
1107242226 13:38250189-38250211 TAGAGGCCTCAAAAGGAATAAGG + Intergenic
1107340167 13:39396946-39396968 TAGAACCTTCAGAGGGAGCATGG + Intronic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1107747961 13:43532527-43532549 TATAAGATTCAAAAGAAACAAGG + Intronic
1108373108 13:49790669-49790691 TAGATGCATGAAAAAGAGCATGG - Intronic
1109238568 13:59854203-59854225 TAGAAGCTGGAAGAGAAGCATGG + Intronic
1109478492 13:62916557-62916579 TAGAGCCTTCAAAACGAGTATGG + Intergenic
1109636889 13:65131859-65131881 TACAGGCTTCAGAAGGAGAATGG + Intergenic
1110053851 13:70939866-70939888 TAGAAGACTCAAAAGGAGACAGG + Intergenic
1110480543 13:75969336-75969358 TTGAAGCTTCAAGAGGGGTATGG + Intergenic
1110725907 13:78823362-78823384 TAGAGACTTCCAAGGGAGCATGG - Intergenic
1111264004 13:85782877-85782899 TAGAACCTTCAGAGAGAGCATGG - Intergenic
1112117522 13:96372982-96373004 TGGAGCCTTCAGAAGGAGCATGG - Intronic
1112616404 13:101010839-101010861 GAGAAGCTTGCGAAGGAGCAGGG + Intergenic
1113139519 13:107131489-107131511 TAGGATCTTCATAAGGACCAAGG - Intergenic
1113216657 13:108048767-108048789 TAGAGGCTTCAGAGAGAGCATGG - Intergenic
1113298631 13:108990741-108990763 TATAAGCTTCATAAGTAGGAGGG - Intronic
1118507040 14:66424882-66424904 TAGAACTTTCAGAGGGAGCATGG - Intergenic
1120292918 14:82600149-82600171 TAGAGCCTTCAAAGGCAGCATGG - Intergenic
1120801124 14:88689929-88689951 TAGAAGCATAAAAAGGAGACAGG + Intronic
1124733367 15:32219654-32219676 TAGGAACTTCAGAGGGAGCATGG + Intergenic
1125932469 15:43610381-43610403 TAGCAGCTTTAATGGGAGCAGGG + Exonic
1125945567 15:43709853-43709875 TAGCAGCTTTAATGGGAGCAGGG + Intergenic
1126315404 15:47364338-47364360 TCGCAGCTTCAAAATGACCAAGG + Intronic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1126828756 15:52577778-52577800 TAAAAGCTTTAAAAAGAACAGGG + Intergenic
1127130528 15:55857723-55857745 TATAAAATTCAAAAGGAGCCTGG + Intronic
1127621481 15:60738818-60738840 TAGCACCTTCAAAGGAAGCATGG - Intronic
1127911591 15:63420490-63420512 TAGAAGCTTCCAAGGAAGCATGG + Intergenic
1128347049 15:66860926-66860948 CAGAAGCTTCTAGAAGAGCATGG + Intergenic
1128355156 15:66921184-66921206 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1130033473 15:80336773-80336795 TAGAATCTTCAAAGGGAACATGG + Intergenic
1131483610 15:92802438-92802460 TGGAGGCTTCAGAAAGAGCATGG - Intronic
1133189485 16:4122948-4122970 TAGAACCTTCAAAAGAAGCGTGG + Intergenic
1133334446 16:4997739-4997761 TAGAACTTTCAGAGGGAGCACGG - Intronic
1133338140 16:5019908-5019930 TACAGCCTTCAGAAGGAGCAGGG - Intergenic
1133354386 16:5125285-5125307 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1133884219 16:9810674-9810696 TAGAGCCTTCAGAGGGAGCAAGG + Intronic
1133955043 16:10435267-10435289 TTGAGGTTTCATAAGGAGCATGG + Intronic
1135509849 16:23072966-23072988 TGCAAGCTTCAAGAGAAGCAAGG + Intronic
1135669455 16:24362543-24362565 TACTAGCTTCCAAAGGTGCAGGG - Exonic
1137273013 16:46915218-46915240 TGGAAGCATCATAAGGAGCAGGG - Intronic
1137555323 16:49466856-49466878 TAGAAGTTGCAAGAGGAGGAAGG + Intergenic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1137976291 16:53035087-53035109 TAGAGTCTTCAAAGGAAGCATGG - Intergenic
1140266696 16:73427511-73427533 TAGAAGCTTGGAAATGAGCATGG - Intergenic
1140644813 16:77017963-77017985 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1140825061 16:78698436-78698458 TAAAAGCTTAAAAAGGAGCTAGG - Intronic
1141812878 16:86387840-86387862 TGGAGGCTTCAGAGGGAGCAGGG - Intergenic
