ID: 1101318257

View in Genome Browser
Species Human (GRCh38)
Location 12:103649701-103649723
Sequence TGGGATGCCTTGGGAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101318257_1101318269 16 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318269 12:103649740-103649762 AGTGGCATCCCTTGGGCTCAGGG 0: 1
1: 3
2: 0
3: 19
4: 221
1101318257_1101318267 9 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318267 12:103649733-103649755 AAGTATTAGTGGCATCCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 119
1101318257_1101318270 17 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318270 12:103649741-103649763 GTGGCATCCCTTGGGCTCAGGGG 0: 1
1: 0
2: 1
3: 54
4: 2071
1101318257_1101318268 15 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318268 12:103649739-103649761 TAGTGGCATCCCTTGGGCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 242
1101318257_1101318265 -2 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318265 12:103649722-103649744 CATAGGGCATCAAGTATTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 64
1101318257_1101318266 8 Left 1101318257 12:103649701-103649723 CCCATTTTTCCCAAGGCATCCCA 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1101318266 12:103649732-103649754 CAAGTATTAGTGGCATCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101318257 Original CRISPR TGGGATGCCTTGGGAAAAAT GGG (reversed) Intronic
907447897 1:54520700-54520722 CATGATGCCTTGGGAAACATGGG + Intergenic
907515585 1:54991399-54991421 TGGGATGCCCAGGGCAGAATGGG - Intronic
908066948 1:60416187-60416209 TGGGATCTCATGGGATAAATGGG + Intergenic
910936736 1:92489318-92489340 TGGGACGGCATGGGAAAAGTGGG + Intergenic
912237676 1:107869383-107869405 TGGGATTCATTGGTAAACATAGG - Intronic
912778530 1:112522781-112522803 GGGGATGCCTGTGGAGAAATGGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919343571 1:196345549-196345571 TGGGATGACTTGGCAATCATTGG + Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922216641 1:223525475-223525497 AGGGATGTCTTGGGCAAAAGTGG - Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1066264604 10:33763980-33764002 TGGGCTGCCTTGGAAGGAATAGG + Intergenic
1067268406 10:44767453-44767475 TGGGATGCCCCTGGAAATATGGG - Intergenic
1069996352 10:72344391-72344413 TGGGAGACCTGGGGAGAAATGGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072728940 10:97831849-97831871 GGGGATGCCATGGTAAATATAGG + Intergenic
1074346250 10:112689211-112689233 GGGAATACCTTGGGAAAAGTGGG - Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1077981547 11:7306306-7306328 TGAGAAGGCTTGAGAAAAATAGG - Intronic
1078531875 11:12142890-12142912 AGGGAGGGCTGGGGAAAAATAGG + Intronic
1078643787 11:13119612-13119634 TGGGGTGCAATGGGAAACATAGG - Intergenic
1078734977 11:14011593-14011615 TGGGCTGACTTGAGAACAATAGG - Intronic
1079146090 11:17853360-17853382 TGTGGTGCCTTGGGAAATACAGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083400013 11:62417023-62417045 AGAGAAGACTTGGGAAAAATAGG - Intronic
1084841252 11:71851400-71851422 TGAGATGCTTTGGGGAATATGGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1087639905 11:100745734-100745756 CCAGATGGCTTGGGAAAAATAGG - Intronic
1089243766 11:117103240-117103262 TCGGATGCCCTGGGGAAATTGGG - Intergenic
