ID: 1101316668

View in Genome Browser
Species Human (GRCh38)
Location 12:103635262-103635284
Sequence CTGCTCGTGATAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101316661_1101316668 -4 Left 1101316661 12:103635243-103635265 CCAAAGCCACCCTTTTTGCCTGC 0: 1
1: 0
2: 4
3: 26
4: 209
Right 1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1101316660_1101316668 6 Left 1101316660 12:103635233-103635255 CCTCTCAGCTCCAAAGCCACCCT 0: 1
1: 6
2: 37
3: 125
4: 444
Right 1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1101316662_1101316668 -10 Left 1101316662 12:103635249-103635271 CCACCCTTTTTGCCTGCTCGTGA 0: 1
1: 0
2: 2
3: 3
4: 111
Right 1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1101316659_1101316668 12 Left 1101316659 12:103635227-103635249 CCAGTGCCTCTCAGCTCCAAAGC 0: 1
1: 0
2: 3
3: 26
4: 297
Right 1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101316668 Original CRISPR CTGCTCGTGATAATGGAGCT GGG Intronic
900688888 1:3967283-3967305 CTGCTAGTGAAAGTGGAGGTTGG - Intergenic
908127453 1:61045122-61045144 CTGCTCTTGATCATGGAGGATGG - Intronic
909238202 1:73179898-73179920 CTGCTCTTGCTATTGGAGGTTGG + Intergenic
909496893 1:76288860-76288882 CTGCTCGCTATAATAGAGCATGG - Intronic
909504202 1:76369539-76369561 CAGCTAGTAATGATGGAGCTAGG + Intronic
911704606 1:100997002-100997024 CTGCTTTTGTTAATGGAGCAAGG + Intronic
914764260 1:150624201-150624223 CTCCTCATGATAAAAGAGCTGGG + Intronic
919019802 1:192089803-192089825 GTGCACGTGATAATACAGCTGGG + Intergenic
920425501 1:205871966-205871988 CTCCACCTGATAAGGGAGCTGGG - Intergenic
920446755 1:206023748-206023770 CTGCTGGTGCTCCTGGAGCTGGG - Exonic
1063384794 10:5609403-5609425 GTGCATGTGATAATGGTGCTGGG - Intergenic
1065244668 10:23744937-23744959 TTGCTCTCCATAATGGAGCTGGG - Intronic
1065783697 10:29193616-29193638 CTGCTTTTGATGCTGGAGCTGGG - Intergenic
1072857731 10:98967166-98967188 CTGATATAGATAATGGAGCTGGG + Intronic
1074723250 10:116282081-116282103 CTGCTCCCCATAATGGGGCTGGG + Intergenic
1075735086 10:124659687-124659709 GAGCTTGTGGTAATGGAGCTTGG - Intronic
1086928053 11:92662217-92662239 CTGCTCCTGATAATGGCTCCTGG - Intronic
1095510794 12:42949669-42949691 CTGCTCTTTACAATGGAGTTGGG + Intergenic
1095541092 12:43309426-43309448 CTGCTCATGAAATTGGAGCCAGG - Intergenic
1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG + Intronic
1102007430 12:109597495-109597517 GTGCTTGTGATTCTGGAGCTAGG - Exonic
1103031774 12:117620644-117620666 TTGCTGCTGATATTGGAGCTAGG - Intronic
1105707986 13:22980645-22980667 GTGCTGGTGAAAGTGGAGCTCGG - Intergenic
1107409388 13:40144364-40144386 CTGCTCTTGAGTGTGGAGCTGGG - Intergenic
1113948293 13:114057338-114057360 CAGCTCGTGGGAATGAAGCTTGG - Intronic
1116160134 14:41257476-41257498 ACACTCTTGATAATGGAGCTGGG - Intergenic
1116991470 14:51281566-51281588 CTGCTGGTGAGAATGAAGATTGG - Intergenic
1118752030 14:68814620-68814642 CTGCTCTTGAGACTGGAGGTGGG - Intergenic
1121950577 14:98167704-98167726 CCTCTCCTGATAATGGAGCCAGG - Intergenic
1123043610 14:105500572-105500594 CTGCCCGTCATGATGGAGCAGGG + Intergenic
1127530535 15:59839314-59839336 CTGCACTTGATACTGGAGCTGGG - Intergenic