1142289702 16:89187952-89187974 GAGCAGCTTCGACAGGAGCAAGG + Intronic
1142947608 17:3445967-3445989 TAGAGCCTCCAAAAGGAACATGG - Intronic
1144644070 17:16957391-16957413 TAGAAGTTACAGAAGGAGAAGGG + Intronic
1145096230 17:20030028-20030050 TAGAGCCTTCACAGGGAGCATGG + Intronic
1145866385 17:28244628-28244650 TTGAAGCTTCCACAGGACCATGG - Intergenic
1146295464 17:31646579-31646601 TATAATCTTCAAAAGCATCAAGG + Intergenic
1149322738 17:55498034-55498056 TGGTACCTTCAAAAGGAACATGG - Intergenic
1149333292 17:55608558-55608580 TAGAAACTTCAGAAGGAGCAGGG - Intergenic
1150684423 17:67309135-67309157 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1150948480 17:69774907-69774929 TAGAATCTCCAAATGGAGCCTGG + Intergenic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1152187623 17:78867892-78867914 TAGAAGGTGCAAAAGGGGCCGGG - Intronic
1152478234 17:80532443-80532465 TAGAAGCAGAAACAGGAGCAGGG - Intergenic
1152611980 17:81320007-81320029 TAGGAGATTGAAAAGGAGCCTGG - Intronic
1153050038 18:893512-893534 TACAAGTTTCAGAAAGAGCATGG - Intergenic
1153328678 18:3849267-3849289 CAGAAGGCTCAAAAGGTGCATGG + Intronic
1153613913 18:6916533-6916555 TAGCAGCTTCACAAGGCACAAGG + Intergenic
1154321634 18:13358722-13358744 GAAAAACTTCAAAAAGAGCAGGG - Intronic
1154509648 18:15083210-15083232 TAGAAGTTTCAAAACCAACATGG - Intergenic
1155275956 18:24187761-24187783 GAGAAGCTACAGAAGCAGCATGG + Intronic
1155598589 18:27516826-27516848 TATAAGGTTCAGATGGAGCAGGG + Intergenic
1157681320 18:49609429-49609451 GAGAAGCTTCAGAAAGAGAATGG + Intergenic
1158698264 18:59722232-59722254 TACAGGCTTCAAAGGGAACATGG + Intergenic
1158748377 18:60227939-60227961 TACAAGCTGCACAAGAAGCATGG + Intergenic
1158819338 18:61141355-61141377 TTGAAGCTTAATAAGGACCAAGG + Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159674296 18:71262318-71262340 TACAGGTTTCAAAGGGAGCATGG + Intergenic
1159910640 18:74142505-74142527 TAGAGCCTTCAGAGGGAGCACGG - Intronic
1160035437 18:75297261-75297283 TGGAGCCTTCAAAGGGAGCACGG - Intergenic
1160037960 18:75318954-75318976 TAGAGGCTTCAGAGGGAGCATGG - Intergenic
1160038073 18:75319745-75319767 TAGAGGCTTTAGAGGGAGCATGG - Intergenic
1160730047 19:637695-637717 TACAGGCGTGAAAAGGAGCAAGG + Intergenic
1163077235 19:14904875-14904897 TTGAAGTTTCAACAGCAGCAGGG - Intergenic
1164531132 19:29049079-29049101 TGGAACCTTCAAAGGGAGCATGG - Intergenic
1164616799 19:29671988-29672010 TAGATGCTTCATAAGTAGCTTGG - Intronic
1165432397 19:35780377-35780399 GAGAAGGGTCAGAAGGAGCAGGG - Intronic
1165661658 19:37586008-37586030 TAGAACCTCCAGAAGGAACATGG + Intronic
926420833 2:12696458-12696480 TAAGAGCTTCAAAAGCTGCAGGG - Intergenic
926756636 2:16241775-16241797 CAGAAACTTCAAAGGGAGCTTGG - Intergenic
928977165 2:37100269-37100291 TGGAAGCCTCCAGAGGAGCATGG + Exonic
932003378 2:67905236-67905258 TAAAAGCTTCCAAAGGAAAATGG + Intergenic
932226923 2:70048761-70048783 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
932312037 2:70750646-70750668 TAGAGCCTTCAGAGGGAGCACGG + Intronic
933309327 2:80640301-80640323 TAGCAGATTCTGAAGGAGCAAGG + Intronic
934578541 2:95419092-95419114 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
934600903 2:95657617-95657639 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
935502597 2:103859405-103859427 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
935831043 2:107000719-107000741 TGGCAGCTCCACAAGGAGCAGGG + Intergenic
936234124 2:110729048-110729070 TAGAGCCTTCAAAAGTAACAAGG + Intergenic
