ID: 1101319838

View in Genome Browser
Species Human (GRCh38)
Location 12:103663857-103663879
Sequence GATCCTAAATCCCAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101319838_1101319847 17 Left 1101319838 12:103663857-103663879 CCCAACCCCTGGGATTTAGGATC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1101319847 12:103663897-103663919 TTCCCCTGTCCCTGTCATCTGGG 0: 1
1: 0
2: 2
3: 24
4: 283
1101319838_1101319846 16 Left 1101319838 12:103663857-103663879 CCCAACCCCTGGGATTTAGGATC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1101319846 12:103663896-103663918 CTTCCCCTGTCCCTGTCATCTGG 0: 1
1: 1
2: 2
3: 41
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101319838 Original CRISPR GATCCTAAATCCCAGGGGTT GGG (reversed) Intronic
900877557 1:5355511-5355533 AATCCTAAGTCCCAAGGTTTAGG + Intergenic
902793981 1:18788248-18788270 AACCCTAAATCCCAGGGTCTAGG + Intergenic
906333872 1:44911291-44911313 GATCCTGAATCACTGGGGTGTGG + Intronic
908401673 1:63777164-63777186 GTTCCTAAAGCCCTGGGCTTGGG - Intronic
911332051 1:96536307-96536329 GACTCTAAATCCCAGGGTTATGG + Intergenic
912159471 1:106964045-106964067 GAGTCTAAATCACAGGGATTGGG + Intergenic
915350137 1:155219225-155219247 ATTCCTAAATCCCAGAGGATGGG + Intergenic
915353541 1:155241456-155241478 GCTCCTAAATCCCAGAGGATGGG + Intronic
915854440 1:159366775-159366797 GATCCTCATTCCCATGGGCTTGG + Intergenic
918833692 1:189431925-189431947 AATCCTAATTCCGAGGTGTTAGG - Intergenic
919654391 1:200183259-200183281 GATTCTAAACCTCAGGAGTTCGG + Intergenic
1070983054 10:80665781-80665803 GATGCAAAACCCCAGGGATTAGG + Intergenic
1071815562 10:89229303-89229325 GATCCTGGTTGCCAGGGGTTAGG + Intronic
1076231437 10:128822929-128822951 GAACCTAAGTCCCAGTGGTGAGG - Intergenic
1077658248 11:4043168-4043190 GTTCTAAAATGCCAGGGGTTTGG + Intronic
1077942235 11:6855347-6855369 CCTGCTAAATCCCAGAGGTTTGG - Intergenic
1080399681 11:31922324-31922346 GGTGCTGACTCCCAGGGGTTGGG + Intronic
1081409885 11:42745505-42745527 TATCCTCAATACCAGGGCTTGGG + Intergenic
1081775260 11:45671874-45671896 GCTCCTGAATGCCAGGGGCTGGG - Intergenic
1085732181 11:79009533-79009555 GAACCTGAATCTCAGGTGTTGGG - Intronic
1088070996 11:105784957-105784979 GATTCCAAATACCAGGGTTTGGG + Intronic
1089788325 11:120923958-120923980 GGTCCTAAAGCCCAGGGGAGAGG - Intronic
1090095651 11:123740253-123740275 GATTATGAATCCCAGGCGTTTGG + Intronic
1092209637 12:6637983-6638005 GATCCATAAAACCAGGGGTTGGG + Intergenic
1095457251 12:42401429-42401451 GGTCCACAAGCCCAGGGGTTGGG - Intronic
1101319838 12:103663857-103663879 GATCCTAAATCCCAGGGGTTGGG - Intronic
1101795819 12:107972578-107972600 GATCATAAATCCCACAGGGTAGG + Intergenic
