ID: 1101321174

View in Genome Browser
Species Human (GRCh38)
Location 12:103674243-103674265
Sequence AAAGAACCTCAGTCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101321170_1101321174 12 Left 1101321170 12:103674208-103674230 CCTGTTATCTCCAGCTGACAGTG 0: 1
1: 0
2: 1
3: 32
4: 199
Right 1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 212
1101321172_1101321174 2 Left 1101321172 12:103674218-103674240 CCAGCTGACAGTGTGGTGTTTGT 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101321174 Original CRISPR AAAGAACCTCAGTCTGAGCT GGG Intronic
901127995 1:6942862-6942884 TAAGGACTTCAGTCTGTGCTTGG + Intronic
903913813 1:26748589-26748611 AAAGAATCTGGGTCAGAGCTGGG - Intronic
904496221 1:30888333-30888355 AAGGATCCTCAGCCTGACCTTGG + Intronic
904893154 1:33794394-33794416 AAGGAAACTCAGGCTGAGTTTGG + Intronic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905638608 1:39573521-39573543 AAAGAACCAAAGGCTGGGCTGGG + Intronic
906313303 1:44769287-44769309 AATGAGACTCAGTCTCAGCTGGG + Intergenic
909009265 1:70315292-70315314 GAAGCACCTCAGTTTGAACTAGG - Intronic
909073950 1:71030274-71030296 AGAGAACCTCAGTGTGACCACGG - Intronic
909598949 1:77441037-77441059 AAAGAACCTCTGGCTGAGCACGG - Intronic
911731358 1:101295188-101295210 AGAGAATCTCAGCCTAAGCTTGG + Intergenic
912160737 1:106981903-106981925 AAAGAACCAGAGTCTCAGCAGGG + Intergenic
912310644 1:108617664-108617686 AAAGAACCAGAGACTGAGGTGGG + Intronic
914248632 1:145904092-145904114 AAAGAACCTCAGTCGGCGGGAGG - Exonic
914332166 1:146682534-146682556 AAAGCACATTAGTCTGAGATGGG + Intergenic
917271982 1:173286657-173286679 AAAGAATCTCTTTCTGAACTTGG + Intergenic
919882203 1:201908103-201908125 GAAGAACTTCAGTCTGAGAATGG - Intronic
920217070 1:204368500-204368522 ACAGAATCTCAGTGTGAGCAAGG + Intronic
921246407 1:213246765-213246787 AAAAAAACTGAGTCTGAGGTGGG + Intronic
922783533 1:228272037-228272059 ACATAACCTCCGTCTGGGCTTGG - Exonic
1063612980 10:7578752-7578774 AAAGCACCTCACGCTGAACTGGG + Intronic
1064104708 10:12491201-12491223 ACAGAACCTCAGGCTTTGCTAGG + Intronic
1064329471 10:14380125-14380147 AATTAACATCAGGCTGAGCTGGG - Intronic
1065006025 10:21380987-21381009 GAAGAACTGCAGTCTGAACTTGG + Intergenic
1065346967 10:24757748-24757770 AAAGATCTTTAGTCTCAGCTGGG - Intergenic
1065549439 10:26855989-26856011 AAAGAACCCCATTCTGGGCTGGG + Intronic
1065725755 10:28666411-28666433 TAAGAACCTGAGTGTCAGCTCGG - Intergenic
1066154768 10:32662822-32662844 AATGAACCTAGGTCTGAGTTTGG + Intronic
1071409170 10:85370543-85370565 AAACTACCTCAGGCTGATCTGGG - Intergenic
1073992899 10:109283938-109283960 GAAGAACCTCACTGTGAGCCGGG - Intergenic
1074700193 10:116085830-116085852 AAAGAAACCCAGTCTGAAGTCGG + Intronic
1076679716 10:132165452-132165474 AAAAAGTCTCACTCTGAGCTGGG - Intronic
1078012919 11:7587501-7587523 ACAGAAACTCAGTTTGAACTAGG + Intronic
1079391045 11:20022380-20022402 AAAGAATCTCAGTCTAGGCATGG - Intronic
