ID: 1101318019

View in Genome Browser
Species Human (GRCh38)
Location 12:103647222-103647244
Sequence CAATCCAGGCAGAGGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101318014_1101318019 -4 Left 1101318014 12:103647203-103647225 CCAGGTTGAGGCTGTGCAACAAT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG 0: 1
1: 0
2: 4
3: 26
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101318019 Original CRISPR CAATCCAGGCAGAGGGTGGT AGG Intronic
900815519 1:4840747-4840769 CAATCCTGGCAGAAGGTGAGAGG + Intergenic
901175040 1:7292946-7292968 CACACCAGGCAGAGGTTGGGTGG + Intronic
902193490 1:14780464-14780486 CCATCCAGGCAGTGAGTGGGAGG - Intronic
902885189 1:19399696-19399718 TAAACCAGGTAGAAGGTGGTAGG - Intronic
904421592 1:30397962-30397984 CATTCCAGGCAGAAGGTGAGGGG + Intergenic
904438913 1:30517154-30517176 CAATCCCCGCAGAGAGTTGTTGG - Intergenic
905273859 1:36804757-36804779 TAATCCAGGCAGGAGGTGATGGG + Intronic
905363540 1:37436293-37436315 CAATACAGGGACAGGATGGTAGG + Intergenic
905973989 1:42162503-42162525 CCACCAAGGCAGCGGGTGGTGGG - Intergenic
907228538 1:52972518-52972540 CAATCCATGCATAGATTGGTAGG - Intronic
908123046 1:61003909-61003931 CAACCCAGACAGAGGGTGAGAGG - Intronic
908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG + Intergenic
912449175 1:109758941-109758963 CAGTCCAGGCCCAGGTTGGTTGG + Intronic
912459669 1:109822319-109822341 CGGTCCAATCAGAGGGTGGTGGG + Intergenic
912881125 1:113415466-113415488 CAATCTAGGCAGAAAGTGATAGG - Intronic
913321600 1:117592393-117592415 CCATCCAAGCAGAGCGGGGTTGG - Intergenic
915432908 1:155880453-155880475 GAATCCTGGCAGAGGGTGCAGGG - Intronic
915665311 1:157439144-157439166 CAATCATGGCAGAAGGTGATGGG + Intergenic
916183954 1:162113062-162113084 TATATCAGGCAGAGGGTGGTGGG + Intronic
917078680 1:171234427-171234449 TAATCCATGCAGAGGGTGAAGGG - Intergenic
917579815 1:176364501-176364523 AAATTAAGGCATAGGGTGGTTGG - Intergenic
920050090 1:203159167-203159189 CCATCCAGGCAGATGAGGGTGGG - Intronic
920084710 1:203406805-203406827 GAATCCAGGAAGAGAGTGATGGG - Intergenic
920106597 1:203557633-203557655 AAATTCAGGCAGAGGCCGGTGGG + Intergenic
920676352 1:208041083-208041105 CAATGCAGGGAGAGGGTGCTGGG - Intronic
921465608 1:215483420-215483442 CAAACCAGGCAGAAGAAGGTGGG - Intergenic
922170322 1:223149086-223149108 GAATCCAGGCATAGTGTGGCTGG - Intergenic
924258254 1:242203654-242203676 CAATCCAGGCAGAAGGTGAAGGG - Intronic
924538352 1:244957780-244957802 CAATCACGGCAGAGGGTGAAGGG - Intergenic
1063362161 10:5467784-5467806 GGATCCCGGCAGAGGGTGTTGGG - Intergenic
1064494799 10:15898032-15898054 AAAGCCTGGCAGAGGGTGGGTGG + Intergenic
1064678638 10:17786993-17787015 CAATCATGGCAGAGGGTGAAAGG - Intronic
1065064617 10:21948462-21948484 AATTCCAGGCAGAGTGTGTTTGG + Intronic
1065689534 10:28319117-28319139 CAATCATGGCAGAGGGTGAAGGG + Intronic
1065715389 10:28561922-28561944 CAATGAGGGTAGAGGGTGGTTGG - Intronic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1068069324 10:52176466-52176488 CAATCCTGGTGGTGGGTGGTAGG - Intronic
1068919413 10:62466427-62466449 CAAGCCAGGCACAGAGTGGCAGG - Intronic
1069029959 10:63585192-63585214 CTTTCCAGGCACAGGGTGCTAGG + Intronic
1069160227 10:65083908-65083930 CAGCACCGGCAGAGGGTGGTAGG + Intergenic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1070389708 10:75958831-75958853 CAATCGTGGCAGAAGGTGGAAGG + Intronic
1070554573 10:77517695-77517717 CAAGCAAGGCAGACGGTGGGAGG - Intronic
1071460486 10:85889165-85889187 CAATCAAGGCAGAGGCTGAGTGG + Intronic
