ID: 1101318000

View in Genome Browser
Species Human (GRCh38)
Location 12:103647071-103647093
Sequence CCACATGAGAAAGTGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101318000_1101318004 -3 Left 1101318000 12:103647071-103647093 CCTGTGTACACTTTCTCATGTGG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1101318004 12:103647091-103647113 TGGATAAAAGGAGTCAGTGAGGG 0: 1
1: 0
2: 2
3: 35
4: 370
1101318000_1101318003 -4 Left 1101318000 12:103647071-103647093 CCTGTGTACACTTTCTCATGTGG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1101318003 12:103647090-103647112 GTGGATAAAAGGAGTCAGTGAGG 0: 1
1: 0
2: 1
3: 23
4: 253
1101318000_1101318005 12 Left 1101318000 12:103647071-103647093 CCTGTGTACACTTTCTCATGTGG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1101318005 12:103647106-103647128 AGTGAGGGTTTTAAGCACACAGG 0: 1
1: 0
2: 0
3: 3
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101318000 Original CRISPR CCACATGAGAAAGTGTACAC AGG (reversed) Intronic
900848536 1:5123261-5123283 CCACATGAGAAAGTGCCAAATGG + Intergenic
905968375 1:42118545-42118567 CCAGAGGAAAAAGTGTACCCAGG + Intergenic
906523659 1:46481464-46481486 CCTTGTGAGAAAGTGTTCACAGG + Intergenic
908522179 1:64955118-64955140 CAATTTGAGCAAGTGTACACAGG + Intronic
910846418 1:91609029-91609051 CCACATGAGAAAGTCCCTACAGG + Intergenic
911516712 1:98876425-98876447 CCCCATCAGAAAGTGGACAAAGG - Intergenic
912365959 1:109134127-109134149 CCACCTGAGAAAGTGAACTTAGG + Intronic
916289886 1:163153573-163153595 CTACATGAGCAATTGTACACTGG - Intronic
917185554 1:172350853-172350875 CAACATCAGAAAATGTAGACAGG + Intronic
920928395 1:210364552-210364574 CAGCGTGAGAAAGTGAACACAGG + Intronic
921705619 1:218319475-218319497 ACACATGAGCCAGTTTACACAGG - Intronic
921974772 1:221190488-221190510 CCACATGTGCAAGTGTAGGCTGG - Intergenic
923571985 1:235124395-235124417 CCAGATGAGAAAATGTACCAAGG + Intronic
1063298606 10:4831481-4831503 AGACAAGAGAAAGTGTACAGGGG + Intronic
1065773690 10:29100595-29100617 ACAGATGAGAAAGTTTACATGGG - Intergenic
1066016083 10:31245378-31245400 CCACATGACTAAGTGTGCAGAGG + Intergenic
1066031799 10:31435154-31435176 CGACATGAGAAAGTTTCAACTGG + Intronic
1066463766 10:35635182-35635204 CTACATGAGAAATTGTAAAGCGG + Intergenic
1068381360 10:56257472-56257494 CCACATTAAAAAGTGTGCAAAGG - Intergenic
1068384727 10:56310883-56310905 CCCCATTAAAAAGTGGACACAGG + Intergenic
1068462538 10:57346227-57346249 CCACATTAAAAAGTGTGCAAAGG - Intergenic
1069558699 10:69414803-69414825 ACACATGAGTGAGTGTACACGGG - Intronic
1075646246 10:124098802-124098824 CCACCTGAGAAGGTGCACAGTGG - Intergenic
1076122395 10:127946607-127946629 ACAGATGAGCAAGTGTGCACAGG - Intronic
1076740360 10:132479797-132479819 ACACATGGAAATGTGTACACAGG + Intergenic
1077881230 11:6352187-6352209 CCACATAGAAAAGTGCACACAGG + Intergenic