1080385535 11:31808891-31808913 ACAGAGCCTCGGGCTGAGCTGGG - Intronic
1082708509 11:56522963-56522985 AAGGAACCTAAGTCTAAGATAGG + Intergenic
1082868185 11:57918860-57918882 AAAAAACCTCAGCCTGTTCTAGG + Intergenic
1083663030 11:64260610-64260632 AGAAAAAATCAGTCTGAGCTGGG + Intronic
1086793206 11:91067134-91067156 AAAAAACCTCTATCTGAGCCTGG + Intergenic
1088061859 11:105662819-105662841 AGAAAACCTCAGTCTCAGCCTGG - Intronic
1090622266 11:128571136-128571158 AAAGAACTTCAGGCTGGGCGCGG + Intronic
1090642102 11:128738629-128738651 AAAGAAACTGCGCCTGAGCTAGG - Intronic
1092451349 12:8605315-8605337 GAAGATCCTCAGACTGAGGTTGG + Exonic
1094445637 12:30526890-30526912 AAAGAAACTCAGGCTTAGCTAGG - Intergenic
1096468643 12:51863153-51863175 AAAGAGCCTCACGCTGAGTTTGG - Intergenic
1100218084 12:92474246-92474268 AAAGAACCTCAGAGTGAAGTGGG - Intergenic
1100548311 12:95623908-95623930 AAAGAACCTAGGCCTGGGCTTGG - Intergenic
1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG + Intronic
1101592594 12:106138013-106138035 AAAGAACCACATTCCCAGCTAGG - Intronic
1102732118 12:115120840-115120862 GAAGAAAGTCAGTCTGGGCTGGG - Intergenic
1103692446 12:122786436-122786458 AAAAAACCTCTGGCTGAGCGCGG - Intronic
1104752831 12:131250924-131250946 AAAGAACCCAAAGCTGAGCTGGG + Intergenic
1105563583 13:21519735-21519757 AAAGATCCTGACTCTGAGCTTGG - Intronic
1106617968 13:31347835-31347857 ATAGCACCTCAATCTGATCTAGG - Intergenic
1107009923 13:35660061-35660083 AAAGAACACCAGTCAGAGATGGG - Intronic
1111145190 13:84169857-84169879 AAAGAATGTCAGTCAGAGTTTGG - Intergenic
1112580275 13:100672438-100672460 AAAGAAGCCCTGTCTGAGCAAGG + Intronic
1114475964 14:22995065-22995087 AAAGAACATCCTGCTGAGCTGGG - Intronic
1117408402 14:55427540-55427562 AAAGAACTTCAGTTCCAGCTTGG + Intronic
1119874287 14:78044098-78044120 ATAGAAACTGAGTCTGAGCTAGG + Intergenic
1121580084 14:95023597-95023619 AAAAAACCTCAGTATCAGCTGGG - Intergenic
1122943446 14:104993897-104993919 CAAGGACCTGAGACTGAGCTGGG + Intronic
1124013102 15:25854677-25854699 AGACAACTTCAGTCTGAGCCTGG - Intronic
1124823691 15:33072625-33072647 AAAGAACATCAGTCTAGGCTGGG + Intronic
1125841046 15:42801441-42801463 TGAGACCCTCAGTCTCAGCTTGG + Intronic
1126323348 15:47448306-47448328 AAATAATCTCAGTATGACCTGGG + Intronic
1127537200 15:59901009-59901031 AAAAGAGCTCAGTCTGGGCTGGG - Intergenic
1127880683 15:63155681-63155703 AAAGAACCACTGTCTGAGCATGG + Exonic
1129653084 15:77505294-77505316 AAAGGGCCTCAGCCTCAGCTTGG + Intergenic
1131081588 15:89541135-89541157 AAACAAACTGAGTCTCAGCTGGG + Intergenic
1132338404 15:101063335-101063357 AAAGCACCCCACTCTGTGCTGGG + Intronic
1133628169 16:7591760-7591782 AAACAAGCACATTCTGAGCTTGG - Intronic
1136000904 16:27291896-27291918 AGAGAAAGCCAGTCTGAGCTTGG + Intergenic
1136064749 16:27751123-27751145 CTAGAACCTGAGTCTGAGATGGG + Intronic