1071476685 10:86031644-86031666 CAACCCAGGCAAGAGGTGGTAGG - Intronic
1071541957 10:86493457-86493479 CAATCTAGGCAGAGGGATATGGG + Intronic
1072237763 10:93467880-93467902 CACTGCAGGCAGAGGGTGCCAGG + Intronic
1072322496 10:94264361-94264383 CAAGCCAGGCAGAGAATGGCAGG + Intronic
1075043679 10:119128732-119128754 CAATCATGGCAGAGGGTGAAGGG + Intronic
1075245138 10:120814890-120814912 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075834225 10:125439903-125439925 CAATTCAGGGAGAGAGAGGTGGG + Intergenic
1075988484 10:126810421-126810443 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1077184395 11:1229819-1229841 CACCCCAGGCGGAGGCTGGTGGG - Intronic
1077184410 11:1229869-1229891 CACCCCAGGCAGAGGCTGGCGGG - Intronic
1077289991 11:1784647-1784669 AAAGCCAGGCAGAGGGTACTGGG - Intergenic
1077654550 11:4006269-4006291 CAATCAAGGCAGAAGGTGAAAGG - Intronic
1077717885 11:4599944-4599966 GAATCAGGGAAGAGGGTGGTTGG + Exonic
1078451595 11:11444397-11444419 GAACCCAGACAGAGGTTGGTGGG - Intronic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1080591931 11:33732083-33732105 CAATCATGGCAGAGGGTGAAAGG - Intronic
1080751967 11:35158951-35158973 CTGTCCTGGCAGTGGGTGGTGGG + Intronic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1081665532 11:44915082-44915104 CTGTCCAGGCCGAGGCTGGTGGG + Intronic
1083718525 11:64592565-64592587 GAGTTCAGGCAGAGGGTGGCAGG + Intronic
1083759102 11:64806153-64806175 CAGTCCTGGACGAGGGTGGTTGG + Intronic
1083910401 11:65705301-65705323 CAATCAAGGCAGAGGGTGAAGGG - Intergenic
1084540376 11:69782607-69782629 CCATCCAGGGAGAGGGAGGGGGG - Intergenic
1084681440 11:70668772-70668794 CATTCCAGACAGAGTGGGGTTGG + Intronic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1087669122 11:101084194-101084216 CAATCAAGGCAGAAGGTGAAGGG - Intronic
1087781337 11:102304044-102304066 CAATCATGGCAGAAGGTGATGGG + Intergenic
1088222440 11:107583496-107583518 CAATCAAGTCAGAGGCTTGTGGG + Intergenic
1089171217 11:116512903-116512925 CATTCCAGGCAGGGGCTTGTGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089598249 11:119596261-119596283 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1090251049 11:125252177-125252199 TACTCCAGGCAGAGGGAGCTTGG + Intronic
1090693064 11:129206014-129206036 TAATCCAGTCAGATGGGGGTGGG - Intronic
1090955934 11:131512851-131512873 CAAGACAGGGAGAGGGTGGGGGG - Intronic
1091346330 11:134856753-134856775 CAGTGCAGGCAGAGCGTGGCTGG + Intergenic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1092135879 12:6146703-6146725 AAAGCCAGGCAAAGGTTGGTGGG + Intergenic
1092387791 12:8049498-8049520 CAATACGGGCAGGGGCTGGTGGG - Exonic
1094134779 12:27113239-27113261 AAATCCAGGCTGAGGCTGGAGGG + Intergenic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1096511719 12:52133678-52133700 CACTCTTGGCTGAGGGTGGTGGG - Intergenic
1096616166 12:52834592-52834614 CAAGCCAGCCACTGGGTGGTGGG - Intergenic
1097448554 12:59707360-59707382 AGATCCAGCCAGAGGGTGGAGGG - Intronic
1097507467 12:60494066-60494088 TTATCTAGGCAGAGGCTGGTGGG + Intergenic
1099648384 12:85391213-85391235 CAACCCAGGCACAGGGAGTTGGG - Intergenic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG + Intronic
1104455789 12:128911233-128911255 GCATCCAGGCAGAAGGTGGGTGG - Intronic