1103168291 12:118789953-118789975 GGCCCTAAAACCCAGGGGTAAGG - Intergenic
1103950800 12:124549996-124550018 GATCCTGTATCGCAGGGGTCTGG + Intronic
1104746660 12:131215151-131215173 GATCCCCATTCCCAGGGGTGCGG - Intergenic
1107782348 13:43917171-43917193 AAGACTAAATTCCAGGGGTTAGG + Intergenic
1109570984 13:64189554-64189576 GATCATAATTGTCAGGGGTTAGG + Intergenic
1109718854 13:66251744-66251766 ATTCCTAAATCCCAGGGATTAGG + Intergenic
1111350409 13:87021277-87021299 GATCCTACATGCTATGGGTTTGG + Intergenic
1111449061 13:88390641-88390663 GACCCTCAATGCCAGGAGTTCGG - Intergenic
1112349750 13:98622970-98622992 TCTCCTAAATGCCAGGGATTCGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1121713450 14:96056000-96056022 TTTCTTAAATCCCAGGGGGTGGG - Intronic
1124911290 15:33923700-33923722 GTTCCTAACCCCTAGGGGTTGGG - Intronic
1127797116 15:62448075-62448097 TCTCCTAAATCCAAGGCGTTGGG - Intronic
1128451972 15:67811087-67811109 GATACAGAATCCCAGGGCTTTGG + Intergenic
1129279249 15:74470948-74470970 GGTCCTCAACCCCAGGGGGTTGG - Intergenic
1130554884 15:84915641-84915663 GTTGCTAAGTCCCAGGGGTCTGG + Intronic
1131279908 15:91012711-91012733 CATCCTCAATCCCAGTGATTGGG - Intronic
1131433593 15:92405773-92405795 AATCCTAAATCCCAGATGTTGGG - Intronic
1134795285 16:17029813-17029835 GCTCCCAAATCTCAGTGGTTTGG + Intergenic
1136132062 16:28229170-28229192 AATCTAAAATCCCAGGAGTTTGG + Intergenic
1138370702 16:56524359-56524381 GATCCTAATTTCCAAGGGTGGGG + Intergenic
1141160325 16:81625339-81625361 GAGGCTAATTCCCAGGGGTGTGG + Intronic
1143674753 17:8423914-8423936 GATCCTAAATCCATAGGCTTAGG + Intronic
1149003392 17:51779612-51779634 GATCCTAAGCCACAGAGGTTTGG - Intronic
1160687808 19:444978-445000 GATCCTGGAGCCCAGGGGTGTGG - Intronic
1163202032 19:15776471-15776493 TATCCTAAAGCCCTGGGGATAGG + Intergenic
1163282670 19:16326663-16326685 GATCCTCACCCCCAGGGGGTCGG - Intronic
1164132257 19:22374889-22374911 GGGCCTAAATCCTAGGGTTTTGG - Intergenic
1164994161 19:32707473-32707495 AATTCCAAATCCCAGGGCTTGGG + Intronic
1166625958 19:44356406-44356428 GATCCTACATCGCAGGGACTGGG - Intronic
1166700325 19:44878405-44878427 GATCCGAAAGCTCAGGTGTTGGG + Intronic
925802036 2:7611018-7611040 GCTCCTTCATTCCAGGGGTTGGG - Intergenic
927408190 2:22796121-22796143 GTTCCAAAATCCCAGGGATGGGG - Intergenic
933979556 2:87539047-87539069 GGTTCTAGATACCAGGGGTTAGG - Intergenic
936314265 2:111411744-111411766 GGTTCTAGATACCAGGGGTTAGG + Intergenic
936404836 2:112193722-112193744 GATCCCATATCCTAGGAGTTTGG + Intergenic
938547486 2:132347742-132347764 GATCCTACATCGCAGGGACTGGG + Intergenic
940048410 2:149434986-149435008 AATCCAAGATACCAGGGGTTAGG - Intronic