936266327 2:111011454-111011476 TAGAAGGTTAAAAATAAGCAAGG + Intronic
936534277 2:113299768-113299790 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
936629247 2:114183242-114183264 TAGAGGCTTCAGAGGGAACACGG - Intergenic
937330485 2:121024275-121024297 TGGAAGCTTCAGAAGGAACAAGG + Intergenic
939655620 2:144820381-144820403 TGGAAGCATCAGATGGAGCAGGG + Intergenic
940429265 2:153569161-153569183 TAGAAGCTGCCAAATAAGCAGGG + Intergenic
940625900 2:156174910-156174932 TGGAAGCTGGAACAGGAGCAAGG - Intergenic
940677562 2:156743728-156743750 TAGAAGCTTCATGAGGACAAAGG - Intergenic
941344605 2:164352161-164352183 TAGCATCTTCAGAGGGAGCATGG - Intergenic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
942879774 2:180845207-180845229 TAGTAGCTCCAGAAGGAGAATGG + Intergenic
944389088 2:199198522-199198544 TAGAATAGTCAACAGGAGCAGGG - Intergenic
944644062 2:201760797-201760819 TAGAAACTTTAAAATGAGTAAGG - Intronic
945335551 2:208588619-208588641 TAGAGGTTTCAGAGGGAGCATGG + Intronic
946812893 2:223545174-223545196 TAGAATCTTTAAAAGGACAAAGG - Intergenic
947069439 2:226270560-226270582 TAGTGGTTTCAAAGGGAGCATGG + Intergenic
947162639 2:227229596-227229618 TGGAATCTTGAAAAGGAGAAAGG + Intronic
947281518 2:228460644-228460666 TAGAGTCTTCTAAGGGAGCACGG + Intergenic
947849432 2:233273509-233273531 TAGAAGTTTCAAAAGAAACAAGG - Intronic
1168807743 20:682618-682640 TAGAAGCTTCAGGGGGAGCTGGG - Intergenic
1169705682 20:8501589-8501611 TAGAAAATTCAGAAGGACCAGGG - Intronic
1169821044 20:9710481-9710503 TTGGAGCTTCATAAGGAGCTTGG + Intronic
1170392326 20:15889178-15889200 TGGAAGCTTGAAAAAGACCATGG - Intronic
1172427768 20:34867226-34867248 TAGAAGTTTCAAAAGAAGTGTGG + Intronic
1173854764 20:46243058-46243080 TGGAAGCTTAGAGAGGAGCAGGG - Intronic
1173951780 20:46999028-46999050 TGGAAGCTTGAAAAGGAGCTGGG + Intronic
1174279044 20:49425116-49425138 TAGAAGCCTCAAATTGGGCAGGG - Intronic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1174975817 20:55332494-55332516 TAGAACCTTCAGAGGGACCAGGG + Intergenic
1175373104 20:58505994-58506016 TACAGGCTTCAGAGGGAGCATGG + Intronic
1176788418 21:13288564-13288586 TAGAAGTTTCAAAACCAACATGG + Intergenic
1176910769 21:14561941-14561963 TAGAGGCTTTGAAAAGAGCATGG + Intronic
1177328333 21:19623058-19623080 TAAAAGCTCCAAAAGGATGAGGG - Intergenic
1177548786 21:22594394-22594416 TAGAAGCTACAAGAGAGGCACGG - Intergenic
1177599068 21:23287663-23287685 TAGATGCTTCCAAATGTGCAGGG + Intergenic
1177987566 21:27996769-27996791 TAGAAGTTTCAAAACCAACATGG + Intergenic
1178787612 21:35668114-35668136 TGGAGACTTCAAAAGGAGCATGG - Intronic
1178924396 21:36762730-36762752 TACAAGCTTCTTAAGGAGAACGG + Intronic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179773225 21:43640710-43640732 TAGAAGTTTCAAAAAGTCCAGGG - Intronic
1181973600 22:26712447-26712469 TACAGGCTTCAGAGGGAGCATGG + Intergenic
1182053839 22:27334211-27334233 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1182335105 22:29578827-29578849 CAGAGGCTGTAAAAGGAGCATGG - Intronic
1182782039 22:32875785-32875807 TGGAGCCTTCAGAAGGAGCATGG + Intronic
1182803714 22:33052921-33052943 CAGAACCTACAAAGGGAGCATGG + Intronic
1184009454 22:41736056-41736078 TAGAAGCTCCAAAGGGAGTGTGG - Intronic
1184654373 22:45933716-45933738 TACAATCTTAACAAGGAGCATGG + Intronic
950157970 3:10738235-10738257 TAAAATCTTCAAAAGCATCAAGG + Intergenic
951066691 3:18275225-18275247 TACAAGTTTCAGGAGGAGCATGG + Intronic