1105622357 13:22080616-22080638 TAATCCAGGCATAGGATGGATGG - Intergenic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1106778139 13:33028044-33028066 CAACCCAGGCATAGGCTGATGGG + Intronic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1107550113 13:41466004-41466026 CAATACAGGAAGGGGGTGATAGG - Intronic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1109218371 13:59616031-59616053 CAATCATGGCATAGGGTGGCAGG + Intergenic
1111804382 13:93021169-93021191 CAATCATGGCAGAAGGTGATGGG + Intergenic
1111943720 13:94641266-94641288 CATTCCTGGCAGAGGAAGGTTGG + Intergenic
1114197395 14:20490967-20490989 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1117088238 14:52223307-52223329 TAAAGGAGGCAGAGGGTGGTCGG - Intergenic
1118030831 14:61816282-61816304 CAGTCCTGGAAGAGGGTGGGTGG + Intergenic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119369614 14:74128207-74128229 GGACCCAGGCAGAGGCTGGTGGG + Intronic
1119556138 14:75554412-75554434 CAATCCAAAGAGAGGGTCGTGGG - Intergenic
1119825473 14:77654021-77654043 CAATCCAGGAAATGCGTGGTGGG + Intergenic
1120210742 14:81631189-81631211 GAACTCAGGCAGAGGGTGGCTGG + Intergenic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1121152864 14:91653547-91653569 CAATCATGGCAGAGGGTGGAAGG + Intronic
1122368937 14:101216922-101216944 CAGTCAAGCCAGAGGGTCGTGGG + Intergenic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1122461542 14:101899727-101899749 CAATACACGCAAAGTGTGGTAGG + Intronic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1123198088 14:106636107-106636129 CAATCAAGGCAGAGTGTGAAGGG - Intergenic
1123771453 15:23533902-23533924 CAAAAGAGGCAGAGAGTGGTCGG + Intergenic
1124158306 15:27247719-27247741 CAATCATGGCAGAGGGTGAAAGG + Intronic
1124192469 15:27592208-27592230 CAAGGCAGGCAAAGGCTGGTAGG + Intergenic
1125004298 15:34800020-34800042 TAACCCAGGCAGAGGGTATTTGG + Intergenic
1125203576 15:37125312-37125334 CCAGCCAGGTAGAGAGTGGTTGG + Intergenic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1126856851 15:52847293-52847315 CAATCCTGGCAGAAGGTGAAGGG + Intergenic
1127514796 15:59682450-59682472 GAATCCAGGCTGAGGATGGAAGG - Exonic
1128111933 15:65081956-65081978 CCATCCCTGCTGAGGGTGGTGGG - Intergenic
1128126683 15:65198161-65198183 CAATCCAGACACAGGGCTGTGGG - Exonic
1129888001 15:79052144-79052166 AAAGCCAGTCTGAGGGTGGTGGG - Intronic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1132803592 16:1765788-1765810 ACCTCCAGGCAGAGGGTCGTGGG + Intronic
1133635519 16:7661429-7661451 CTGTCAAGGCAAAGGGTGGTGGG - Intronic
1133652696 16:7827990-7828012 AAATCCAGGGGCAGGGTGGTGGG + Intergenic
1133928043 16:10209720-10209742 AAATCCAGGGAGATGGTGGGGGG + Intergenic
1134552652 16:15145161-15145183 CAAGGTAGGAAGAGGGTGGTGGG + Intergenic
1135650000 16:24197680-24197702 TAATCCAGGCAAAAGGTGATAGG + Intronic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1137535568 16:49321825-49321847 AAATCCAGGCAGAGCCTGGTGGG - Intergenic
1137735484 16:50720130-50720152 CAAGCCAGGGAGAGAGTGGGCGG + Intronic
1138246468 16:55470588-55470610 CAATGCAGTCTGAGGGTGGGAGG - Intronic
1138966989 16:62096386-62096408 GATTCATGGCAGAGGGTGGTAGG - Intergenic
1139558131 16:67725552-67725574 CAAGGCAGGCAGTGGGAGGTGGG + Exonic
1139682406 16:68575206-68575228 CAAGCCAGGCACAGCATGGTGGG - Intronic
1139912773 16:70408378-70408400 CAAACCAGGCAGAAGGAGCTGGG + Intronic
1141165476 16:81657866-81657888 CAAACCAGGAAAAGGGTTGTAGG - Intronic
1142129324 16:88425561-88425583 GAATCCAGGCACAGAGAGGTGGG - Intergenic
1142178264 16:88654981-88655003 GAACCCAGGAAGAAGGTGGTGGG + Intronic
1142422373 16:89979786-89979808 CATTACAGGAAGAGGCTGGTAGG + Intergenic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1143585287 17:7847725-7847747 TCAACCAGGCAGGGGGTGGTGGG - Exonic