1077989572 11:7391941-7391963 CCTCATTAGAAAGTGGACAAAGG - Intronic
1079967469 11:26995981-26996003 CCAAATGAGAAAGAATACATTGG - Exonic
1080365468 11:31569278-31569300 CCACAAGAGAAAGTGTCAATGGG + Intronic
1082791711 11:57350204-57350226 ACACAGGAGAAAGTGGCCACAGG - Intronic
1085167347 11:74414753-74414775 CCACAAAAGAAAGTGCACAATGG - Intergenic
1086116653 11:83258410-83258432 TCTCATGAGAAAGAGTACTCAGG + Intronic
1086185966 11:84016204-84016226 CCACATTAAAAAGTGGACAAAGG - Intronic
1086612394 11:88773276-88773298 CCACATCAAAAAGTGGACAAAGG - Intronic
1086782064 11:90919726-90919748 CCACATGAGAATCTATACACAGG - Intergenic
1087439832 11:98169351-98169373 CCCCATGATAAAGTGGACAAAGG + Intergenic
1087512100 11:99109369-99109391 CCATATGAAAAAATGTACATGGG - Intronic
1087711036 11:101552591-101552613 CCAAATCAAAAAGTGAACACTGG + Intronic
1087818671 11:102687466-102687488 ATACATAAGAAAGTCTACACAGG + Intergenic
1088141093 11:106617209-106617231 ACACATGATAAAGTGCAGACAGG - Intergenic
1088536385 11:110866534-110866556 CCACAGGCGAAAGAGTTCACAGG + Intergenic
1090260647 11:125316289-125316311 CCACATAAGAGAGTTCACACAGG - Intronic
1095919189 12:47512361-47512383 CCCCATCAGAAAGTGTGCAAAGG + Intergenic
1099399028 12:82179590-82179612 CCCCATGAAAAAGTGGACAAAGG - Intergenic
1099413207 12:82357917-82357939 CCACATGCGCAAGAGTTCACAGG + Intronic
1101318000 12:103647071-103647093 CCACATGAGAAAGTGTACACAGG - Intronic
1101612637 12:106304980-106305002 CCACATGTGCAAGTGTCCACAGG + Intronic
1101618511 12:106361131-106361153 GCACATGAGGACATGTACACTGG + Intronic
1102986030 12:117279450-117279472 CCATAAGAGAAAATATACACTGG - Intronic
1104172318 12:126293795-126293817 CCAAAAGAGAAAGTGTAACCTGG + Intergenic
1106032251 13:26013861-26013883 CCACATGGGAAAGTGAGGACAGG - Intronic
1107199194 13:37693346-37693368 CCTGGTGAGAAAGTGTACAGTGG + Intronic
1109941381 13:69370618-69370640 CCCCATTAGAAAGTGGACAAAGG + Intergenic
1111628441 13:90818493-90818515 CCACATCAGAAAGTGGGCAAAGG + Intergenic
1114501420 14:23171819-23171841 CCCGATGGGAAAGTGTAAACAGG - Intronic
1120139166 14:80908685-80908707 TCACATGATAAAGAATACACAGG - Intronic
1127693988 15:61426078-61426100 CTACATGAGCAAGTCTACACCGG - Intergenic
1131384423 15:91991483-91991505 CTAAATCAGAAATTGTACACTGG - Intronic
1132534767 16:472646-472668 ACACGTGAGAAAGAGTGCACAGG - Intronic
1137271562 16:46905810-46905832 ACCCATGAGAGAGTGTACAGGGG - Intronic
1138353108 16:56356976-56356998 CCACATGAGAGAGCGGACACAGG - Intronic
1140882671 16:79213133-79213155 GCACATGAGAAAGTCCACTCTGG + Intergenic
1141350679 16:83292359-83292381 CCACATGGAAAAGTGGCCACAGG - Intronic
1142491729 17:284003-284025 CCACCTGTTACAGTGTACACAGG - Intronic
1146930539 17:36774340-36774362 CCACAGGAGGAAGTGGACATGGG + Intergenic
1149168618 17:53783015-53783037 CCCCATCAGAAAGTGTGCAAAGG + Intergenic
