ID: 1101320136

View in Genome Browser
Species Human (GRCh38)
Location 12:103666126-103666148
Sequence CTCCCACGGTGGAGTCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 102}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101320123_1101320136 11 Left 1101320123 12:103666092-103666114 CCAGCCCCCACCCCCAGCGCTGA 0: 1
1: 0
2: 12
3: 182
4: 1627
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320131_1101320136 -2 Left 1101320131 12:103666105-103666127 CCAGCGCTGACTTCACTCCTTCT 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320122_1101320136 14 Left 1101320122 12:103666089-103666111 CCACCAGCCCCCACCCCCAGCGC 0: 1
1: 4
2: 50
3: 606
4: 4179
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320126_1101320136 5 Left 1101320126 12:103666098-103666120 CCCACCCCCAGCGCTGACTTCAC 0: 1
1: 0
2: 0
3: 27
4: 234
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320128_1101320136 1 Left 1101320128 12:103666102-103666124 CCCCCAGCGCTGACTTCACTCCT 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320119_1101320136 26 Left 1101320119 12:103666077-103666099 CCTAAACTCCTCCCACCAGCCCC 0: 1
1: 13
2: 417
3: 1172
4: 2467
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320124_1101320136 7 Left 1101320124 12:103666096-103666118 CCCCCACCCCCAGCGCTGACTTC 0: 1
1: 0
2: 3
3: 88
4: 922
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320130_1101320136 -1 Left 1101320130 12:103666104-103666126 CCCAGCGCTGACTTCACTCCTTC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320121_1101320136 15 Left 1101320121 12:103666088-103666110 CCCACCAGCCCCCACCCCCAGCG 0: 1
1: 2
2: 33
3: 554
4: 3557
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320125_1101320136 6 Left 1101320125 12:103666097-103666119 CCCCACCCCCAGCGCTGACTTCA 0: 1
1: 0
2: 3
3: 43
4: 360
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320127_1101320136 4 Left 1101320127 12:103666099-103666121 CCACCCCCAGCGCTGACTTCACT 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320120_1101320136 18 Left 1101320120 12:103666085-103666107 CCTCCCACCAGCCCCCACCCCCA 0: 1
1: 58
2: 1869
3: 4436
4: 10897
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102
1101320129_1101320136 0 Left 1101320129 12:103666103-103666125 CCCCAGCGCTGACTTCACTCCTT 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101320136 Original CRISPR CTCCCACGGTGGAGTCGGTG TGG Intronic
900957152 1:5893040-5893062 CTCCCACGGTGGCAGGGGTGTGG + Intronic
902665237 1:17933037-17933059 CTCCCACGATGGTGTCGGCCTGG + Intergenic
908979310 1:69934931-69934953 CTCCCATGGTAGAGTTGTTGGGG - Intronic
912472579 1:109915743-109915765 CTCCCAGGGTGGGGTGTGTGGGG + Intronic
916677092 1:167073251-167073273 CACCCAGGCTGGAGTGGGTGGGG - Intronic
919168019 1:193919356-193919378 CTCCCACAGTGCAGTGGGGGGGG + Intergenic
919650935 1:200148212-200148234 CTGCCGCTGTGGAGTCGGGGCGG - Intronic
923252032 1:232186358-232186380 GTCCCAAGGTGGACTGGGTGGGG - Intergenic
1063089622 10:2850763-2850785 CTCACATGGTGGAAGCGGTGAGG + Intergenic
1063580033 10:7297922-7297944 CTCCCACTGTGGAGGTGGTGGGG - Intronic
1067427771 10:46222533-46222555 CTCCCACAGTGGAAGGGGTGAGG + Intergenic
1068431750 10:56941908-56941930 CTGCTACAGTGGAGTGGGTGTGG - Intergenic
1070318401 10:75335749-75335771 CTTCCATGGTGGTGTGGGTGGGG + Intergenic
1072790259 10:98312584-98312606 CTCCCACTGGGGAGTCCATGGGG + Intergenic
1073570110 10:104574050-104574072 GGCCCAAGGTGGAGTTGGTGGGG + Intergenic
1075269442 10:121035783-121035805 CTCCCACAGTGCAGTGGGGGGGG + Intergenic
1076449490 10:130546955-130546977 CTCCCACTGTGGTGATGGTGGGG - Intergenic
1076592255 10:131591656-131591678 CTCACACGGTGGAGACAGAGAGG - Intergenic
1076890098 10:133279162-133279184 CTCCCACGGAGGGGGAGGTGTGG + Exonic
1076922284 10:133460287-133460309 CTTCCACAGTGGATTGGGTGAGG + Intergenic