1143778545 17:9216647-9216669 AAATCCAGGGAAAGGCTGGTAGG - Intronic
1143935991 17:10484718-10484740 CAATCATGGCAGAAGGTGATGGG + Intergenic
1144159360 17:12542634-12542656 CAATCATGGCAGAAGGTGATGGG + Intergenic
1144357785 17:14462378-14462400 CAATCCTGGCAGAAGGTGAAGGG + Intergenic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1146005666 17:29159094-29159116 CCATCCAGCCTGTGGGTGGTGGG - Intronic
1146398253 17:32485622-32485644 CAATCAAGGCAGAAAGTGCTGGG - Intergenic
1147237755 17:39070140-39070162 CAATACAGGAAGAGGTTGGGTGG + Intronic
1148114238 17:45165714-45165736 TATTCCAGGCAGAAGTTGGTAGG - Intronic
1148522959 17:48299704-48299726 CAATGCAGGTAAATGGTGGTAGG + Intronic
1149100477 17:52900537-52900559 TAATCCAGAAAGAGAGTGGTGGG + Intergenic
1149109172 17:53006318-53006340 CACTCCAGGCAGAAGGTACTAGG - Intergenic
1149840056 17:59954533-59954555 CAATCCAGCCAGAGGTTGGCTGG + Intronic
1150034317 17:61777551-61777573 GAACCCAAGCAGAGGGTTGTGGG - Intronic
1150295825 17:64006881-64006903 GAATCCAGGCAGAGGAAGCTGGG + Intronic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1160991065 19:1860527-1860549 CACTCCAGGCAGGGGTGGGTGGG + Intronic
1162667508 19:12226778-12226800 CACTCCAGGCTGGGCGTGGTGGG + Intronic
1163187905 19:15652680-15652702 CATTCCAGGAACAGGGTGGGTGG + Intronic
1166920274 19:46224459-46224481 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1167425375 19:49427465-49427487 CAATCCGGGCTGAGGGAGGAGGG - Exonic
1168176374 19:54630803-54630825 CAAACCAGACAGACGGTGGCTGG + Intronic
1168306662 19:55439579-55439601 GAGGCCAGGGAGAGGGTGGTTGG - Intronic
925061456 2:893964-893986 CACTCCAGTCAGAGGGAAGTGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925522102 2:4758394-4758416 CAATCATGGCAGAGGGTGAAAGG + Intergenic
925686941 2:6482486-6482508 CCATCCAGGGAGAAGGAGGTTGG - Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
926141220 2:10369601-10369623 GGCTCCAGGCAGAGGGAGGTGGG + Intronic
926974206 2:18496988-18497010 CAATCATGGCAGAAGGTGATGGG + Intergenic
927241816 2:20925823-20925845 AAACCCAGGCAGAGGGTGGTGGG + Intergenic
927701328 2:25270654-25270676 CAACACTGGCAGAGGGTGGGGGG + Intronic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
929264025 2:39898675-39898697 GAATCCAGGAAGTGGGTAGTGGG - Intergenic
932161853 2:69467505-69467527 GAATCCAGAGAAAGGGTGGTTGG + Intronic
932623036 2:73277341-73277363 CAATAAAGGCAGGGGGAGGTAGG + Intronic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
935672360 2:105566653-105566675 CAATCCAGCCAGGGGATGGGAGG - Intergenic
935747012 2:106197255-106197277 CAATCATGGCAGAGGGTGAAGGG - Intergenic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936373731 2:111923604-111923626 CAATCCTGGAAGAAGGTGGGAGG + Intronic
936492700 2:112986249-112986271 CAATCATGGCAGAGGGTGAAGGG - Intergenic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
937333620 2:121047189-121047211 CTCTCCAGGTACAGGGTGGTGGG + Intergenic
937625504 2:124038927-124038949 CAATACAAGCAGAGGCAGGTGGG - Intronic
938296426 2:130182205-130182227 CGCTGCAGGGAGAGGGTGGTGGG + Exonic
939005126 2:136778117-136778139 CTATGCAGACAGAGGGTTGTAGG - Intronic
939149908 2:138460989-138461011 CAATCATGGCAGAAGGTGATGGG + Intergenic
940328232 2:152447682-152447704 TAATCCAGGCAGAGGGAGGTAGG - Intronic
940614830 2:156037452-156037474 GAATTCTGGGAGAGGGTGGTCGG - Intergenic
941543482 2:166816036-166816058 GAATCCAAGGAGAGGGAGGTGGG + Intergenic