940795271 2:158071001-158071023 GATCATCCATCCCAGTGGTTGGG + Intronic
941425349 2:165337971-165337993 AATTGTAAATCACAGGGGTTTGG + Intronic
941897335 2:170642636-170642658 GATTCAAAATCCCAGGGCCTAGG - Intronic
942535178 2:176955858-176955880 GATCATAAATCCCAGGCTTCTGG - Intergenic
943358481 2:186889514-186889536 GTCTCTAAATCCCAGGGGATGGG + Intergenic
948327587 2:237138234-237138256 CATCCTAAATCCTATGGATTAGG - Intergenic
1171876353 20:30580497-30580519 GATCCTACATCTCAGGGACTGGG + Intergenic
1175384138 20:58583463-58583485 GCTCCCAAATCCCCGGGCTTAGG - Intergenic
1176157629 20:63629876-63629898 GTTCACAGATCCCAGGGGTTAGG + Intergenic
1181393362 22:22600019-22600041 GATCCCAAATCCCAGCACTTTGG + Intergenic
1182436103 22:30331021-30331043 GATCCTCAAGCCCAGCTGTTGGG - Intergenic
1184225756 22:43128118-43128140 GATCCTAGATCCTGGGGGCTGGG + Intronic
950453112 3:13076594-13076616 GATCCTGAATCCCTGGGATTCGG - Intergenic
954630877 3:52047107-52047129 GAGCCCAAAACCCAGGGGTGGGG + Intergenic
955940823 3:64145948-64145970 GATCCTAAATCCCAAGGTGATGG - Intronic
956784421 3:72630555-72630577 CATCCTCAAAGCCAGGGGTTGGG + Intergenic
959474783 3:106796464-106796486 GTTCAGTAATCCCAGGGGTTTGG + Intergenic
960182806 3:114601993-114602015 GAGCCTAAAGACCAGAGGTTTGG - Intronic
960876179 3:122297443-122297465 CATTCTAAATCCCAGCAGTTTGG + Intergenic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
962757768 3:138479817-138479839 GATCCTTACCCCCAGGGGTAAGG - Intronic
964717051 3:159733497-159733519 GATGCTAAATTACAGGGCTTGGG + Intronic
967466614 3:189813650-189813672 GATCCTATGTCCCAAGGGTAGGG - Intronic
972194142 4:36632283-36632305 GCTGCTAAATCACAGAGGTTTGG - Intergenic
978566860 4:110091909-110091931 GATTCTAAATCCCAGGGCTCTGG + Intronic
981873294 4:149511977-149511999 CATCCTAAGTCCTAGGTGTTGGG + Intergenic
984241055 4:177219647-177219669 GTTACCAAATGCCAGGGGTTTGG + Intergenic
985670766 5:1205470-1205492 GAGCCTGAGCCCCAGGGGTTGGG + Intronic
986029222 5:3880039-3880061 GATCCTCAAGCCCAGGTGATGGG - Intergenic
990458527 5:56012342-56012364 GATGCTAAATCACAGCTGTTGGG + Intergenic
992709534 5:79436477-79436499 AAGACTAAATCCCAGAGGTTAGG - Intronic
992911392 5:81399032-81399054 AATCCGAAATTCCAGGGGTGGGG + Intergenic
993170612 5:84414288-84414310 AATTCTAAATGCCAGGGCTTGGG - Intergenic
996505530 5:124263980-124264002 GATCATAAATCCCTGGTGCTGGG - Intergenic
996595468 5:125197087-125197109 GAGCCCATATCCCAGGGATTTGG + Intergenic
997684106 5:135776716-135776738 GTTCCTAAAACCCGGGGGGTGGG + Intergenic
998065907 5:139158504-139158526 ACTGCTAAATCCGAGGGGTTTGG - Intronic
998507425 5:142683246-142683268 TATGCTAGCTCCCAGGGGTTAGG - Intronic