1149212074 17:54315335-54315357 CCACATGAGAAATTATACCAAGG + Intergenic
1149905667 17:60524888-60524910 CCACATTTGAATGTGAACACTGG - Intronic
1156110054 18:33714889-33714911 CCACAAGAAAAAGTGGACAAGGG - Intronic
1160156838 18:76441226-76441248 CCAGGTGAGCAAGTGTACCCAGG - Exonic
1162483168 19:10941405-10941427 CCATAAGATAAAGTGAACACAGG + Intergenic
1163263426 19:16204713-16204735 CCACATGGGAATGTGCACACCGG - Intronic
1167861821 19:52290569-52290591 CGACACGAGAAAGTGCATACTGG + Exonic
1168174222 19:54611675-54611697 CCCCATTAGAAAGTGTGCAAAGG - Intronic
1168574133 19:57494281-57494303 CAACACCAGAAAGTTTACACTGG + Exonic
1168583442 19:57574397-57574419 CCACATGAGGAAGTGCTCAGTGG - Intronic
1168700220 19:58433996-58434018 CGACATCAGAAAGTTCACACTGG - Exonic
1168700251 19:58434332-58434354 CGGCATGAGAAAGTTCACACTGG - Exonic
925064152 2:916103-916125 CCACATCAGAAACTGCACAGTGG + Intergenic
928652017 2:33413579-33413601 CCTCTTTTGAAAGTGTACACTGG - Intergenic
929638855 2:43555061-43555083 CTACATAAGAATGTTTACACTGG + Intronic
930707433 2:54518610-54518632 AGACTTGAAAAAGTGTACACTGG - Intronic
933666330 2:84968102-84968124 CCATTTGAGAAAGTGTACCTGGG - Intergenic
934886490 2:98029922-98029944 CCACATGAGAAATTCTCAACTGG - Intergenic
935756741 2:106282286-106282308 CCACATGGGAGAGGGTTCACAGG - Intergenic
936715046 2:115176862-115176884 ACACATGAGAAACTGTCTACTGG - Intronic
939567505 2:143801792-143801814 CCTCATGAGAAAATGACCACAGG + Intergenic
939755099 2:146100429-146100451 CCATATTAGTTAGTGTACACTGG + Intergenic
944109782 2:196120028-196120050 CCACATGAGAAACTCTTCTCAGG + Intergenic
944907488 2:204277022-204277044 CCACATAAGAAGGGGTACATGGG - Intergenic
945099269 2:206249517-206249539 CCACATAGGAAAGTGCACAGAGG + Intergenic
946934998 2:224710758-224710780 CCACATAAGAAGGTGAACTCTGG - Intergenic
1169220339 20:3818895-3818917 CCCCCTGAGAAAGTGCACTCTGG - Intergenic
1169305121 20:4482914-4482936 CCACATGTAAAATTGTACAATGG - Intergenic
1172667658 20:36611917-36611939 CCAGATGAGAATGTAAACACGGG - Intronic
1178097044 21:29227089-29227111 CAACATGTGAAAATGGACACTGG - Intronic
1178363399 21:31968540-31968562 CCACAAGAGGAAGCGTAGACAGG + Intronic
1180227891 21:46407637-46407659 CAAAATGAGAAAGTATAGACTGG - Intronic
1183999642 22:41663683-41663705 CCACATCAGCAAGGGTACGCTGG + Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
949116277 3:328838-328860 AAACATGAAAAATTGTACACTGG + Intronic
952729205 3:36621182-36621204 CCACATAAGAGAGTTCACACAGG + Intergenic
956477808 3:69641700-69641722 CCACATGAAAAAGTGGGCAAAGG + Intergenic
957698693 3:83680420-83680442 CCACATGAAAAAGTGGGCAAAGG + Intergenic
957712667 3:83883260-83883282 CAACATGAGCAAGTATACAGTGG + Intergenic
957771804 3:84703787-84703809 CCACATTAAAAAGTGGACAAAGG + Intergenic
957876846 3:86157598-86157620 CCACATGAAAAAGTGGACAAAGG - Intergenic