942218628 2:173747261-173747283 CCAACCAGGCAGATGGTGGATGG - Intergenic
942383067 2:175412940-175412962 GTATCCAGGTATAGGGTGGTGGG - Intergenic
942415160 2:175750983-175751005 CAATCCTGGCAGAAGGTGAAGGG - Intergenic
942419855 2:175796473-175796495 CAATCATGGCAGAGGGTGAAAGG - Intergenic
944904498 2:204249340-204249362 CAATCCAGTCCGAGTATGGTCGG + Intergenic
946038734 2:216765899-216765921 CACTGCAGGCTGAGGGTGGGAGG + Intergenic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946945290 2:224815235-224815257 CAATCAAGGCAGAAGGTGAAGGG - Intronic
947438090 2:230090660-230090682 CAATCATGGTAGAGGGTGATGGG - Intergenic
948532240 2:238616668-238616690 CATTCCAGGAAGAAGGGGGTGGG - Intergenic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1169202692 20:3720551-3720573 GAATCCAGGCACAGGAAGGTGGG + Intergenic
1169804871 20:9549234-9549256 CACTCCAAGCAGATGGTGGTGGG + Intronic
1170606219 20:17876746-17876768 AAATCCAGGGCCAGGGTGGTTGG + Intergenic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1172518253 20:35550844-35550866 CAATCCAGGCAAAAGATGGTGGG + Intronic
1172625054 20:36342100-36342122 CAGCCCAGAAAGAGGGTGGTGGG - Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173110852 20:40188755-40188777 GAACCCAGACAGAGGGTGGTGGG - Intergenic
1174315650 20:49698737-49698759 CAACACAGGCACAGGGTGGCAGG - Intronic
1174315920 20:49701557-49701579 CAACACAGGCACAGGGTGGCAGG - Intronic
1174349285 20:49955538-49955560 GAATCCAGGCAGCTGGTGATGGG + Intergenic
1174688836 20:52482439-52482461 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175911369 20:62406927-62406949 CCATCCAGGCCGAGGCCGGTGGG + Exonic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176659515 21:9621311-9621333 TAAGCCAGGCAGAGTGTGGCAGG + Intergenic
1177287994 21:19076506-19076528 AAACCTAGGCAGAGGGTGCTTGG - Intergenic
1177880718 21:26690623-26690645 CAATCACGGCAGAGGGTGAAAGG + Intergenic
1178743660 21:35226795-35226817 CACTCCAGGCAGAGGGAATTTGG - Intronic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179317188 21:40254287-40254309 CACTCCAGGCAGGGGGAGGGTGG + Intronic
1179367018 21:40768219-40768241 CAATTCAGGCAGGGGGTGACTGG - Intronic
1179485120 21:41705160-41705182 AAAGCCAAGCCGAGGGTGGTGGG + Intergenic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1183781776 22:40003461-40003483 CAATCCAAGCTGGGGGAGGTGGG + Intronic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1184962593 22:47942363-47942385 CAATCCTGGCAGAAGGTGAGAGG + Intergenic
951202461 3:19890429-19890451 CAGTCCTGGGAGAGGATGGTAGG + Intronic
951351796 3:21615283-21615305 CAATCATGGCAGATGGTGGAGGG - Intronic
952234011 3:31460547-31460569 CAGTGAAGGCAGAGGGTGTTGGG - Intergenic
952613138 3:35235511-35235533 GAATCCAGGCAGAGTGGGCTGGG + Intergenic
952990480 3:38827069-38827091 CACACCTGGCTGAGGGTGGTAGG + Intergenic
953013841 3:39053320-39053342 TAATCCCAGCAGAAGGTGGTAGG + Intronic
955356759 3:58238082-58238104 CTATCCAGGCAGCGGGAGGTGGG - Intronic
957487592 3:80882710-80882732 CGAGCAAGACAGAGGGTGGTGGG + Intergenic
957589749 3:82180613-82180635 CAATTAAGGCTGAGTGTGGTGGG - Intergenic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
961714869 3:128851496-128851518 CAAACCAAGCGGAGGGTGGGGGG - Intergenic
962027391 3:131562760-131562782 CAATGCAGGCAGTGGGTGAGGGG - Intronic
962821046 3:139047437-139047459 GCATCCAGGCAGAAGGCGGTGGG + Intronic
963547854 3:146684549-146684571 CAATCATGGCAGAGGGTGAAAGG + Intergenic
963683384 3:148409360-148409382 CAATCATGGCAGAGGGTGAAGGG + Intergenic