1077362843 11:2148321-2148343 CACCCAGGGTGGTGTCTGTGGGG - Intronic
1077530525 11:3092742-3092764 GTCCCCTGGAGGAGTCGGTGGGG - Intronic
1078961443 11:16277307-16277329 CTCACATGGTGGAGTGGGTGGGG - Intronic
1083282793 11:61637804-61637826 CTCCCACGGTTGTGACAGTGGGG + Intergenic
1083987152 11:66222939-66222961 CTCCCAGGGAGGAGTCTGTTTGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084473378 11:69375807-69375829 CCCCCAGGGAGGAGTGGGTGTGG + Intergenic
1084746825 11:71175852-71175874 CTCCCAGAGTGGAGGCGATGGGG + Intronic
1085317718 11:75555455-75555477 CTCCCATGGTGGCCTCTGTGGGG + Intergenic
1088799303 11:113290747-113290769 CTCACATGGTGGAATGGGTGAGG - Intergenic
1089731087 11:120519418-120519440 CTCACACGGTGGGAGCGGTGAGG - Intronic
1090912390 11:131132784-131132806 CTCACATGGTGGAAACGGTGAGG + Intergenic
1092779077 12:11968698-11968720 CTCCCATGGTGGTGGAGGTGGGG + Intergenic
1097905911 12:64919576-64919598 CTCACACGGTGGAAGGGGTGAGG + Intergenic
1098848888 12:75570937-75570959 CTCCCCAGGTGGGGTCAGTGGGG - Intergenic
1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG + Intronic
1102855722 12:116291667-116291689 CACCCAGGCTGGAGTCAGTGGGG + Intergenic
1104186990 12:126442350-126442372 CTCCCACGCTAGAGCAGGTGAGG - Intergenic
1104852571 12:131884286-131884308 TTCCCATGGCTGAGTCGGTGGGG - Intergenic
1111331514 13:86765068-86765090 CTCCCATGGTGGAATGAGTGAGG + Intergenic
1113200826 13:107866615-107866637 CCCTCACGGTGGAGTCGGCCAGG - Exonic
1113448919 13:110392016-110392038 CTCCCAGGGTGGATTTGGAGGGG + Intronic
1114714918 14:24814820-24814842 CTCACATGGTGGAAGCGGTGAGG - Intronic
1115706313 14:36002493-36002515 CTCCTAGGGTGGAGTCGAAGAGG - Intergenic
1118179619 14:63479279-63479301 CTCCCATGGTGCTGTGGGTGGGG + Intronic
1118410167 14:65470199-65470221 CTGCCACATTGGAGCCGGTGCGG + Intronic
1122060630 14:99134512-99134534 GTCCCACTGAGGAGCCGGTGAGG - Intergenic
1124791368 15:32730696-32730718 CTCCCACCGTGTAGGCTGTGCGG - Exonic
1132944958 16:2527631-2527653 CTCCCAGGGTGGGGGCGGGGAGG - Intronic
1134215367 16:12313053-12313075 CACCCAGGGTGGAGTGAGTGGGG + Intronic
1136410675 16:30075378-30075400 CGCTCAGGCTGGAGTCGGTGGGG - Intergenic
1140242383 16:73214916-73214938 TTCCCACAGAGGAGTTGGTGTGG - Intergenic
1143001503 17:3798001-3798023 GGCCCACGGTGGAGGTGGTGAGG - Intronic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1143872873 17:9970116-9970138 CTCCCTCCGTAGAGTCGGGGCGG + Intronic
1149356563 17:55845604-55845626 CTCCCACGGCGGGGTGGGGGAGG - Intergenic
1150129416 17:62659107-62659129 CTCACATGGTGGAATAGGTGAGG + Intronic
1152888292 17:82865378-82865400 CTCCCACGATGGGGTGGATGTGG - Intronic
1152921645 17:83068897-83068919 CTCCCAGGGTGGGATCCGTGGGG + Intergenic
1154147190 18:11875936-11875958 CTCACATGGTGGAGAGGGTGAGG + Intronic
1158669746 18:59464092-59464114 GTCCCATGGTGGAGACAGTGGGG - Intronic
1160550433 18:79691485-79691507 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550447 18:79691522-79691544 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550462 18:79691560-79691582 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550477 18:79691598-79691620 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550491 18:79691635-79691657 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550505 18:79691672-79691694 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550520 18:79691710-79691732 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550535 18:79691748-79691770 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550549 18:79691785-79691807 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550561 18:79691823-79691845 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550575 18:79691860-79691882 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550590 18:79691898-79691920 CTCCCAGGGTGGACTTGGGGTGG + Intronic