958607071 3:96372846-96372868 CCCCATGAAAAAGTGGACAAAGG - Intergenic
960414184 3:117364013-117364035 CCACATCAAAAAGTGAACAAAGG + Intergenic
960673083 3:120170577-120170599 CCACATGAGAATGTGCACGATGG - Intronic
961110035 3:124276203-124276225 CACCATGAGAAAATCTACACTGG + Intronic
961934501 3:130569080-130569102 CCACGTGACACAGGGTACACAGG - Intronic
962001276 3:131300202-131300224 CCCCATTAAAAAGTGTACAAAGG - Intronic
962539958 3:136371181-136371203 CCACATCAAAAAGTGGACAAAGG - Intronic
963473196 3:145770704-145770726 CCACTTGAGAAAGTCTAAATAGG + Intergenic
964459771 3:156911327-156911349 CCGCATTAGAAAGTGGACAAAGG - Intronic
965920275 3:173905131-173905153 CCACATGGGAAAGAGAACTCAGG - Intronic
968056517 3:195696240-195696262 CCCCATCAGAAAGTGTGCAAAGG - Intergenic
970250822 4:14114116-14114138 CCCCATGAGAAAGTACAGACTGG - Intergenic
970484066 4:16506976-16506998 TCAACTGAAAAAGTGTACACAGG - Intronic
970975826 4:22041794-22041816 CTAAAGGAGAAAGTGCACACTGG - Intergenic
974355959 4:60813264-60813286 CCAGAAGAGAAAGTGTAGATGGG - Intergenic
975138104 4:70893937-70893959 CCACTTGTGTAAGTATACACTGG - Intergenic
975523749 4:75327370-75327392 CCAGATAGCAAAGTGTACACAGG - Intergenic
975767963 4:77689211-77689233 CCACATGAAAAAGAGGAAACAGG - Intergenic
975956688 4:79849058-79849080 CCCCAGTAGAAAATGTACACAGG + Intergenic
976428017 4:84928849-84928871 CCACTTGAATAAGTCTACACAGG + Intronic
976948001 4:90793988-90794010 CCCCATTAAAAAGTGTACAAAGG - Intronic
977420239 4:96790549-96790571 CCACATTAGTAGGTGTACCCTGG - Intergenic
978977284 4:114893567-114893589 ACACATCAGAAAGTGGACAAAGG - Intronic
983678260 4:170321690-170321712 CCCCATCAGAAAGTGAACAAAGG + Intergenic
986788721 5:11139939-11139961 CCACATAAGAAAGTCTCCCCTGG - Intronic
987400856 5:17475161-17475183 CCACATGAAAAAGTGGGCAAAGG + Intergenic
988005649 5:25407119-25407141 CCACAAAAGAAAGAGTACAGAGG + Intergenic
988795361 5:34648467-34648489 CCAGATGAGAAGGAGCACACAGG + Intergenic
989674525 5:43958087-43958109 CCCCATCAGAAAGTGTGCAAAGG + Intergenic
989727150 5:44599917-44599939 CCCCATGAAAAAGTGTGCAAAGG - Intergenic
992877066 5:81066976-81066998 TCTCATGAGAAAGTGCACGCTGG - Intronic
995938756 5:117552049-117552071 CCACATTAGAGAGTGTGCTCAGG + Intergenic
999084310 5:148873656-148873678 CCACATGGGGAAGTGTAGAGGGG - Intergenic
1004077113 6:12353859-12353881 CCACATTAAAAAGTGGACAAAGG - Intergenic
1010465646 6:76165256-76165278 CTCCATGAGAACGTGCACACTGG - Intergenic
1010469663 6:76212117-76212139 CCTCATCAAAAAGTGGACACAGG + Intergenic
1014569495 6:122991296-122991318 CCCCATGAAAAAGTGGGCACAGG + Intergenic
1017568189 6:155710986-155711008 CCACATAAGCAGGTGTAAACAGG - Intergenic
1018312422 6:162524920-162524942 TCACATGGAAAAGTGTACATGGG - Intronic
1020226853 7:6287119-6287141 CCCCATGAAAAAGTGTGCAAAGG + Intergenic
1021162729 7:17297139-17297161 CCAAAGAAGACAGTGTACACTGG - Intergenic