1092169007 12:6361804-6361826 CAGGATGCCTTGGGAAGACTGGG - Intronic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1093366517 12:18306196-18306218 TGGGAAGTCTTAAGAAAAATAGG + Intronic
1093431795 12:19093152-19093174 GGGGATCTCTTGAGAAAAATAGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095392260 12:41721745-41721767 TGGCCTGCCTTAGGGAAAATGGG - Intergenic
1099400214 12:82194430-82194452 TTTGATGCCATGGGAATAATTGG + Intergenic
1099580437 12:84439958-84439980 TGGGAAGTCTTGGGAAGTATTGG - Intergenic
1100341319 12:93682414-93682436 TGGGAGGCCTTGAGAACAAATGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1103652332 12:122442633-122442655 TGTAATGCCTTTGAAAAAATTGG + Intergenic
1103824100 12:123722254-123722276 TTAGATGGCTTGGGAAACATTGG + Intronic
1103826893 12:123746201-123746223 TGGGAGGCATAGGGGAAAATTGG + Intronic
1107038058 13:35921154-35921176 TGGGATATCCTGGGAATAATAGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1112906746 13:104431767-104431789 TGGCATGGCTGGGGAAAAAGAGG + Intergenic
1114537471 14:23432130-23432152 TGGGCTGTTTTGGGAAAAGTTGG + Intronic
1114568799 14:23651346-23651368 TGGGATGCCTCTGGAAGAGTGGG + Intergenic
1114881088 14:26787154-26787176 TGGGATGGCTAGTGAAAAGTGGG + Intergenic
1116202175 14:41811762-41811784 TGGGAAGGCTTGGGAGAAGTAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120031144 14:79642325-79642347 TTGGATGGCTTGGTCAAAATGGG - Intronic
1120092970 14:80355271-80355293 TGGAAAGCCTTGTGAAAGATTGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122559882 14:102605266-102605288 TTGGTTGCCTGGGGACAAATTGG + Intronic
1127494285 15:59495187-59495209 TGGGGAGGCTGGGGAAAAATGGG - Intronic
1127728015 15:61769869-61769891 AGGGTTGCCCTGGGAAAATTGGG + Intergenic
1128504027 15:68253421-68253443 ATGAATGCCTTGGGAAATATTGG - Intronic
1135168030 16:20157590-20157612 TTAGATGCCCTGGGAAAAGTGGG + Intergenic
1137381428 16:48003081-48003103 TGGGTAGCCTTGGGAGAAAATGG + Intergenic
1137684762 16:50378999-50379021 TGGGATCCCTTAGAAAAATTAGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138641257 16:58389175-58389197 TGGGATGCTTAAGGAACAATAGG + Intronic
1139157439 16:64460710-64460732 TTGGAAGCCTTTGGATAAATGGG + Intergenic
1141289012 16:82700286-82700308 TGGGATGCCCTGTGAACAAAAGG - Intronic
1143407297 17:6685950-6685972 TGGCAAGGCTTGGGAAAGATGGG + Exonic
1144795464 17:17888461-17888483 TGGGATGCCTTTGGATAGAAGGG + Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1148099274 17:45078168-45078190 TGATAGGCCTAGGGAAAAATTGG + Intronic
1149790611 17:59473688-59473710 TGAAATGCTTGGGGAAAAATTGG - Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1153261941 18:3232461-3232483 TGGGAAGACTTGGGAGCAATGGG + Intergenic
1153692575 18:7608199-7608221 TGAGATGACTTGGGAAAAAGAGG + Intronic
1154246460 18:12703240-12703262 GGCGGTGCCTTGGGAGAAATAGG + Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156192607 18:34736982-34737004 TGGTATGGCTTGGGAAGAATGGG + Intronic
1156793963 18:41017607-41017629 TGGGATATCTTGAGAATAATTGG - Intergenic
1158491167 18:57910910-57910932 TGAGATGCTTTGGGGAGAATGGG + Intergenic
1158884605 18:61815092-61815114 TGAGATGGCTTGAGGAAAATCGG + Exonic
1159763365 18:72456043-72456065 TGGGATGCCTAGGAAAAACTTGG + Intergenic