998552199 5:143088437-143088459 GATCATAAAACTCAGGGGTTTGG + Intronic
1003421639 6:5963565-5963587 GAGCCTGAGTCCCAGGGTTTTGG - Intergenic
1004310929 6:14544198-14544220 AAACCCAAAGCCCAGGGGTTTGG - Intergenic
1006551093 6:34823794-34823816 CATCCGTAATCCCAGGGCTTTGG - Intronic
1008418928 6:51274025-51274047 GATGCTAAATTCCAGGTGGTCGG - Intergenic
1008517769 6:52334414-52334436 GATCTGAAATCCCTGGAGTTGGG + Intergenic
1011291370 6:85780744-85780766 AATGTTAAATCCCAGAGGTTAGG + Intergenic
1011806233 6:91075499-91075521 TATGCTAGATCCCAGGGGATAGG - Intergenic
1012409921 6:98945754-98945776 CATCCTAAATCACAGGTGATGGG + Intronic
1016200641 6:141403260-141403282 GTACCAAAATGCCAGGGGTTTGG - Intergenic
1022488806 7:30800916-30800938 GAGACTAAATCGCTGGGGTTGGG - Intronic
1022535996 7:31098839-31098861 GATCCTGAATGCCAAGGGTGTGG + Intronic
1022799984 7:33767610-33767632 GAAAATAAATGCCAGGGGTTGGG - Intergenic
1023057674 7:36302864-36302886 GAACCGAAAACCCAGGTGTTAGG - Intergenic
1023969328 7:44979508-44979530 GATCCTAATGCCCAGGCCTTTGG + Intergenic
1026506133 7:70985679-70985701 GTTACTAAATGCCAGGAGTTTGG - Intergenic
1027343439 7:77233786-77233808 GTTCCTAAAGCCCAGGGGCTGGG + Intronic
1027804507 7:82799989-82800011 GAGTCTAAATTCCAGGAGTTTGG + Intronic
1031759066 7:125688250-125688272 CTTCCTAAATCCCAAGGATTTGG + Intergenic
1037378843 8:18262692-18262714 GATCCTATAGCCCAGTGATTAGG + Intergenic
1039200044 8:35081366-35081388 GATCCTAAATTCCAGTGGAAAGG + Intergenic
1039316598 8:36380240-36380262 GATCATTAATCCCCTGGGTTGGG + Intergenic
1041816820 8:61982421-61982443 GTTGCCAAATGCCAGGGGTTTGG - Intergenic
1042139037 8:65661041-65661063 GATCAGAGATGCCAGGGGTTGGG + Intronic
1043873117 8:85457193-85457215 GCACCTAAATCACAGTGGTTTGG - Intergenic
1044267518 8:90200834-90200856 GCTCCCAAATCTCAGGGGCTTGG + Intergenic
1046666973 8:117014962-117014984 GTTACCAAATGCCAGGGGTTCGG - Intronic
1048755884 8:137737768-137737790 GTTACCAAACCCCAGGGGTTTGG + Intergenic
1051482256 9:17573743-17573765 GATGCCAATTCCCAGGGGATTGG + Intergenic
1051956203 9:22697468-22697490 GAACCTAAGTCTCAGGGATTTGG - Intergenic
1054782434 9:69177323-69177345 GATCCTAAATCCAAGGGTTAGGG + Intronic
1059356411 9:113702643-113702665 AATCCCAAATCTCAGGTGTTGGG - Intergenic
1060031805 9:120220946-120220968 GATGCTAAATCCCAGGGAAAAGG + Intergenic
1060329427 9:122652804-122652826 TATCTTAAATCCCTGGGGATTGG + Intergenic
1060909385 9:127337202-127337224 AGTCCTAAATCCCAGGGGACAGG - Intronic
1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG + Intergenic
1194113643 X:89869713-89869735 GTTCCTTTATCCCAGAGGTTTGG + Intergenic
1200466323 Y:3524752-3524774 GTTCCTTTATCCCAGAGGTTTGG + Intergenic