1021538338 7:21729406-21729428 GAACATGAGAAAGTGTATTCTGG - Intronic
1022996974 7:35766721-35766743 CCCCATCAAAAAGTGGACACAGG - Intergenic
1024086154 7:45893578-45893600 CCACCTGTTAAAATGTACACTGG + Exonic
1024825159 7:53382628-53382650 ACACAAAAGAAAGTGAACACTGG + Intergenic
1025162015 7:56669437-56669459 TCACATGCCCAAGTGTACACAGG - Intergenic
1026972824 7:74478356-74478378 CCACGTGAGAATGTGTGAACAGG - Intronic
1028231800 7:88314603-88314625 ACACATGAGAAAGGCCACACAGG + Intergenic
1029185619 7:98736397-98736419 CCTAATGAGAAAGTGTTCAAAGG - Intergenic
1030778687 7:113569552-113569574 GCACATGAGAAAATGGACTCTGG + Intergenic
1032914528 7:136474576-136474598 CCCCATTAAAAAGTGTACATAGG - Intergenic
1034881889 7:154768969-154768991 CCAAATGAGAAAGTGAACTCTGG - Intronic
1036716412 8:11128310-11128332 CCACAGGAGTGAGTGTAGACAGG - Intronic
1037137692 8:15482865-15482887 ACACATGAGAAAATGTAAAAAGG - Intronic
1039774702 8:40723904-40723926 CCACATGTGAAAATGCACCCTGG + Intronic
1043391799 8:79798955-79798977 CCTCATGACTAAGTATACACTGG + Intergenic
1043783593 8:84367957-84367979 CCACATGAGAAAATTTAAAAAGG - Intronic
1045392769 8:101731839-101731861 GCCCATGAGAAAGTGGACAGAGG + Intronic
1045852411 8:106718531-106718553 CCACATGATAAAGAGTACTTTGG + Intronic
1047152377 8:122278633-122278655 CCCCATTAAAAAGTGGACACAGG + Intergenic
1047739186 8:127793756-127793778 CCAAAGGAGCAAGTGGACACTGG - Intergenic
1054808447 9:69414562-69414584 CCCCATCAGAAAGTGGACAAAGG - Intergenic
1054834228 9:69659439-69659461 CCACATGAGAAGCTGCAGACGGG + Intronic
1056703905 9:88935212-88935234 CCAGATGAGAACTTGGACACAGG + Intergenic
1058403418 9:104643306-104643328 CCCCATGAAAAAGTGGACAAAGG + Intergenic
1186992657 X:15086099-15086121 CCTCCTGAGAGAGGGTACACAGG + Intergenic
1187278287 X:17835708-17835730 CCACATAAGAAAGGGAACAGAGG - Intronic
1189190679 X:39100581-39100603 CCCCATGATAAAGTGGACAAAGG - Intergenic
1190586079 X:51943841-51943863 CCACATGAGAATCTGGCCACTGG + Intergenic
1190992999 X:55571836-55571858 CCCCATGAAAAAGTGTGCAAAGG + Intergenic
1191869791 X:65736292-65736314 CCACATAGGCCAGTGTACACGGG - Intronic
1192127279 X:68513928-68513950 CCTCATCAGTAAATGTACACTGG + Intronic
1193085577 X:77446158-77446180 CCTCAGGAGAAACTGAACACAGG - Intergenic
1193605186 X:83558736-83558758 CAACATGATAAAGGGTACATAGG - Intergenic
1194041277 X:88944829-88944851 ACAGATGAGAAAGTCTACAGAGG + Intergenic
1194221208 X:91193885-91193907 ACACATTAAAAAGTGGACACAGG + Intergenic
1195216676 X:102710970-102710992 CATCATGAGAAGGTCTACACTGG - Intergenic
1200557713 Y:4657638-4657660 ACACATTAAAAAGTGGACACAGG + Intergenic
1201348311 Y:13009557-13009579 CCCCATGAAAAAGTGGACAAAGG + Intergenic
1201529107 Y:14972343-14972365 CCATATGAGAAAGTTGAAACTGG - Intergenic
1201681944 Y:16655765-16655787 CCACATAAAAAAGTGGACAAAGG - Intergenic