963707879 3:148710945-148710967 CAATCATGGCAGAAGGTGATAGG - Intronic
963816504 3:149837529-149837551 CAATCATGGCAGAGGGTGAAAGG + Intronic
964708368 3:159645566-159645588 CAATACACGCAGAGGGTGCCTGG - Intronic
965886721 3:173455222-173455244 CAATCATGGCAGAGGGTGAAGGG + Intronic
967695863 3:192529691-192529713 CAATCAAGGCAGAAGGTGAAAGG + Intronic
970367601 4:15375757-15375779 CAACCCAGGCTGAGGGTGTGGGG - Intronic
971003826 4:22351885-22351907 ATAGCCTGGCAGAGGGTGGTCGG - Intronic
971562033 4:28090846-28090868 AAATCCAGGAAGAGAATGGTTGG + Intergenic
974002698 4:56527326-56527348 CAAACCAAGCAGAGGTTGGCAGG - Intergenic
974902866 4:68022465-68022487 CAATGCAAGCTGAGGGTGATGGG - Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978586011 4:110276466-110276488 CAATCTAGGCAGACAGTGATGGG - Intergenic
978892611 4:113848145-113848167 CAATCATGGCAGAGGGTGAATGG + Intergenic
978921206 4:114184576-114184598 CATTCCAGGCAGAGGAAAGTAGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
980598416 4:134987281-134987303 CAATCCTGGCAGAAGGTGAAAGG - Intergenic
980960301 4:139468148-139468170 CAATCAAGGCAGAAGGTGAAAGG + Intronic
981713096 4:147728157-147728179 AAATCCAGACAGAAGGTGGTTGG - Intergenic
982236169 4:153253078-153253100 CAATCCAGACTGTGGGTGGGAGG + Intronic
982312849 4:154003806-154003828 CAATCCAGGCAGGCGGTTGATGG + Intergenic
985368453 4:189259823-189259845 CAATCCTGGCAGAAGGTGAAAGG + Intergenic
985415857 4:189735102-189735124 TAAGCCAGGCAGAGTGTGGCAGG - Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
987681645 5:21143721-21143743 CAATCATGGCAGAGGGTGAAGGG - Intergenic
988443087 5:31254076-31254098 CAATCCAGGCAGGATGTTGTGGG - Intronic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
988780462 5:34516591-34516613 TAATCCAGGCAGGGCGTGGTGGG - Intergenic
989332743 5:40278816-40278838 CTATCCAGGCTGAGGGAGGAAGG + Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990632405 5:57684579-57684601 CAATCCTGGCAGAAGGTGAAGGG - Intergenic
991075974 5:62538576-62538598 CAATCAAGGCAGAAGGTGAAAGG - Intronic
991120474 5:63007941-63007963 CAATCGTGGCAGAAGGTGATGGG + Intergenic
991285819 5:64974380-64974402 CAATCATGGCAGAGGGTGAAAGG + Intronic
991605994 5:68401723-68401745 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
992745938 5:79820340-79820362 CAATCATGGCAGAGGGTGAAAGG - Intergenic
993262810 5:85681961-85681983 CAATCATGGCAGAAGGTGATAGG + Intergenic
993278119 5:85888386-85888408 CAATCACGGCAGAGGGTGAAAGG + Intergenic
993594548 5:89836068-89836090 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
993620058 5:90157420-90157442 AAATTCAGGAAGAGGCTGGTTGG - Intergenic
993623969 5:90201342-90201364 GAATCCAAGAACAGGGTGGTGGG - Intergenic
995392258 5:111652495-111652517 CAATCATGGCAGAGGGTGAAAGG + Intergenic
995597798 5:113766203-113766225 CAACCCTGGCAGAAGGTTGTGGG - Intergenic
997545374 5:134701803-134701825 CACTCTAGAAAGAGGGTGGTGGG - Intronic
1000223176 5:159233827-159233849 TAAAGCAGGCAGAAGGTGGTGGG - Intergenic
1000434115 5:161186507-161186529 CAATCATGGCAGAAGGTGATGGG + Intergenic
1001714742 5:173806141-173806163 TAATCCAGGCAAAGGGTTTTGGG - Intergenic
1001847135 5:174932350-174932372 GAATCTAGGCAGAGGGTAGGGGG - Intergenic
1002212567 5:177607568-177607590 CCCTCCAGGCTGCGGGTGGTGGG + Intronic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1003643971 6:7899276-7899298 CAAACAAGGCGCAGGGTGGTGGG + Intronic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1005163942 6:22897660-22897682 CAATACAGCCAGTCGGTGGTAGG + Intergenic