951754627 3:26076585-26076607 TAGAAACTTCAGAGGAAGCATGG + Intergenic
952379304 3:32792201-32792223 TAGATGCTTCAAAAATATCAGGG + Intergenic
953241280 3:41151524-41151546 AACAGGCTTCAAAAAGAGCAAGG + Intergenic
953461773 3:43087132-43087154 TAGAGCCTTCAGAGGGAGCATGG + Intronic
954125726 3:48527118-48527140 TAGCACCTTCAGAGGGAGCATGG + Intronic
954658796 3:52215312-52215334 GAGAAGCTTCAAAAAGGCCAAGG - Intergenic
954860384 3:53683406-53683428 AACAAGCTTCAAAAGGATCAGGG + Intronic
954990594 3:54837655-54837677 TAGAACCTTCAGAGGGAGCATGG - Intronic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956116320 3:65922564-65922586 TAGATCCTTCAAAGGAAGCAAGG + Intronic
956499462 3:69866321-69866343 TACAAGCTTTCAAAGGAGCATGG - Intronic
956916912 3:73881245-73881267 TAGAATCTTCAAAGGGAGCATGG - Intergenic
957903236 3:86524627-86524649 TAGAAACTTCAAAATTAACAGGG - Intergenic
957909297 3:86601692-86601714 TAGAACCATCAGAAAGAGCATGG - Intergenic
959163636 3:102748778-102748800 TATAAGCTTCTTAAGGAGGAAGG + Intergenic
959597684 3:108145903-108145925 TAGAACCTTCAGAAGTAGCATGG + Intergenic
959961711 3:112305215-112305237 AAGGAGCTCCTAAAGGAGCAAGG + Intergenic
960181137 3:114580986-114581008 AAGAATCTTAAAAAGGAACAAGG + Intronic
960517156 3:118615025-118615047 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
962313438 3:134342215-134342237 TAGCATCTTCAGAGGGAGCATGG + Intergenic
962654714 3:137531508-137531530 TAGAGGCTTCAAATGGACCATGG - Intergenic
962662835 3:137621758-137621780 TAGATCCTTCAGAGGGAGCATGG - Intergenic
963157651 3:142116519-142116541 TAGAGGCTTTACAGGGAGCACGG + Intronic
963410483 3:144921375-144921397 TGGATGATTCAACAGGAGCATGG + Intergenic
963422525 3:145078288-145078310 TAGAACTTTCAGAGGGAGCATGG - Intergenic
963941981 3:151104757-151104779 TAGAGGCTTCAGAGGGAGGATGG - Intronic
964017084 3:151960987-151961009 TAGAAGCATCATTAAGAGCACGG - Intergenic
964244891 3:154640336-154640358 TAGAAGCTTCAAAAAGCAAATGG - Intergenic
964642217 3:158921043-158921065 TAAAAGCTTGAAAAGGGGGAGGG - Intergenic
964815178 3:160709914-160709936 TAGAAACTTCAGAGGGATCACGG - Intergenic
964958067 3:162386882-162386904 GAGAGGCTTCAAAAGTAGCATGG - Intergenic
965653471 3:170958548-170958570 TTAGAGCTTCAGAAGGAGCATGG + Intergenic
965944336 3:174221736-174221758 TAGAAGCTTAAAAGGGTGCATGG - Intronic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
967077003 3:186012327-186012349 TAGAGGCTTCAAAGAGAGCATGG + Intergenic
969002125 4:3990852-3990874 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
969146451 4:5128149-5128171 TAGCACCTTCACAGGGAGCATGG + Intronic
969310957 4:6353051-6353073 TAGAACCTTCAGAGAGAGCACGG + Intronic
969811791 4:9653957-9653979 TAGAAACTTCAGAGGGAGCACGG + Intergenic
969912634 4:10459785-10459807 TAGAGGGTTCAGAGGGAGCATGG + Intergenic
970307733 4:14750659-14750681 TAGGAGCTTCAGAGGTAGCATGG - Intergenic
970438789 4:16061759-16061781 TAGAGGCTTCAGAAGGACCATGG - Intronic
970953245 4:21780830-21780852 TAGCAGCTTCAGAGGGAACATGG - Intronic
971247744 4:24945495-24945517 CAGAGCCTTCAAAGGGAGCATGG + Intronic
971364425 4:25966216-25966238 TAGATTCTTCCAAGGGAGCATGG - Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
972279820 4:37590946-37590968 TAGCAGCTTCTAAAGCTGCAAGG - Exonic
972693143 4:41419508-41419530 CATAAGCTTCACAAGGAGAAAGG - Intronic
973219349 4:47707887-47707909 TATTAGCTTTAAAAGGATCATGG - Intronic
973769506 4:54193349-54193371 TACAAGCTTCAAAATTATCAGGG - Intronic