1136625130 16:31457751-31457773 AAGGAACCCCAGTCTGGGCTGGG - Intergenic
1138200962 16:55088059-55088081 AAAGAGCCTCAGCCTGAGGCAGG - Intergenic
1138721626 16:59088980-59089002 AAAGAACCACTCTCTGAGCATGG - Intergenic
1139821543 16:69725367-69725389 AAATAATCTCACTCTGAGATTGG - Intronic
1139918669 16:70444754-70444776 AAAGAACCACTGTCTGAGCATGG + Intergenic
1140001385 16:71028384-71028406 AAAGCACATTAGTCTGAGATGGG - Intronic
1140556943 16:75932264-75932286 ACAGAACCTAAGTATGAGGTTGG + Intergenic
1140570248 16:76096239-76096261 AAATAACCTTATTCTGAGATAGG + Intergenic
1140932481 16:79640546-79640568 AAAGAACTGGAGGCTGAGCTGGG + Intergenic
1142189866 16:88712822-88712844 AAAGAGCCTCAGTCTGGGCAGGG - Exonic
1144027065 17:11286682-11286704 AAAGAACCTTCCTCTGAACTGGG - Intronic
1145356541 17:22160708-22160730 AAAAAAACAAAGTCTGAGCTGGG - Intergenic
1145901515 17:28493424-28493446 CCAGAACCTCAGGCGGAGCTGGG + Intronic
1146175929 17:30666770-30666792 AAAGAACCTGAGGCTGAGGTGGG - Intergenic
1146349383 17:32082878-32082900 AAAGAACCTGAGGCTGAGGTGGG - Intergenic
1147866290 17:43554939-43554961 AAAGAAACTGAGTCTCAGATTGG + Intronic
1149754663 17:59176985-59177007 AAAGAAACTCAGGCTGGGCGCGG - Intronic
1153973324 18:10246037-10246059 AAGAAACCGCAGTCTGACCTAGG - Intergenic
1156507090 18:37604184-37604206 AAAGAAACACAGACTGAGCCTGG - Intergenic
1156889054 18:42168866-42168888 AAAGAAACTCAGCCTAAACTTGG - Intergenic
1156913852 18:42442396-42442418 AGAGAACCTCACTCTCAGGTTGG - Intergenic
1157095649 18:44683307-44683329 AAAGTAGCTCACTCTGAGCAAGG - Intronic
1157686556 18:49647278-49647300 ATAAAACATCAGTCAGAGCTGGG + Intergenic
1158089440 18:53693728-53693750 AAATAACCACAGACTGAACTTGG - Intergenic
1158723957 18:59951277-59951299 AACAAACATCAGTCTGAGCCTGG - Intergenic
1159449704 18:68584514-68584536 AAAGAACTCCAGACTGACCTCGG + Intergenic
1161009651 19:1954145-1954167 AACCAACCTCAGGCTGACCTAGG - Intronic
1162982898 19:14250142-14250164 AAAGAACCTGAGGCTGAGGTGGG + Intergenic
1163697102 19:18769511-18769533 AAAGAACAGCCGCCTGAGCTGGG + Intronic
1168678536 19:58296678-58296700 TAAGAACCTCTGGCTCAGCTGGG - Exonic
926107129 2:10159505-10159527 AAAGACCCTGTGTCTGATCTGGG - Intronic
930050104 2:47208685-47208707 TAAGAATCTCAGCCTGAGTTTGG + Intergenic
930561941 2:52970480-52970502 GTAGAACATCAGTCTGACCTCGG + Intergenic
930623750 2:53672206-53672228 ATAAAACCTAAGTCTAAGCTGGG + Intronic
934095129 2:88594901-88594923 AAAGAACCTGAGGCTGGGCATGG + Intronic
936020496 2:108990815-108990837 ACAGACCCTCAGTCTGAACTCGG - Intergenic
938365608 2:130730882-130730904 AAAAGACCTCAGTCTGTGGTTGG + Intergenic
942303041 2:174580710-174580732 AAAGTACCTCAGACTTAGGTGGG + Intronic
942647779 2:178132881-178132903 AAAGAACCACAGTTTTGGCTGGG - Intronic
944981954 2:205131366-205131388 AAAGAAACTCTGTCTTAGCAAGG - Intronic
948087092 2:235260023-235260045 AAAGCAGCTCAGTCTGAGGCAGG + Intergenic