1128752004 15:70156476-70156498 CAGTTGGCGATAATGGAGCTGGG - Intergenic
1137753000 16:50880449-50880471 CTGCTTTAGAGAATGGAGCTTGG + Intergenic
1139176520 16:64695864-64695886 TTGCTCATGATACTGAAGCTTGG - Intergenic
1142469982 17:157912-157934 CTGCCCATGACAATGGAGCCTGG + Intronic
1146059548 17:29597218-29597240 CTGCTCATGCTAAAGGAGTTTGG + Intronic
1150567199 17:66352103-66352125 CTGCTCATGGGAATGGGGCTGGG + Intronic
1163455050 19:17401644-17401666 CTGTTTGTGGTAATGGAGCCAGG - Intergenic
1167226250 19:48242843-48242865 CTGCTGGTGGGAATGGAGATTGG - Intronic
926277800 2:11418075-11418097 CTGCTAGTGAAAATGAATCTGGG + Intergenic
927823691 2:26292125-26292147 CTGCTGGTGAGAATGCAGATTGG + Intergenic
929638947 2:43556379-43556401 TTGCATGTGATAATGGAGATAGG - Exonic
935181973 2:100699674-100699696 CAGGTCCTGAAAATGGAGCTGGG + Intergenic
937127427 2:119483351-119483373 GAGCTGGTGATAATGGAGCTGGG + Intronic
942155044 2:173119572-173119594 TGCCTCGTGATACTGGAGCTAGG - Intronic
944885686 2:204060289-204060311 CTGCTCAAGATTATAGAGCTTGG + Intergenic
948327132 2:237133337-237133359 CTGCTCATGAGAATGTAGATTGG - Intergenic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1176088643 20:63309310-63309332 CTGCTCGTGAGGAGGGAGGTGGG - Intronic
1181750950 22:24988955-24988977 CAACTAGTGATTATGGAGCTGGG + Intronic
1184212200 22:43042727-43042749 CTGCACCTGAAAATGGAGCTGGG + Intronic
954463048 3:50638530-50638552 CTGCTCTGGGTAATGGAGCAGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954972217 3:54660824-54660846 CTCCACGTGAAAGTGGAGCTCGG + Intronic
956976864 3:74591025-74591047 CTGCTTGTAATAATTAAGCTTGG - Intergenic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
971233871 4:24823977-24823999 CAGCTGGTGAAAAGGGAGCTTGG - Intronic
980822855 4:138039088-138039110 CTGCTCCAGAGTATGGAGCTGGG - Intergenic
997271266 5:132540373-132540395 CTGCTCCTGATCCTGGGGCTTGG + Intergenic
998764499 5:145470564-145470586 CTGCCCTTGCTTATGGAGCTGGG + Intergenic
999719320 5:154386927-154386949 TAGCTCCTGATGATGGAGCTGGG - Intronic
1003396020 6:5752745-5752767 CTGGTCCTGATGAAGGAGCTGGG + Intronic
1005029221 6:21493652-21493674 CTGCTAGTGATACCGGAGCGGGG + Intergenic
1010915947 6:81619033-81619055 CTGCATGGGATAAAGGAGCTGGG + Intronic
1011096420 6:83670171-83670193 CTGCTGGTGGTAATGTAGCATGG - Intronic
1018483724 6:164217866-164217888 TTGCTGGTTATAATGGAGCATGG + Intergenic
1022968540 7:35496493-35496515 CTGCTCATGAGAATGGAGGGAGG + Intergenic
1027612118 7:80374775-80374797 TTGCTCTTGATAATGCAACTAGG + Intronic
1030954537 7:115835738-115835760 CTGCCAGAGATAATGAAGCTAGG - Intergenic
1044357346 8:91238361-91238383 GTGCTCATGAGAATGGAGGTGGG + Intronic
1045556300 8:103217922-103217944 CTGCTAGTTTTAATGGAGGTGGG + Intronic
1047303109 8:123631827-123631849 CTGCTGGTGAAAATAGAGATGGG + Intergenic
1051944812 9:22555190-22555212 CTGCCAGTGATAATGCAGTTTGG - Intergenic
1052528734 9:29655383-29655405 CTGCTCGAGATAATGGAAGTAGG + Intergenic
1053767369 9:41420886-41420908 ATGGTCGTGATAAAGGAACTTGG - Intergenic
1054319510 9:63640890-63640912 ATGGTCGTGATAAAGGAACTTGG + Intergenic