973968888 4:56191238-56191260 TAGAACCTCCAGAAGGAGCCAGG - Intronic
974325680 4:60412238-60412260 TACAGGCTTCAGAAGGAGCATGG - Intergenic
974435213 4:61848313-61848335 TAGAGGCTTCAGAGGGAACATGG - Intronic
975351628 4:73353509-73353531 TAGAACCTTCAAAGAGAGCATGG + Intergenic
975928275 4:79486564-79486586 TAGAGGCTTCAGAGGGAACATGG + Intergenic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
976621979 4:87137622-87137644 TAGTAGTTTAAAAAGGACCAGGG - Exonic
977912069 4:102548660-102548682 TAGAGCCTTCAAAGGGGGCACGG - Intronic
978483080 4:109216680-109216702 TAGAGGCTTCAGAGGGAGCATGG + Intronic
979615589 4:122739135-122739157 TTGATCCTTCAGAAGGAGCATGG + Intronic
980127861 4:128790670-128790692 TAGAACCTTTAGAGGGAGCACGG - Intergenic
981076541 4:140598211-140598233 TAGAAGGTTTAGAAGGAGAAGGG + Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981447821 4:144860835-144860857 GAGAAGCTGCAAAAGGTGCTGGG - Intergenic
982449200 4:155531936-155531958 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
982812221 4:159840153-159840175 TTTAAGCGTAAAAAGGAGCAAGG - Intergenic
983351137 4:166590048-166590070 TAGAAGCTTCTAAAGGGCCCTGG + Intergenic
984441622 4:179778132-179778154 TAGGAGCTTGAATAGGAGCTGGG + Intergenic
984447632 4:179857096-179857118 CAGAAGTTTCAAAAGAGGCAGGG + Intergenic
984499567 4:180542120-180542142 TAGAAGCTTTATAACAAGCATGG - Intergenic
985665874 5:1181289-1181311 CAGAAGCCTCAGAAGGAGAAGGG - Intergenic
986708930 5:10473482-10473504 TAAAAGCTTCAGAGGGAGCAGGG + Intergenic
986847803 5:11776040-11776062 TAGAGCCTTCAGAGGGAGCATGG + Intronic
988258783 5:28855957-28855979 TAAAGGCTTCAGAAGAAGCATGG - Intergenic
988478076 5:31605684-31605706 TGGAAGTCTCAAAAGGAGAATGG - Intergenic
988650387 5:33142419-33142441 TAGAGTCTTCATAAAGAGCATGG + Intergenic
988928689 5:36014548-36014570 TGGAAGGTTAACAAGGAGCAAGG - Intergenic
988948889 5:36238034-36238056 TAGAAGATTTGAGAGGAGCAAGG + Intronic
989344659 5:40416457-40416479 TAGAGCCTTCAAAAGGAGCAGGG + Intergenic
989376208 5:40764432-40764454 AAGAAGCCTCAAAAGAATCAAGG + Intronic
990151968 5:52828793-52828815 TAGAGGCTTCAGAAGGAGTATGG - Intronic
990507668 5:56460559-56460581 AAGCAGCTTCTAAAGAAGCAAGG - Intronic
990831514 5:59964107-59964129 GAGAAGCTTCAAAAGAGGAAAGG + Intronic
991076022 5:62539209-62539231 TAGACCCTTCAGAAAGAGCAAGG - Intronic
991581013 5:68155371-68155393 TAGAACCTTCAGAGGGATCATGG - Intergenic
991939609 5:71838088-71838110 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
992025347 5:72664228-72664250 GACAAGCTGGAAAAGGAGCAGGG - Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
992287035 5:75246665-75246687 TAGAACCTTCAGAAAGAGCATGG - Intergenic
993340226 5:86716404-86716426 TTCAAGCTTCAAAAGGAGCATGG - Intergenic
994150672 5:96444127-96444149 TACAAGCTCCATAAGGGGCAAGG - Intergenic
994426054 5:99588275-99588297 TACAGGTTTCAAAAGAAGCATGG + Intergenic
994965905 5:106670367-106670389 TAGAAGGTTCTACAGGGGCATGG - Intergenic
995016738 5:107318404-107318426 TAAAAGCTTCAAAGTGAGCATGG + Intergenic
995796722 5:115949014-115949036 TAGAAGCTACAAATGGAGGTAGG - Intergenic
996070734 5:119128390-119128412 GAGAAGCATCAACAGCAGCATGG - Intronic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
997825550 5:137103885-137103907 AAGAAGGTTGAAAATGAGCAAGG + Intronic
998169745 5:139865500-139865522 CAGAAGCTTTCTAAGGAGCAGGG + Intronic
998204795 5:140150668-140150690 TAGATGCTTGAAACGCAGCAAGG + Intergenic
998888007 5:146714897-146714919 TCTCAGCTTCAAAAGGAGAAGGG - Intronic