948689471 2:239692690-239692712 GAAGAACTTGATTCTGAGCTGGG + Intergenic
949013009 2:241692590-241692612 AAAGAATCTCAGGCTGGGCGTGG - Intergenic
1169281859 20:4274803-4274825 AAAGAAATTCAGTCTGAACTTGG + Intergenic
1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG + Intronic
1174264595 20:49322238-49322260 AAATAATTTCAGTCTGAGCAAGG + Intergenic
1174312435 20:49668489-49668511 ACATAACCTCAGTATAAGCTTGG + Intronic
1175121646 20:56720523-56720545 AAAGAATCTCAGACTAAGCAAGG - Intergenic
1175180221 20:57141214-57141236 AAACAACCTAAGTTAGAGCTGGG - Intergenic
1176961731 21:15166418-15166440 CAAGAACCTCAAACTGAGATAGG + Intergenic
1178146124 21:29742256-29742278 AAAGACACTCAGTTTGAGTTTGG - Intronic
1178661126 21:34508631-34508653 AAAAAACCCCAGTCTGGGCGCGG - Intergenic
1179548518 21:42127728-42127750 AAAGATCCTCAGCTTGAACTGGG - Exonic
1181317343 22:21979194-21979216 ACAGAACCTGACTCTGAGTTGGG + Intronic
1182049370 22:27301177-27301199 AAAGCACCTAACTCTGTGCTAGG - Intergenic
1182059899 22:27389290-27389312 AGAGCACCGCAGCCTGAGCTGGG - Intergenic
1182255231 22:29033052-29033074 AAAGAAGCTCAGTCTAGGCCGGG + Intronic
1182619432 22:31610786-31610808 GAAGACCCTCAGTCTGAGGGGGG - Intronic
1182973712 22:34602508-34602530 AAAGAATTTCAGTCTCATCTAGG + Intergenic
949813888 3:8038294-8038316 ACAGAATCCCAGCCTGAGCTGGG + Intergenic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
952265878 3:31785839-31785861 AGAGAACCTTACTCTGAGCATGG + Intronic
956797690 3:72731388-72731410 AAAAATCCTCAGTTTGGGCTGGG + Intergenic
956798427 3:72736493-72736515 AAAAATCCTCAGTTTGGGCTGGG + Intergenic
958962148 3:100521054-100521076 AAAGAACCCCTTTCGGAGCTAGG + Intronic
959821300 3:110738241-110738263 AAAGAACCTATGTCTGAGAGAGG - Intergenic
959882885 3:111466325-111466347 AAAGAAGCTCTTTCTGAGTTGGG - Intronic
960947724 3:122978319-122978341 AAAGAACCACTCACTGAGCTGGG + Intronic
962537552 3:136343856-136343878 CAAGAACCTGAGTCTGAACATGG - Exonic
965248122 3:166302674-166302696 AAAGAATCCCAGTTTGAGATGGG + Intergenic
967091314 3:186137197-186137219 AAAGAATGTCTGTCTGGGCTGGG - Intronic
969869626 4:10096516-10096538 ACGGAACCGCAGGCTGAGCTGGG - Intronic
970061340 4:12037874-12037896 AAAAAACCACAGTCTGGGCTGGG - Intergenic
974492626 4:62586930-62586952 AAAGAAAGCCAGTCTGAGCAAGG - Intergenic
975011690 4:69362877-69362899 AATTAAAATCAGTCTGAGCTTGG + Intronic
976679805 4:87744441-87744463 AAATAACCCCAGTATGAGTTAGG + Intergenic
979710186 4:123770301-123770323 TAAGAACCTCAGTCAAGGCTGGG - Intergenic
980677327 4:136103729-136103751 AGAGAAACTCACTCTGAGCTAGG + Intergenic
982808066 4:159790932-159790954 AAATAGCCTGAGTCAGAGCTGGG - Intergenic
983893317 4:173054488-173054510 TAAAAACATCAGTGTGAGCTGGG - Intergenic
984769194 4:183422803-183422825 AAAGACCCTCACGCTGAGATGGG - Intergenic
990310699 5:54535333-54535355 AAAGTACCTTTCTCTGAGCTTGG + Intronic
990512564 5:56501924-56501946 TAAGAACCACAGTCTGATATTGG - Intergenic