1006410236 6:33869339-33869361 CAATCCAGGTAGTGGGTGGATGG + Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1007847752 6:44774490-44774512 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1008567661 6:52785030-52785052 ACATCAAGGCAGAAGGTGGTGGG + Intergenic
1008571796 6:52823866-52823888 ACATCAAGGCAGAAGGTGGTGGG + Intergenic
1009824195 6:68845696-68845718 CAATCATGGCAGAGGGTGAAAGG - Intronic
1010785123 6:79992008-79992030 CAATCATGGCAGAAGGTGATGGG - Intergenic
1011247682 6:85336788-85336810 CATTCCAGGCAGAGAAAGGTTGG + Intergenic
1011445327 6:87433013-87433035 CAAACGAGGCAAAGCGTGGTAGG - Intronic
1012222984 6:96673486-96673508 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1012598696 6:101069446-101069468 CAATCCAGGCAGTTGGTGGTGGG - Intergenic
1013715952 6:112961804-112961826 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1014082601 6:117304966-117304988 CAATCATGGCAGAGGGTGAAGGG - Intronic
1014449242 6:121564556-121564578 CAATCCTGGCAGACGGTGAAGGG - Intergenic
1016388657 6:143553414-143553436 CAAACCAGGAAGAGGGGAGTTGG + Intronic
1017194376 6:151684276-151684298 AAATCCAAGCATAGGATGGTGGG + Intronic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1020754920 7:12190283-12190305 CAATCCTGGCAGAAGGTGAAAGG + Intergenic
1021059526 7:16093423-16093445 GAACCCAGACATAGGGTGGTGGG - Intronic
1022383086 7:29878832-29878854 GTATCAAGGCAGAGGGTGCTTGG + Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1023179272 7:37465376-37465398 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1024814990 7:53257794-53257816 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1024832280 7:53474696-53474718 AAATCCAGGCACAGTGTGTTGGG - Intergenic
1026403909 7:70044418-70044440 CAAAAAAGGCAGAGGGTGGGGGG - Intronic
1028608542 7:92682283-92682305 CAATGAAGGCAGAGAGTGGGTGG - Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1030014084 7:105201072-105201094 CAGTCCTGGCAGAGGGTGAGGGG + Intronic
1031080401 7:117252042-117252064 CAAGCCAGGCAGAGGGTCATGGG - Intergenic
1031730019 7:125288605-125288627 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1033369524 7:140696043-140696065 CAAAGCAGGCAGAGAGGGGTTGG + Intronic
1033818387 7:145103150-145103172 AAACCCAGGCAGAGCCTGGTGGG + Intergenic
1034122628 7:148641195-148641217 CACACCAGACAGAAGGTGGTTGG + Intergenic
1034272525 7:149810190-149810212 CACTCTAGTCAGAGGGTGGTAGG + Intergenic
1035055687 7:156034490-156034512 CAATCCTGGCAAAGGGTGAAGGG + Intergenic
1035108394 7:156460709-156460731 GAGTCCAGGCAGGTGGTGGTTGG + Intergenic
1035432503 7:158832766-158832788 CAATGGAGGCTCAGGGTGGTAGG + Intergenic
1036742795 8:11380170-11380192 CAATCAAGTGAGTGGGTGGTAGG + Intergenic
1037105745 8:15105441-15105463 CAATCAAGGCAGAAGGTGAGGGG + Intronic
1037638746 8:20723413-20723435 CAGTCCAGGCAGTGAGTGGATGG - Intergenic
1037993889 8:23339325-23339347 CGATCCAAGGAGGGGGTGGTGGG - Intronic
1038729003 8:30110238-30110260 AAATTCTAGCAGAGGGTGGTGGG + Intronic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1039026269 8:33261638-33261660 AAATACATGAAGAGGGTGGTAGG - Intergenic
1039615512 8:38952085-38952107 AGATTCAGGCAGAGGGAGGTAGG + Intronic
1040545776 8:48396947-48396969 GACTCCAGGCAGAGGGATGTGGG - Intergenic
1042471038 8:69188485-69188507 CAATTCAGGCAGAGGGGTGCAGG - Intergenic
1044080133 8:87873182-87873204 AAATCAAGGCAGCGGGTGGAAGG - Exonic
1044153255 8:88809273-88809295 AAATTCAGGCAGTGGGGGGTGGG + Intergenic