998945240 5:147331904-147331926 GAGAAGTTTCAGAGGGAGCATGG + Intronic
999888986 5:155956635-155956657 TAAAACCTTCCAAGGGAGCACGG - Intronic
1000105140 5:158052473-158052495 TTTATGCTTCAAAGGGAGCAGGG - Intergenic
1000393319 5:160747651-160747673 TAGAGGCTTCAGAGGGGGCATGG + Intronic
1001170002 5:169410268-169410290 TAGAAGCTTCAGAGGGGGCATGG + Intergenic
1002384511 5:178856243-178856265 TAGAAGACTCAAGAGGAGAAGGG + Intergenic
1003223213 6:4180302-4180324 TAGCACCTTCAGAGGGAGCATGG + Intergenic
1003495898 6:6662995-6663017 TCGCAGCTTCAGAGGGAGCATGG - Intergenic
1004269904 6:14185722-14185744 TAGAACCTTTGAAGGGAGCATGG + Intergenic
1004565525 6:16792599-16792621 TAGAGACTTCACAGGGAGCATGG - Intergenic
1004567170 6:16808679-16808701 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
1004819777 6:19354778-19354800 TACAAGCTTCAAACAAAGCATGG - Intergenic
1004837912 6:19548864-19548886 TTAAACCTCCAAAAGGAGCATGG - Intergenic
1006533705 6:34679939-34679961 TAGAAACTTCAGAGGGATCATGG + Intronic
1007307668 6:40919464-40919486 TAGAAGCTGACACAGGAGCAGGG - Intergenic
1008289245 6:49693493-49693515 TAGAAACATCAAAAGGAAAAGGG - Intronic
1008433915 6:51453345-51453367 TAGATGCTTTATAGGGAGCAAGG + Intergenic
1008642173 6:53475258-53475280 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1008844469 6:55946441-55946463 TAGAAACTTCAAAAGGAGTGTGG - Intergenic
1009298722 6:61987979-61988001 TACAAGCATCAAAAGAACCAAGG + Intronic
1009533651 6:64852832-64852854 TAGACCCTTCAGAGGGAGCATGG + Intronic
1009838342 6:69034165-69034187 CAGATTCTTCAAAAGGAGGAAGG - Intronic
1009888241 6:69650621-69650643 TAGAAACTTCAGAGGGAGCATGG - Intergenic
1010154927 6:72781297-72781319 TAGAGTCTTCATAGGGAGCATGG + Intronic
1010944615 6:81959371-81959393 TAAAAGGTTCACTAGGAGCAAGG + Intergenic
1011027279 6:82882883-82882905 TCAAAGCTTCAAAAAGGGCAAGG + Intergenic
1011078273 6:83461444-83461466 TACAGGCTTCAGAAGGAACATGG + Intergenic
1012196213 6:96344216-96344238 TAAAAGCCTCCAAAGGAGCAGGG + Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013834993 6:114324045-114324067 TATAAGATTCAAGAGGAGGAAGG + Intronic
1013996387 6:116313228-116313250 TGTAGGCTTCAGAAGGAGCATGG + Intronic
1014060398 6:117064940-117064962 TACAGGTTTCAACAGGAGCATGG - Intergenic
1014200000 6:118598658-118598680 TAGACCCTTCAGAGGGAGCATGG + Intronic
1014760308 6:125348920-125348942 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
1014994314 6:128123246-128123268 TAGAAACTTCAGAGAGAGCATGG + Intronic
1015308466 6:131736850-131736872 TAGAGCCTTCAAAAAGAACATGG - Intronic
1016942099 6:149490973-149490995 TAGAGGCTTCAGAGCGAGCATGG + Intergenic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1018022002 6:159770116-159770138 AACAAGCCTCAAAAGGATCAAGG + Intronic
1019412449 7:912193-912215 CAGAAGCTCCGACAGGAGCACGG + Intronic
1019916681 7:4137626-4137648 TATGAGCATTAAAAGGAGCAAGG - Intronic
1021061368 7:16117009-16117031 TAGATGCTAAAAAAGCAGCAGGG - Intronic
1022507209 7:30914625-30914647 TGGATGCCTCAAGAGGAGCAGGG + Intronic
1022627389 7:32051832-32051854 TGGAACCTTCAAAAGGAAAAGGG - Intronic
1022841281 7:34166276-34166298 TAGAAACTTTTAAATGAGCATGG - Intergenic
1023535993 7:41211594-41211616 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
1023564353 7:41508681-41508703 TAGAAGCTGGAGAAGCAGCATGG - Intergenic
1024436648 7:49364486-49364508 TAACACCTTCAGAAGGAGCATGG - Intergenic
1024837682 7:53542711-53542733 TAGGAGCTGCACCAGGAGCAAGG + Intergenic