992098967 5:73388176-73388198 AAAGAAGCTCACCCTGAGCTTGG + Intergenic
992318600 5:75586559-75586581 ATAGAACCTCAGTCAGAATTTGG - Intronic
996026422 5:118651161-118651183 AAAGAACTGCAGGCTGACCTCGG + Intergenic
996559714 5:124815602-124815624 AAAGTACCTCAGCCTTAGTTTGG - Intergenic
997726591 5:136125917-136125939 AAAGAAGGTCAGTGTGAGCAAGG + Intergenic
997822988 5:137082704-137082726 AAAGCCCCAGAGTCTGAGCTGGG + Intronic
998183379 5:139961125-139961147 AAACAGCCTGAGTCAGAGCTGGG - Intronic
998215519 5:140235799-140235821 AAAGGACCACGGTGTGAGCTGGG - Intronic
998888534 5:146721074-146721096 AAAGAACCACAGCCTCACCTGGG + Intronic
999033046 5:148315741-148315763 AAAGAAACTCAGTCAGAGCCTGG - Exonic
1000254232 5:159522629-159522651 AAATATCTTCAGTCTGAGGTTGG + Intergenic
1000446152 5:161323566-161323588 GCAGAGCCTCAGTTTGAGCTGGG + Intronic
1001326467 5:170731410-170731432 AAAGAAACTCAGGCTGGGCATGG + Intronic
1002674374 5:180898795-180898817 AAAGGACCTCAGACTGTGCCAGG + Intergenic
1003890274 6:10557785-10557807 AAAGAACATCATTCTGGGCTAGG - Intronic
1005668851 6:28084360-28084382 AAAGAACCTCAGGCCGGGCACGG + Intronic
1005743125 6:28811311-28811333 AAATAACCTCCTTCTAAGCTAGG - Intergenic
1007704487 6:43782637-43782659 AGGGAACCTCAGTCTGAGTGGGG - Intronic
1007704508 6:43782714-43782736 AGGGAGCCTCAGTCTGAGCGGGG - Intronic
1007791994 6:44314916-44314938 AAAGATCATCAATCTCAGCTGGG - Intronic
1008876573 6:56336126-56336148 AAAGTACATCAGCCTCAGCTGGG + Intronic
1011102805 6:83743411-83743433 AAAGAACAAGAGTCTGAGCCTGG - Intergenic
1012185436 6:96209337-96209359 AAAGAACCTAATCCAGAGCTTGG + Exonic
1012227334 6:96719122-96719144 AAAGAACCTCTTTCTGAGTATGG - Intergenic
1012289965 6:97441669-97441691 AAAGAAAATCATTCTGAGATAGG + Intergenic
1012724875 6:102798604-102798626 AAACAAATTCAGTCTGAGATAGG - Intergenic
1013205743 6:107944400-107944422 AAAGAAGTTCAGACTGGGCTAGG + Intronic
1014090571 6:117399537-117399559 AGAGAGCCTCAGGCTGAACTAGG - Intronic
1014093998 6:117439919-117439941 AGAGAACCTCAGTGAGAGATGGG + Intronic
1014440393 6:121467187-121467209 AAAGAACCTGAGGCTGGGCGTGG - Intergenic
1016031622 6:139344134-139344156 AAATAACCCCAGTAGGAGCTGGG - Intergenic
1017650714 6:156578990-156579012 ATTGAACCTCAGTCTTAGATGGG - Intergenic
1017781003 6:157715249-157715271 AAAGAATGTCAGTTTGGGCTGGG + Intronic
1018531880 6:164773806-164773828 AGAGAACATCAGGCTGACCTTGG - Intergenic
1019071107 6:169345923-169345945 AAGGAACCTGAGACTGGGCTTGG + Intergenic
1021232453 7:18102661-18102683 AAAGCACCTAAGTTTTAGCTGGG + Intronic
1021552625 7:21887848-21887870 AAAGAACCTCAGGCTTAGAGAGG + Intronic
1021799327 7:24288104-24288126 AAAGAACCTAAATCTGAAATAGG - Intronic
1024244436 7:47458555-47458577 AAATAAAATCAGTCTGCGCTGGG + Intronic
1024858262 7:53807127-53807149 AAAAAAACTCAGTCCTAGCTGGG + Intergenic
1026459264 7:70599202-70599224 AAAGAAACTCAGGTTGATCTTGG + Intronic