1160215868 18:76930401-76930423 TTGAATGCCTTGGAAAAACTTGG - Intronic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1164786018 19:30931667-30931689 TGGGATGCCCTGGGAGAGGTAGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925070467 2:963200-963222 TGTGATGCTTTTGGAAAAATAGG - Intronic
927693059 2:25221950-25221972 TAGGAAGCCTAGGGAAAAAGGGG + Intergenic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
930171391 2:48255264-48255286 AGGGATGGCATGGGAAAATTAGG + Intergenic
931344963 2:61437940-61437962 TGGAATACCTTGAGAAGAATTGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
934503349 2:94875073-94875095 TGGGGTCCCTCGGGATAAATGGG - Intronic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
936246961 2:110836786-110836808 AGGGAAGCCTTGGAAGAAATAGG + Intronic
939546270 2:143557984-143558006 GGGGATGCCTTGGAAACATTTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942349858 2:175040561-175040583 TGGGAAGCCTCGGGAAACTTAGG - Intergenic
943482802 2:188442579-188442601 TGAGATGCTTTTGGGAAAATAGG + Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
944193713 2:197030007-197030029 TAGGATGCCTTTGGAAATATGGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
944899353 2:204198509-204198531 TGGCATCCCTTGGGGAAAAGGGG - Intergenic
945110911 2:206358564-206358586 TGGAATACTTTGAGAAAAATTGG - Intergenic
945990485 2:216391945-216391967 TGGGAGGCCTTGGGATAGGTGGG + Intergenic
946093240 2:217249248-217249270 TGGGAAGAGATGGGAAAAATAGG - Intergenic
947682148 2:232044557-232044579 TGAGATGCCTAGGGACATATAGG + Intronic
948038842 2:234882953-234882975 TGGGATGACTTTGAATAAATGGG + Intergenic
948655398 2:239473717-239473739 TTGGGGGTCTTGGGAAAAATGGG + Intergenic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1169327153 20:4685617-4685639 AGGCATGCCCTGGGGAAAATAGG - Intergenic
1169727188 20:8748246-8748268 TTGGATGCCTTGGATAAAACTGG + Intronic
1170041851 20:12047142-12047164 TGTTCTGCCTTGAGAAAAATGGG + Intergenic
1170084018 20:12509237-12509259 TGGCATGTTTTGGCAAAAATGGG - Intergenic
1170655696 20:18286036-18286058 AGGGCTGCCTTGGGGAAGATAGG + Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1175353362 20:58342749-58342771 TGGGATGCTTTGAGAAGACTGGG + Intronic
1175654276 20:60755003-60755025 TGGGAGGACTTGGGAGAAAGAGG - Intergenic
1178837224 21:36108939-36108961 CCAGATGGCTTGGGAAAAATAGG + Intergenic
1179090128 21:38257089-38257111 CAGGTTGCCTTGGGAAAGATAGG - Exonic
1182024448 22:27107036-27107058 AGGGAAGCCTTGGGAAAAGAGGG - Intergenic
1182850300 22:33468260-33468282 TGAGATGCCTGGGGTAGAATTGG - Intronic
1183243061 22:36672690-36672712 GGTGATGCCTTGGGAAGAATGGG - Intronic
949402378 3:3679168-3679190 TGGGATGTCCTGGGAAAATTGGG - Intergenic
952733249 3:36662173-36662195 TGGGATGTTTTGGGAAGAATCGG - Intergenic
952745232 3:36770816-36770838 ATGGTTGCCTTGGGAAAAAGGGG - Intergenic
954643233 3:52114779-52114801 TGGGATGACTTGGGAACAGTGGG - Intronic
955960445 3:64335220-64335242 TGGCATGCCTTGAAAAAAAAGGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958734198 3:97990048-97990070 TGAGATGCCTTGGAAGAAATAGG - Intronic
959106939 3:102075741-102075763 TGGGATGGCCTGGGAAAATGTGG - Intergenic