1028025974 7:85840470-85840492 TATAAGCTTCAAGAGGTTCAGGG + Intergenic
1028528750 7:91814774-91814796 TAGCAGCTTCAGAGGAAGCATGG + Intronic
1028555149 7:92115527-92115549 TAGAACCTTAAGGAGGAGCACGG + Intronic
1029334838 7:99889822-99889844 TAGAAGCTTTGAAGGGAGCATGG - Intronic
1029617359 7:101667470-101667492 TAGAAGCTCCAAGAGGATCAGGG - Intergenic
1030426956 7:109390182-109390204 CAGAAGCTTCAAATTGAGAATGG + Intergenic
1030688732 7:112511552-112511574 TAGCACCTTCAGAGGGAGCATGG - Intergenic
1030778067 7:113561547-113561569 AAGAAGTTTCAAAAGAAACATGG - Intergenic
1030982353 7:116201019-116201041 TAGAACCCTCAGAGGGAGCATGG + Intergenic
1031216424 7:118898929-118898951 AAGAATCTTCAAAGGGAGCAGGG - Intergenic
1031939700 7:127775196-127775218 TAGAACCTTTAAAGGGAACATGG + Intronic
1032686432 7:134239062-134239084 TAGGAACTTCTAAAGGAGCTGGG - Intronic
1032856299 7:135836485-135836507 TAGAAGCTTCAGGAGCAGGAGGG - Intergenic
1033057313 7:138069965-138069987 TAGAAACTTCAGAGGGAGCATGG - Intronic
1033292752 7:140101637-140101659 TGGAAGCTTCATGAGGGGCAGGG + Intronic
1033506273 7:142004523-142004545 TAGAGACTCCAAAAGGAGAAAGG + Intronic
1034017178 7:147599593-147599615 CAGAAACTTCAGAAAGAGCATGG - Intronic
1034107541 7:148503104-148503126 AAGAAGCTTTGAAAGGAGCATGG - Intergenic
1034280696 7:149852059-149852081 TAGAAGCATCTTAAGGAGCCTGG + Intronic
1034781977 7:153888757-153888779 CAGAACCTTCAAAAGTAGCAAGG - Intronic
1036375086 8:8193088-8193110 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1036584980 8:10115438-10115460 TAGCACCTTCAGAGGGAGCAGGG + Intronic
1036854455 8:12230060-12230082 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1036875815 8:12472560-12472582 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1037211456 8:16393352-16393374 TAAAAGCTTCAGACGGAGTAGGG + Intronic
1038143374 8:24870768-24870790 TCAAAGCTTCAGAGGGAGCATGG - Intergenic
1038382088 8:27105712-27105734 TAGAACCTTCAGAAGGAAAATGG + Intergenic
1038614259 8:29077977-29077999 TGGAAGCTTCAAAAGCAGAGAGG + Intronic
1038928554 8:32167868-32167890 TAGCTGTTTCAAAAAGAGCAAGG - Intronic
1039328628 8:36512541-36512563 TAGAGGCTCCAGAGGGAGCACGG + Intergenic
1039575167 8:38617594-38617616 TAGAGGCTTCAGAGGGAACATGG - Intergenic
1039800424 8:40949922-40949944 TAGAGCCTTCAAAGGGAGCACGG + Intergenic
1040120634 8:43681200-43681222 TAGAATCTGCAAAAGGAGGTTGG + Intergenic
1040352264 8:46581408-46581430 TAGGAACTTCAAAAGGGGAAGGG - Intergenic
1040600657 8:48880604-48880626 TAGAGCCCTCAGAAGGAGCAGGG - Intergenic
1041338799 8:56819329-56819351 AAGAAACTACAAAAGGAGTAAGG + Intergenic
1042101605 8:65280681-65280703 TAGAAACTTCAGATGGAGCATGG - Intergenic
1042154402 8:65826821-65826843 TAAAGCCTTCAAAGGGAGCATGG - Intronic
1042469212 8:69163879-69163901 TACAAGTTTCAGAAGGAGCATGG + Intergenic
1042884897 8:73537796-73537818 TAGAAACTTCAAAAAGAGAAAGG - Intronic
1044364471 8:91326803-91326825 TAGAACCTGCAGAGGGAGCATGG - Intronic
1044785611 8:95789192-95789214 TAGAGGCTTCAAAGGGAGCATGG + Intergenic
1044792201 8:95858922-95858944 TAGAACCTTCAGAGAGAGCATGG + Intergenic
1045271194 8:100663106-100663128 TGGAGGCTCCAAAAGGAGCGGGG + Intronic
1045468523 8:102490525-102490547 TAGAAACTTCAGGGGGAGCATGG + Intergenic
1045850375 8:106689166-106689188 TACAAGTTTCAAAAGGAGCATGG - Intronic
1046264829 8:111817136-111817158 TAGAACCTCCAGAGGGAGCATGG + Intergenic
1047161544 8:122386184-122386206 TGAAAACTTCAAAAGGAGTAAGG - Intergenic
