ID: 1101322923

View in Genome Browser
Species Human (GRCh38)
Location 12:103689132-103689154
Sequence CTGCAGGAACAGTTTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101322923_1101322930 22 Left 1101322923 12:103689132-103689154 CCATGCTGAAACTGTTCCTGCAG 0: 1
1: 0
2: 1
3: 35
4: 242
Right 1101322930 12:103689177-103689199 AAGACGTCCAAGAATACTCAAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1101322923_1101322934 30 Left 1101322923 12:103689132-103689154 CCATGCTGAAACTGTTCCTGCAG 0: 1
1: 0
2: 1
3: 35
4: 242
Right 1101322934 12:103689185-103689207 CAAGAATACTCAAGGTGGCTGGG 0: 1
1: 0
2: 3
3: 16
4: 204
1101322923_1101322933 29 Left 1101322923 12:103689132-103689154 CCATGCTGAAACTGTTCCTGCAG 0: 1
1: 0
2: 1
3: 35
4: 242
Right 1101322933 12:103689184-103689206 CCAAGAATACTCAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 20
4: 159
1101322923_1101322931 25 Left 1101322923 12:103689132-103689154 CCATGCTGAAACTGTTCCTGCAG 0: 1
1: 0
2: 1
3: 35
4: 242
Right 1101322931 12:103689180-103689202 ACGTCCAAGAATACTCAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101322923 Original CRISPR CTGCAGGAACAGTTTCAGCA TGG (reversed) Intronic
901168565 1:7237167-7237189 CTCCAGGAACAGTATCTGGATGG - Intronic
901405058 1:9039872-9039894 CATCCGGAACAGCTTCAGCACGG + Exonic
901668156 1:10838190-10838212 CTGCAGGAACGGTTGCAGGGAGG + Intergenic
903228957 1:21910270-21910292 GGGCAGGAACAATTTCAGGAAGG - Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
906241588 1:44245456-44245478 CTGCATGAACACTTTCCCCAGGG + Intronic
906314592 1:44778096-44778118 CTGGAGGAGCAGTTCCAGCAGGG + Exonic
906976205 1:50576053-50576075 TTCTAGGAACAGTTTCAGAAAGG - Intronic
906997431 1:50811828-50811850 CTGCAGTAACCATTACAGCATGG + Intronic
908814865 1:68021284-68021306 CTGCAGGAGCATTTACACCATGG - Intergenic
909725012 1:78824340-78824362 GTGCAGGAAATGTTTCAACAAGG - Intergenic
910568627 1:88675529-88675551 CTGTAGGAAGAGTTGTAGCAAGG + Intergenic
911360759 1:96873377-96873399 CAGCAGGGACACTTTCAGCAGGG + Intergenic
913691405 1:121282991-121283013 CTACAGGAATAGTCTCAACAAGG + Intronic
913702562 1:121386651-121386673 CAGCAGCAAAAGTTTCAACAGGG - Intronic
914043125 1:144067146-144067168 CAGCAGCAAAAGTTTCAACAGGG - Intergenic
914134961 1:144893342-144893364 CAGCAGCAAAAGTTTCAACAGGG + Intronic
914146141 1:144996991-144997013 CTACAGGAATAGTCTCAACAAGG - Intronic
915545188 1:156592981-156593003 CTGCAGGAAGGGTTTCAGATAGG - Intronic
915846268 1:159268774-159268796 CTGCTGCTACAGTTTCAGAAAGG + Intergenic
916784413 1:168074698-168074720 GTCCAGGAAAAGTTTCACCAAGG + Intronic
917022222 1:170601790-170601812 CTGCAGGAGCAGGTTCCTCATGG - Intergenic
917421928 1:174872991-174873013 CAGGAGGAACAGTTTCTCCAGGG + Intronic
917432856 1:174988664-174988686 CTGCAGTGACATTTTCAGCAAGG + Intronic
918592479 1:186255528-186255550 CTGCATGAACACTTGCAGTAAGG + Intergenic
919657306 1:200209928-200209950 CTGCAGTAAAACTTTCTGCATGG - Intergenic
920114326 1:203609340-203609362 CTGCAGGAAGAGTTACAAAAAGG - Intergenic
920478730 1:206301468-206301490 CTACAGGAATAGTCTCAACAAGG + Intronic
920489991 1:206405394-206405416 CAGCAGCAAAAGTTTCAACAGGG - Intronic
921299407 1:213736269-213736291 CTGCAGGTAAGGTTTCAGCCAGG + Intergenic
921575464 1:216830075-216830097 CCGCATTAAAAGTTTCAGCAGGG - Intronic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