961049997 3:123737913-123737935 TGGAATGCCTGGGTAAAAGTGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962819316 3:139032701-139032723 TGGGATGCTTTGGAAACAAAGGG - Intronic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963836316 3:150061442-150061464 TGATATGCCTTGGAAACAATTGG - Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
965402153 3:168224780-168224802 TGGTATGCATTGGGAAATACAGG + Intergenic
967575371 3:191083995-191084017 TGGGATGGATTGGGAAAGAGGGG + Intergenic
967643163 3:191892847-191892869 TGAGCTGGCTTGGGAAAACTTGG - Intergenic
968971416 4:3797674-3797696 TGGGATGGCTTTGGAAAAGGTGG + Intergenic
969599816 4:8169673-8169695 TGGGGGGCCTTGGGAACATTCGG - Intergenic
969782350 4:9417441-9417463 TGAGATGCTTTGGGGAATATGGG - Intergenic
969902778 4:10364970-10364992 TGTGATGCCTTTGGGAAAAGTGG + Intergenic
970457397 4:16238673-16238695 TGGGTTGCCTTATGAATAATGGG + Intergenic
970615329 4:17763491-17763513 TAGGCTTCCTTGGGACAAATAGG + Intronic
971091436 4:23350579-23350601 TGGAAAGTCTTGGGAAAACTAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
973595900 4:52489653-52489675 TAAGATGCCTTGGGAAATAAGGG + Intergenic
975572957 4:75836601-75836623 TGACCTGCCTTGGGAACAATGGG + Intergenic
977830700 4:101588794-101588816 TTGAATGCCTTGGGAAAGAAAGG + Intronic
979460740 4:120979886-120979908 TGGCATGCTTTGGGATTAATAGG + Intergenic
980197041 4:129602699-129602721 TAGGATGCCTTGGAATACATTGG + Intergenic
982138603 4:152296198-152296220 TAGGATGCTTTGAGACAAATGGG + Intergenic
985881365 5:2641258-2641280 AGGGTTGCCATGAGAAAAATCGG + Intergenic
988328603 5:29804782-29804804 TGTGATGCCTTTAAAAAAATTGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990551151 5:56880618-56880640 TGTAATGCCTTGTGAAAAAGTGG - Intronic
990604606 5:57396093-57396115 AGGCCTGCCTTGGGAAAAAAAGG + Intergenic
994606617 5:101975454-101975476 TGGGATGCAGGGGGAAAGATGGG - Intergenic
994709221 5:103246104-103246126 GGGGATGCCATGTGGAAAATTGG - Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996241663 5:121210792-121210814 TGAGATGACTTTAGAAAAATAGG + Intergenic
996651293 5:125880039-125880061 TGGGATACCTGGGGAATATTGGG - Intergenic
999822181 5:155239297-155239319 TGGGAAGCCCTAGGAAATATGGG - Intergenic
999873425 5:155775761-155775783 GAGGATGCCTTGGGAAACAGTGG + Intergenic
999936765 5:156495002-156495024 TGTGATGCTCTGGGAAAAGTGGG + Intronic
1001548019 5:172582586-172582608 TGAGATGCCTTTGGAAAAGAGGG + Intergenic
1001603884 5:172946452-172946474 TGGGATGATGTGGGAACAATGGG - Intronic
1001643802 5:173265113-173265135 TCAGATGCCTTGGGAAATCTAGG - Intergenic
1001757618 5:174182661-174182683 AGGGATGGCTAGGGAGAAATAGG - Intronic
1003001587 6:2340216-2340238 TGGAATAACTTGAGAAAAATTGG - Intergenic
1006188051 6:32191614-32191636 TGGGGTGCCTAGGGAGAAACAGG + Intronic
1006900600 6:37498453-37498475 TGGCATCCCTTGAGAAATATTGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010188665 6:73171345-73171367 TGGGATACTTTGAGAAAGATGGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011747256 6:90418392-90418414 TAGGATGTCTTGGGAAAGACTGG + Intergenic
1012061920 6:94496285-94496307 TTTGATGGCTTGGGAAAAGTGGG - Intergenic
1012232442 6:96776212-96776234 TGAGTTACCTTGAGAAAAATTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1017480992 6:154854888-154854910 TCAGATGCCTTGATAAAAATTGG + Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020231699 7:6324087-6324109 TGTGATGCCTTTGGGAAAGTGGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1025218830 7:57086471-57086493 TGGGATGCCTTGAAAATGATTGG - Intergenic
1025629752 7:63260059-63260081 TGGGATGCCTTGAAAATGATTGG - Intergenic
1025652520 7:63483968-63483990 TGGGATGCCTTGAAAATGATTGG + Intergenic
1027632423 7:80622894-80622916 TGGGTTGTCTTGGTAAATATTGG + Intronic
1029596212 7:101538776-101538798 TGGGATCCCTGGGGACAAAGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031077082 7:117223197-117223219 AGGGATGCTTTGGGAAAAGGAGG - Exonic
1035242979 7:157544224-157544246 CGGGAGGCCTTGGGAGAAGTGGG + Intronic
1036583399 8:10099865-10099887 TGGGATGCTTTGGGAAAATGAGG - Intronic
1036597356 8:10225953-10225975 TGGCATGCCATAGGAAAAAATGG + Intronic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039622786 8:39014172-39014194 TGGGTTATCTTGGGAAAAGTGGG + Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040605383 8:48926730-48926752 TGGTATGACTTGGGAAAAGGGGG - Intergenic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1047786378 8:128157690-128157712 TGGTATGCCTTAGGGAAAAGAGG + Intergenic
1048590907 8:135820061-135820083 TGGGATTCCATGGGAGTAATGGG - Intergenic
1049131024 8:140841532-140841554 TGGAATGCCTTTTTAAAAATCGG + Intronic
1050569991 9:6927823-6927845 TAGAATGCCTTGAGAAGAATGGG - Intronic
1051039611 9:12791377-12791399 ATGGATGCCTTTGGGAAAATGGG - Intronic
1051554897 9:18372349-18372371 TGGGATTCTTTTGGAATAATGGG + Intergenic
1053266929 9:36721921-36721943 TGGGTTTCCTTAGGAAGAATAGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057805932 9:98220047-98220069 GGGGAAGCCTAGGGAAAGATAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059749275 9:117232547-117232569 TTGGAGGACTTGGCAAAAATGGG - Intronic
1060681987 9:125574375-125574397 TGTGATGCCTTAGGATATATGGG + Intronic
1061958985 9:133978408-133978430 TGGGAGGCCTTGAGGAAACTTGG + Intronic
1062361729 9:136191513-136191535 TGGGATGCCCTGGGCAGAAAAGG - Intergenic
1186749489 X:12606933-12606955 GGGTATGCCTGGGGAAGAATGGG - Intronic
1188399660 X:29729268-29729290 TGGCATGCAGAGGGAAAAATGGG - Intronic
1190347082 X:49347729-49347751 TGGGATGGCTTGGGTCAAATTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192029648 X:67495513-67495535 TGGGAGGCCTTAGGAAACTTAGG - Intergenic
1193206803 X:78759052-78759074 TGGGAAGCCTGGGAAAAGATAGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1196518591 X:116644207-116644229 AGGGATACCTGGGGAATAATAGG - Intergenic
1197678888 X:129361133-129361155 TGGGATACCTTTGGAAGGATAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199476927 X:148256152-148256174 TTAGATGATTTGGGAAAAATCGG + Intergenic
1201200691 Y:11537392-11537414 TGGAATGCATTGGAATAAATTGG + Intergenic
1201202104 Y:11549748-11549770 TGGAATGCATTGGAATAAATTGG + Intergenic
1201203394 Y:11560964-11560986 TGGAATGCATTGGAATAAATTGG + Intergenic
1201204051 Y:11566571-11566593 TGGAATGCATTGGAATAAATTGG + Intergenic
1201204699 Y:11572168-11572190 TGGAATGCATTGGAATAAATTGG + Intergenic
1201205351 Y:11577780-11577802 TGGAATGCATTGGAATAAATTGG + Intergenic
1201206000 Y:11583386-11583408 TGGAATGCATTGGAATAAATTGG + Intergenic
1201206649 Y:11588993-11589015 TGGAATGCATTGGAATAAATTGG + Intergenic