1047221738 8:122924198-122924220 TAGAGGCTTCAGAGGGAGCACGG - Intronic
1047388016 8:124427385-124427407 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1047534522 8:125707227-125707249 TAGAACCTTCAGAAAGATCATGG - Intergenic
1048018044 8:130514833-130514855 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048048361 8:130794150-130794172 TAGAGCCTTCAGAGGGAGCAGGG + Intronic
1048300181 8:133245632-133245654 TAGCACCTTCAGAGGGAGCACGG + Intronic
1048512612 8:135076355-135076377 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1048887083 8:138917274-138917296 TAGAAGCTGGAAGAGGGGCAAGG - Intergenic
1048926946 8:139279976-139279998 TGGGAGCTACAAGAGGAGCAGGG - Intergenic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1050173333 9:2844877-2844899 TAGAGCCTTCAAAAGGTGCAGGG - Intergenic
1051587443 9:18741665-18741687 TACAAGTTTTAGAAGGAGCATGG - Intronic
1054850726 9:69843848-69843870 TAGAAGCTTCAAGACCAGCCTGG - Intronic
1055070461 9:72160837-72160859 TGGAAGGTGAAAAAGGAGCATGG - Intronic
1056028969 9:82531069-82531091 TAGACCCTTCAGAGGGAGCATGG - Intergenic
1056132390 9:83599352-83599374 TAGCTACTTCAAATGGAGCAGGG - Intergenic
1056223013 9:84468384-84468406 TAGAAGCTTCAGATGGAACCTGG + Intergenic
1056459213 9:86792898-86792920 TAGAGGCTTTGGAAGGAGCATGG + Intergenic
1056948982 9:91026783-91026805 TAGATGCTTGGAAAGAAGCAGGG - Intergenic
1057055621 9:91958385-91958407 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1057247444 9:93468751-93468773 TAGAAGCATAAAAAGGATCACGG - Intronic
1057407759 9:94789019-94789041 TAGAAGCTCCAAAAGGCTCTAGG - Intronic
1057525976 9:95801831-95801853 TAGAAGCTCCAGGAGGAACAAGG - Intergenic
1058192283 9:101933565-101933587 TAGAAGTTTTAAAAAGAGAAGGG - Intergenic
1059067565 9:111101641-111101663 TAGAAGCTTCAAATGCAGGCCGG - Intergenic
1059234101 9:112747776-112747798 TAAAAGTTTTAAAAGCAGCATGG - Intergenic
1059402577 9:114079520-114079542 CAGAATCTTCAAAGGGAACATGG + Intergenic
1060776364 9:126377684-126377706 TATAAGCTTCACAAGGACAACGG - Intronic
1062097033 9:134708840-134708862 TGGAAGCTTCAGAGGGAGCACGG - Intronic
1186666169 X:11719868-11719890 TAGGTGCTTCGGAAGGAGCATGG + Intergenic
1186711534 X:12202941-12202963 TAGAACCTTCAGAGGAAGCATGG + Intronic
1188665279 X:32811957-32811979 TAGAATCTTCCAATGGAGCCAGG - Intronic
1188946007 X:36303121-36303143 TACAGGTTTCAGAAGGAGCATGG - Intronic
1189100707 X:38186491-38186513 TAGAAAGTACAAAAGGAGGAAGG + Intronic
1190746443 X:53325759-53325781 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1191767539 X:64714546-64714568 TGGAAGTTTCCAAAGGAGAAGGG + Intergenic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1195216720 X:102711345-102711367 AAGAGGATTCAAAAGGAGCCAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1196963848 X:121033700-121033722 TAGAGCCTTTAGAAGGAGCATGG + Intergenic
1197287348 X:124611491-124611513 TAGGAGCTTCCAAAGAAACAAGG - Intronic
1197480867 X:126984304-126984326 TAGAAGATTGAAAGGGAACAGGG + Intergenic
1197644023 X:128998046-128998068 TAGAAGCCATAAAAGGATCATGG + Intergenic
1198118650 X:133569306-133569328 TAGCAGCTTCTAAAGGATTATGG - Intronic
1198250538 X:134875396-134875418 TACAAGCTTCAGAGGGAGTACGG - Intergenic
1198306074 X:135384225-135384247 TAGAACCTTCAGAGGGAGCATGG + Intergenic
1198714515 X:139542683-139542705 AAGATGCTTTAAAAGGAGGAAGG + Intronic
1199519699 X:148721767-148721789 TAGGGGCTTCAAATGGACCATGG - Intronic
1201730455 Y:17197085-17197107 TAGGTGCATCAAAAGGAGAAGGG - Intergenic