1027033616 7:74909342-74909364 AAAGAAACTCAGGCTGTGCATGG - Intergenic
1027038754 7:74945728-74945750 AAAGAAACTGAGTCCCAGCTGGG + Intergenic
1027642749 7:80757432-80757454 AAAGAAAGTCAGTCTGAGGCAGG - Intronic
1028016356 7:85719110-85719132 AAAGAATCTTGGTCTGAGTTTGG + Intergenic
1029397337 7:100317313-100317335 AAAGAAACTCAGGCTGGGCATGG + Intronic
1030671277 7:112339727-112339749 TTAGAAACTCAGTCTGAGTTCGG - Intronic
1030800266 7:113841409-113841431 AAATAACATCAGTCTGAACTTGG - Intergenic
1031163597 7:118199210-118199232 AATGAACCTCAGTATGATCTTGG + Intergenic
1031280545 7:119795221-119795243 AAAGAACCACAGTCTCTGCCTGG - Intergenic
1031660713 7:124420854-124420876 AAAAACCCTCAGAGTGAGCTGGG - Intergenic
1032953448 7:136943018-136943040 ACAGAGCCCCAGTGTGAGCTGGG - Intronic
1034675234 7:152888093-152888115 AAAGAACCCCAGGCTGCTCTGGG - Intergenic
1034747134 7:153532679-153532701 AATGAACCTGAGATTGAGCTGGG + Intergenic
1035571947 8:678504-678526 AAAGAACTTCAGGCTTAGATAGG + Intronic
1035812924 8:2507481-2507503 AGAGAAGCTGAGTGTGAGCTGGG - Intergenic
1036527649 8:9550097-9550119 AAGGCACCTCAGCCTGAGGTAGG - Intergenic
1038414551 8:27384843-27384865 AAACAACCTCAGACAGCGCTTGG - Intronic
1039110923 8:34040143-34040165 AAAGAATCTCAGTCTAATGTGGG + Intergenic
1039404361 8:37299872-37299894 AAAGAACCACAGCTTGACCTTGG + Intergenic
1039720481 8:40159111-40159133 AAACAACCCCAGACTGAGCCTGG + Intergenic
1039891412 8:41688159-41688181 AGAGCACCTCGGTCTCAGCTGGG - Exonic
1041693115 8:60709022-60709044 AAAGAGCCTCAGTCAGAGAGAGG - Intronic
1042561486 8:70075130-70075152 AACGAGCCTCAGTCTAGGCTGGG + Intergenic
1042700240 8:71604564-71604586 AAAGAAACTGAGAGTGAGCTAGG - Intergenic
1044468957 8:92542644-92542666 ATAAACCCACAGTCTGAGCTAGG + Intergenic
1044710402 8:95051828-95051850 AGAGAAAGTCAGTCTAAGCTAGG + Intronic
1046045678 8:108961505-108961527 AAAGAACATCAGTCAGCACTGGG + Intergenic
1047338060 8:123955019-123955041 ACAGAACCCCTTTCTGAGCTGGG - Intronic
1051623187 9:19073394-19073416 ATAGAACCTTGATCTGAGCTGGG - Intronic
1059449142 9:114359362-114359384 AAAGAACATTATTCTCAGCTGGG - Intronic
1059586744 9:115615471-115615493 AAGGACACTCAGTCTGAGCTGGG + Intergenic
1060986786 9:127824711-127824733 GAAGCACCTCTGTGTGAGCTTGG - Intronic
1061687354 9:132292389-132292411 AATGTACCCCAGCCTGAGCTGGG + Intronic
1061702384 9:132425485-132425507 AATTAACCTCAATCTCAGCTCGG - Intronic
1062114432 9:134800447-134800469 AAAGAAGCTAAGTCTGGGCTGGG + Intronic
1062622103 9:137427780-137427802 CAGGAAGCTGAGTCTGAGCTGGG + Intronic
1189681229 X:43518804-43518826 AATGTCCCTCAGTCTGAGCCTGG + Intergenic
1193170661 X:78332067-78332089 AAAGACCTTCAGTGAGAGCTAGG + Intergenic
1195483529 X:105375214-105375236 AAAGAACAACAATCTGAGCTGGG + Intronic
1196760781 X:119198689-119198711 AAAGAATGTCATTCTGACCTTGG - Intergenic
1197503996 X:127278986-127279008 AAAGAACTTCAGGCTGGGCATGG + Intergenic