1160550605 18:79691936-79691958 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550620 18:79691974-79691996 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550635 18:79692012-79692034 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550649 18:79692049-79692071 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550663 18:79692086-79692108 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550675 18:79692124-79692146 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550688 18:79692161-79692183 CTCCCAGGGTGGACTCCGGGTGG + Intronic
1161743455 19:6040054-6040076 CTCCCGCGCTGGAGACGATGGGG + Exonic
1168687628 19:58358114-58358136 CGGCCAGGGTGGAGTGGGTGAGG - Intronic
933331956 2:80903805-80903827 CTCTCAAAGTGGATTCGGTGAGG - Intergenic
934712751 2:96526636-96526658 TTGCCAGGGTGGAGTGGGTGGGG - Intergenic
942188236 2:173445220-173445242 CTACCACGGTGAAATGGGTGTGG + Intergenic
945026009 2:205620678-205620700 CTCCCACTGTGGGGTGGCTGAGG - Intergenic
946998520 2:225425155-225425177 CTCCCACCGTTGAGTCCTTGAGG + Intronic
948854838 2:240725218-240725240 CTCCCACCCTGGTCTCGGTGCGG - Intronic
1169068046 20:2705568-2705590 CTCCCACAGTGGCGTGGGTCTGG + Exonic
1170134680 20:13059741-13059763 CTCCAAGGGTGGAGTTTGTGGGG - Intronic
1172335452 20:34112027-34112049 CTCCCACACTGGAGTGGGTTAGG + Intronic
1174357878 20:50010258-50010280 CTCCCAGGGCGGGGACGGTGAGG - Intergenic
1175466648 20:59194180-59194202 CTCACACGTTGGAGTGGGCGGGG - Exonic
1178599600 21:33984432-33984454 CCCCGCCTGTGGAGTCGGTGCGG + Intergenic
1180002167 21:45000127-45000149 CGCCCAGGGTGGAGTCCCTGTGG - Intergenic
1180156932 21:45982468-45982490 GTCCCTCGGTGGGGACGGTGGGG - Intronic
1182131928 22:27860589-27860611 CTCCCACTGTGGATGTGGTGAGG + Intronic
1184414379 22:44343704-44343726 CTCCCAGGGTGGAGTCAATAGGG + Intergenic
1185373568 22:50471746-50471768 CTCCCAGGGTGGAGGCTGGGAGG + Intronic
963040503 3:141066434-141066456 CACCCACGCTGTAGTTGGTGTGG + Exonic
969391796 4:6896269-6896291 CTCACACGGTGGACAGGGTGAGG - Intergenic
971287206 4:25302190-25302212 GTCCCACTGTGGGGGCGGTGGGG - Intergenic
974181241 4:58386802-58386824 CTCCCAGGGAGTAGTCGGTGGGG - Intergenic
984930399 4:184842088-184842110 CTCCCACAGTGGTGTCTCTGTGG + Intergenic
990461457 5:56035407-56035429 CTCCCACAGTGCAGTGGGGGGGG - Intergenic
994605670 5:101962888-101962910 CTCCCACAGTGCAGTGGGGGGGG + Intergenic
998073186 5:139215102-139215124 CTCTCAAGGAGGAGTCGGTGTGG - Intronic
1006477766 6:34268944-34268966 CTCCCACAGTGCAGTGGGGGCGG - Intergenic
1019547708 7:1586412-1586434 GTCCCCCGGGGGGGTCGGTGGGG - Intergenic
1023112394 7:36826897-36826919 TTCTCACGGTGAAGTTGGTGTGG - Intergenic
1026955301 7:74372903-74372925 CACCCAGGGTGGACACGGTGGGG - Intronic
1031692920 7:124812948-124812970 CTCCCACCTTGGAGCGGGTGGGG - Intergenic
1038030532 8:23634612-23634634 CACCCAGGCTGGAGTGGGTGAGG + Intergenic
1040825210 8:51612669-51612691 CTCCCATGGTGGAATTGGGGAGG - Intronic
1040952768 8:52953299-52953321 CTCCCACAGTGCAGTGGGGGGGG + Intergenic
1041297719 8:56376049-56376071 CACCCAGGCTGGAGTCAGTGAGG - Intergenic
1041333968 8:56758933-56758955 CTCACACGGTGAAGTGGGTGAGG - Intergenic
1051842612 9:21415238-21415260 CTCCCATGCTGGAGTCACTGAGG - Intronic
1056223974 9:84477407-84477429 CTCCCAAGGTAGAGTCGAAGAGG - Intergenic
1056500484 9:87203877-87203899 CTCCCAAGGTGGGGTCTGTGTGG - Intergenic
1057146026 9:92760123-92760145 CTCCCCCTGTGGAGTCAGTATGG + Intronic
1059248710 9:112869018-112869040 ATTCCATGGTGGAGTCTGTGAGG + Exonic
1185815990 X:3156453-3156475 CTCCCATGGTGGAAAGGGTGAGG - Intergenic
1186476190 X:9859535-9859557 GTCCCTTGGTGGAGACGGTGGGG + Intronic
1195973347 X:110498187-110498209 CTCCCATGGTGGAAGTGGTGAGG + Intergenic
1201265456 Y:12202146-12202168 CTCCCATGGTGGAAGAGGTGAGG + Intergenic