1044216217 8:89613851-89613873 TAATCCAGGCAGAGGGAGTAGGG - Intergenic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1048425530 8:134319689-134319711 CAATCCAGGGAGAGGGTGTGAGG + Intergenic
1048594834 8:135855396-135855418 CAATCATGGCAGAAGGTGATAGG + Intergenic
1048880784 8:138870985-138871007 CAGGCCAGGCAGAGGGATGTGGG + Intronic
1049630013 8:143648740-143648762 CAAGCCTGGCAGAGGATGGGTGG + Intronic
1049790451 8:144469924-144469946 CAAGGCAGGCGGTGGGTGGTGGG + Intronic
1050945284 9:11510025-11510047 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1051191436 9:14517227-14517249 CATTCCAGAGAGAGGTTGGTGGG - Intergenic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1054354842 9:64050471-64050493 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1056005276 9:82263061-82263083 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1058049134 9:100388953-100388975 CAACCCAGGAAGTGGGTGGGAGG + Intergenic
1058158233 9:101538890-101538912 CAAACCAGGGAGGGGTTGGTGGG - Intronic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1058717070 9:107732045-107732067 CACACCAGGCTGAGGGTGGGAGG + Intergenic
1059247547 9:112861646-112861668 CAAGACTGGCAGAGGGTGGCAGG - Intronic
1059336986 9:113575140-113575162 GCATCCAGGCAGGTGGTGGTGGG + Intronic
1060289932 9:122292562-122292584 AAATGCAGGGAGAGGGTGGTAGG + Intronic
1060532164 9:124354281-124354303 CACTCCAGGAAGAAGGTGTTGGG - Intronic
1060789973 9:126479316-126479338 CAGGTCAGGCAGATGGTGGTGGG + Intronic
1060910078 9:127342579-127342601 CAAACCAGGGACAGGGAGGTTGG + Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061416998 9:130452394-130452416 CAACCCAGACAGAGGCTGGCAGG - Intronic
1061618547 9:131795864-131795886 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
1062338195 9:136081774-136081796 CCATCCAGGTAGAGGGAGCTTGG - Intronic
1203743179 Un_GL000218v1:19601-19623 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1203637076 Un_KI270750v1:123154-123176 TAAGCCAGGCAGAGTGTGGCAGG + Intergenic
1185648121 X:1629464-1629486 AAATCCAGGAAGCGGGTGGGAGG - Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186268509 X:7858797-7858819 CAATCATGGCAGAGGGTGAAGGG + Intergenic
1186540964 X:10399280-10399302 CAGGCCAGGCAGTGGGTGGAAGG + Intergenic
1188861298 X:35259725-35259747 CAGTGCAGGAAGAGGCTGGTAGG - Intergenic
1189078863 X:37947476-37947498 CAATCATGGCAGAGGGTGAAGGG - Intronic
1189087860 X:38046363-38046385 CAATCAAGGCAGAAGGTGAGAGG + Intronic
1189340272 X:40199841-40199863 CAATCCAGGCAGAAGGCGGCAGG - Intergenic
1189436535 X:40997870-40997892 CAATCCAGTCATGGGGTGGGTGG + Intergenic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192179641 X:68908465-68908487 AAGTCCAGGCAGATGGTGGTGGG + Intergenic
1193058833 X:77182940-77182962 CAATCATGGCAGAGGGTAATAGG - Intergenic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1196103453 X:111871450-111871472 TAATCCAGCCAGGGAGTGGTGGG - Intronic
1196168780 X:112564785-112564807 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
1196540833 X:116905248-116905270 CAATCCAAACATAGTGTGGTAGG - Intergenic
1197643037 X:128987098-128987120 CAATCAAGGCAGAAGGTGAAAGG - Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199989555 X:152978490-152978512 CAATCATGGCAGAAGGTGATGGG + Intergenic
1201156708 Y:11137068-11137090 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1201437900 Y:13979192-13979214 CAAATCAGGCAGAAGGAGGTGGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic