ID: 1101319139

View in Genome Browser
Species Human (GRCh38)
Location 12:103657865-103657887
Sequence GAGTGCAGGAAATTCCCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101319135_1101319139 9 Left 1101319135 12:103657833-103657855 CCATCCATCTTAACGGCTTTATC 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1101319139 12:103657865-103657887 GAGTGCAGGAAATTCCCCATCGG 0: 1
1: 0
2: 0
3: 13
4: 91
1101319136_1101319139 5 Left 1101319136 12:103657837-103657859 CCATCTTAACGGCTTTATCTTCA 0: 1
1: 0
2: 5
3: 50
4: 3607
Right 1101319139 12:103657865-103657887 GAGTGCAGGAAATTCCCCATCGG 0: 1
1: 0
2: 0
3: 13
4: 91
1101319133_1101319139 19 Left 1101319133 12:103657823-103657845 CCTTCTGTCTCCATCCATCTTAA 0: 1
1: 1
2: 0
3: 27
4: 323
Right 1101319139 12:103657865-103657887 GAGTGCAGGAAATTCCCCATCGG 0: 1
1: 0
2: 0
3: 13
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101319139 Original CRISPR GAGTGCAGGAAATTCCCCAT CGG Intronic
904786232 1:32985073-32985095 GAACTGAGGAAATTCCCCATGGG - Intergenic
905127245 1:35724334-35724356 GAGTTCAGGAAACACCCCGTAGG + Intronic
908195645 1:61743231-61743253 GAGTCCAGGAATTTCCCCTAAGG - Intronic
915332908 1:155124762-155124784 GAGGGCAGGAATTTCCTCAGAGG - Intergenic
915661872 1:157411512-157411534 CAGTGCAGTGAATGCCCCATGGG + Intergenic
915667199 1:157455984-157456006 GTGGGCAGGAAATACCCCTTAGG + Intergenic
921380118 1:214516024-214516046 GAGTGCAGGAAATTATACCTAGG - Intronic
1062956785 10:1545698-1545720 GAGTGCAGCACAGTCACCATAGG - Intronic
1065277278 10:24097904-24097926 GAATGCAGGTACCTCCCCATTGG - Intronic
1067660319 10:48232584-48232606 GAGAGCTGGAATTTCCGCATGGG - Intronic
1070302361 10:75213017-75213039 GACTGTTGGAAATACCCCATTGG + Intronic
1076830902 10:132993624-132993646 GAGAGTCGGGAATTCCCCATTGG + Intergenic
1077156164 11:1092642-1092664 GGGTGACGGAAATTCCCCACAGG - Intergenic
1085270512 11:75267218-75267240 GACTGCAGGGAAATCCACATCGG + Intronic
1085932701 11:81104221-81104243 GAGCAGAGGAAATTCCCCACTGG + Intergenic
1085953506 11:81362637-81362659 GAGTGCCTGAAATTTCACATGGG - Intergenic
1087746104 11:101949011-101949033 GAGTTCAGGAAAGACCTCATGGG + Intronic
1090454815 11:126839522-126839544 GAGAGGAGGAAATGCCGCATTGG + Intronic
1090679319 11:129036662-129036684 GAGTGCAGGAATTTTTCCAAAGG - Intronic
1094831080 12:34300598-34300620 GCGTGCAGGACATGCACCATGGG - Intergenic
1095808061 12:46343066-46343088 CAGTGCAGCAAGTTCCCCCTGGG + Intergenic
1098921043 12:76302491-76302513 GAGTGCTGGGAATTGACCATAGG - Intergenic
1099588054 12:84546458-84546480 GAGGGCAGCAAATTTCCAATGGG + Intergenic
1101319139 12:103657865-103657887 GAGTGCAGGAAATTCCCCATCGG + Intronic
1106017235 13:25881308-25881330 ACATGCAGGAAATTCCTCATTGG + Intronic
1108485810 13:50923327-50923349 GAGTGCAGGAAACTCTAAATAGG + Intronic
1109885471 13:68537002-68537024 AAGTGGAGGCAATTCCCTATTGG - Intergenic
1113045998 13:106155600-106155622 AATTTCAGGAAATTCCCCAAGGG + Intergenic
1113763765 13:112868038-112868060 CAGTGCAGAAAATGCTCCATTGG - Intronic
1118719670 14:68585258-68585280 GAGTTCCTGAAATTCCCCATGGG - Intronic
1120428840 14:84387960-84387982 AAGATCAGGAAATTGCCCATGGG - Intergenic
1121627294 14:95395269-95395291 GAATGCTGGAAATTCCACAGTGG + Intergenic
1124209201 15:27748240-27748262 GGGAGCAGGATATTCCTCATAGG - Intergenic
1124900832 15:33820894-33820916 GAATGCAGGAAATGCTCAATAGG - Intronic
1126370275 15:47938591-47938613 GAGTGCTGGAAATTGACCATTGG + Intergenic
1128260415 15:66229020-66229042 GAGTGCAGGAAAATCAGCAAAGG - Intronic
1132976027 16:2711596-2711618 GAGTGCAAGAAATGGCCCACGGG + Intergenic
1133468168 16:6048003-6048025 GAGAGAAGGAAATGCCTCATGGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1140018948 16:71218118-71218140 TAGTGCATGAAATTCCTCAAGGG - Intronic
1140167572 16:72569605-72569627 GAGTGTAATAATTTCCCCATGGG - Intergenic
1141174202 16:81708471-81708493 GAGTGCAGGAAAGGCCCCTTGGG + Intronic
1149657870 17:58319714-58319736 GCGGGCAGGAAATTCCACAGGGG + Intronic
1157523957 18:48364446-48364468 GAGTACAGGAAATTCCAGATGGG + Intronic
1158393537 18:57062469-57062491 GAGTGCAGGAAATTCAAGACAGG - Intergenic
1165822723 19:38686721-38686743 GAGTGCAGGCTCTTCCCCTTGGG + Intronic
1166754397 19:45181331-45181353 GTGTGCAGGAAATGCCACCTTGG - Exonic
925045919 2:773079-773101 AAGTGAAGGAAATTCCACATAGG - Intergenic
925853177 2:8104102-8104124 GCTTGCTGGAAATTGCCCATTGG - Intergenic
926166237 2:10523383-10523405 AAGTGCAGGCAATGCCCCAGAGG + Intergenic
926213960 2:10892286-10892308 GTGTGCAGGACATGCCCCATGGG - Intergenic
932436081 2:71703252-71703274 GTGTGCAGGGAACTCTCCATGGG + Intergenic
933894382 2:86797365-86797387 TAGTGCAGGAAATTCAGAATGGG + Intronic
934606012 2:95695704-95695726 GACTGCAGCAACTACCCCATGGG - Intergenic
944985184 2:205168146-205168168 GAGTAAAGGAAATTCCCAAAGGG - Intronic
948533661 2:238630407-238630429 AAGTTCAGGAAATTCTGCATTGG - Intergenic
1171522691 20:25787622-25787644 GAGAGCAGAAAATTCCACTTCGG - Intronic
1171554136 20:26068261-26068283 GAGAGCAGAAAATTCCACTTCGG + Intergenic
1178003219 21:28187715-28187737 GTGAGCAGGAAATTTACCATAGG - Intergenic
1181085549 22:20437863-20437885 CCGGGCAGGAAATTCCACATCGG + Intronic
1182080335 22:27524338-27524360 GGGTGTAGGAAATTCCTCCTTGG - Intergenic
950032520 3:9862216-9862238 AAGTGCAGAAAACTCCCAATAGG - Intergenic
950150427 3:10682641-10682663 GAGTGCAAGAACTTCCCACTAGG + Intronic
959293985 3:104512330-104512352 GATTGGAGGAAATTCCCACTTGG - Intergenic
961156466 3:124683852-124683874 TTTTGGAGGAAATTCCCCATTGG + Intronic
962092099 3:132255076-132255098 GACTGCATGAAGTTACCCATGGG - Intronic
972115183 4:35622763-35622785 GAGTGCAGGAAATACGCCAGTGG + Intergenic
973719992 4:53713491-53713513 GAGTTAAGGCAATTCCCCAGGGG - Intronic
973847944 4:54932233-54932255 GAGTGCAGGAACTTCTCAAGTGG - Intergenic
974555388 4:63440236-63440258 GACTGTAGGAAATACTCCATGGG + Intergenic
975246494 4:72126839-72126861 GACTGCAGGAAATTAGGCATAGG - Intronic
977767770 4:100820680-100820702 GACTGCAGTAAATTCACCAGAGG - Intronic
978072920 4:104493368-104493390 GAGTTCAGGGAATTCTACATGGG + Intronic
981711134 4:147709920-147709942 GAAGGCAGGAAATTCCCCAGGGG + Intergenic
984557114 4:181227784-181227806 GTGGGCAGGATATTCCCCAGTGG + Intergenic
984847994 4:184123932-184123954 GAGAGCAGGAAAATCCCTAAGGG - Intronic
984937670 4:184903412-184903434 GAGTGCAGCAAAGTCCCCAGCGG - Intergenic
1000857871 5:166421929-166421951 GAGTGAAAGAAATGCCTCATGGG + Intergenic
1002079588 5:176729392-176729414 AAATGCCAGAAATTCCCCATAGG - Intergenic
1006673862 6:35747847-35747869 GAGTTCAGGAAATGCCTCAAAGG - Intronic
1007274245 6:40661762-40661784 GAGAGCAGGAAAGGCCCCACTGG - Intergenic
1007784820 6:44273523-44273545 GAGTGCAGGACATTCAACATGGG + Intronic
1008010007 6:46456458-46456480 GATTGTAGGAAATGCCCCTTAGG - Intronic
1009713096 6:67349253-67349275 GAGTACAGGAAATGCCATATTGG - Intergenic
1014358788 6:120447800-120447822 GAATTCAGGAAATTCCCAAAAGG - Intergenic
1017267936 6:152472951-152472973 AAGTGCAGGGAATACCCCATAGG + Intronic
1018051382 6:160011807-160011829 GAGAACAGGAAATTCCCTTTAGG - Intronic
1019825372 7:3279961-3279983 GAGTGCAGCAAATTCCCTCTAGG + Intergenic
1020387421 7:7622408-7622430 GAGTGAAGGAAATTGCTCAGTGG + Intergenic
1022108184 7:27211685-27211707 GTGTGGAGGAAATTCCCCAAAGG - Intergenic
1022635558 7:32131057-32131079 GAGTGCTGGAACTTTCCCACAGG + Intronic
1025283171 7:57642823-57642845 GAGAGCAGAAAATTCCACTTCGG - Intergenic
1035737215 8:1897734-1897756 GAGTACAGCAAAATCCCCAGAGG - Intronic
1036691722 8:10948707-10948729 GAGTGCGGGGCCTTCCCCATGGG - Intronic
1048996248 8:139795327-139795349 GTTTGCAGTTAATTCCCCATGGG + Intronic
1052012366 9:23425476-23425498 GAGTACAGGAAAATGCACATAGG - Intergenic
1052460201 9:28753143-28753165 GAGTGTAGGAAAATCCTCACAGG + Intergenic
1053481959 9:38422704-38422726 GAGCACAGGAAAGTCACCATTGG - Intronic
1054910350 9:70449564-70449586 GAGGACAGGAAATTCCCAGTGGG - Intergenic
1055256040 9:74372552-74372574 GTGTGCAGGTAATTCTCCAGGGG - Intergenic
1186404047 X:9286166-9286188 CAGAGCAGGAACTTGCCCATTGG - Intergenic
1190241875 X:48663087-48663109 AAGTGCAGGGATTTCCACATGGG - Intergenic
1192239681 X:69319315-69319337 GAGGGAATGGAATTCCCCATGGG + Intergenic
1198764155 X:140063832-140063854 GAGAGCAGCAGATTACCCATGGG - Intergenic
1200277688 X:154750518-154750540 GAATGCAGGCAATTCCCCTCTGG + Intronic