923839775 1:237656658-237656680 CAGCAAGATCAGTTTTAGCAAGG + Intronic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1066020858 10:31299782-31299804 CTGCAGTAATAGTCTCAGTAGGG - Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067683663 10:48455086-48455108 CCGCAGGTACAGCTTCAGCAGGG + Exonic
1075117475 10:119638939-119638961 CTGGGGGAGCAGTTCCAGCAGGG + Intergenic
1075543258 10:123333886-123333908 CAGCAAGAACAGTTCCTGCATGG - Intergenic
1076369760 10:129944652-129944674 CAGCAGGCTCAGTTGCAGCAAGG - Intronic
1076773833 10:132682087-132682109 GGACAGGAACAGTTTCAGCTGGG + Intronic
1078016062 11:7616063-7616085 CTGCATGACCAGTGTCAGGAAGG + Intronic
1079294592 11:19221669-19221691 CCTCAGCAACAGTTGCAGCAGGG + Intergenic
1081192061 11:40116115-40116137 CTGCAGCAACCAGTTCAGCAAGG - Exonic
1081912649 11:46709927-46709949 CTGATGGAAAAGTTTCAACAAGG + Intergenic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1083245443 11:61423681-61423703 CTGAAGAAACAGTTTCTCCAAGG + Intronic
1083706014 11:64516343-64516365 CTGCAGGAACTGCTGCAGCCAGG + Intergenic
1084597771 11:70127348-70127370 CTGCAGGAACTGTTCCATAAGGG + Intronic
1085042807 11:73336539-73336561 CAGCAGGGACAGTTTCTGGAAGG + Intronic
1085145008 11:74187598-74187620 CCACAGGAACAATTTCAGTAGGG - Intronic
1086332812 11:85770754-85770776 CTGCAGGAGCAGTTTCATGGAGG - Intronic
1087059995 11:93967898-93967920 GTGCAGGACCATTTTCAGCTTGG - Intergenic
1087149411 11:94845192-94845214 TCACAGAAACAGTTTCAGCAGGG + Intronic
1091279361 11:134373365-134373387 CTGCAGGGCCAGTTTCAGTGGGG - Intronic
1092138064 12:6163464-6163486 CACCAGGAACAGATTCACCAGGG - Intergenic
1092495351 12:8988036-8988058 CTGCAGGAACTATCTCAGCTTGG + Intronic
1095317563 12:40784707-40784729 CTGTAAGAACAGGTTCAACAGGG + Intronic
1095909746 12:47414216-47414238 CTTCAGGAACAATTTCAGGAAGG + Intergenic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097199706 12:57268237-57268259 CTTCAGCAACAGTTGCATCATGG - Intronic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1097752456 12:63371132-63371154 CTGCATGCTCTGTTTCAGCAAGG + Intergenic
1098331169 12:69355065-69355087 CTGGAGGAGCAGTTTCAGCTGGG - Intergenic
1098346841 12:69514378-69514400 ATGGTGGAGCAGTTTCAGCAAGG - Intronic
1099664768 12:85613877-85613899 ATGGAGGAACAGTGTCACCATGG - Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100233475 12:92633742-92633764 CTGCAGGAGCAGTCTCAGGTAGG - Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1102470539 12:113157597-113157619 CTGCATGAACAGCTTCACCTGGG - Exonic
1102946900 12:116997735-116997757 CTACAGGTATGGTTTCAGCAGGG - Intronic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1104009496 12:124919638-124919660 CCTCAGGAGCAATTTCAGCATGG - Intergenic
1106138799 13:26993708-26993730 CTGCAGGGACAGCTTTAGCCAGG - Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107161170 13:37229882-37229904 CTTCAGGAACAGTTTGATCAAGG + Intergenic
1108824037 13:54390162-54390184 CTTGAGGAACAGTCTCAGGAGGG + Intergenic
1110111550 13:71753591-71753613 TTACTGGAACAGTGTCAGCAAGG - Intronic
1112080896 13:95969014-95969036 CTGCTGGAACTGCTGCAGCATGG - Intronic
1113142637 13:107171549-107171571 GGGAAGGAAGAGTTTCAGCAAGG - Intronic
1114794633 14:25699430-25699452 CTGCAGCAAATGTATCAGCAAGG - Intergenic
1115446299 14:33494266-33494288 TTGAAGCAACAGTTTCATCAAGG + Intronic
1119062679 14:71492184-71492206 CTGATGGCACAGTTACAGCAAGG + Intronic
1119667944 14:76498415-76498437 CTCCAGGAAGAGTTTGTGCATGG - Exonic
1119970905 14:78969198-78969220 CTACAGGAACAGGCTGAGCATGG - Intronic
1121111105 14:91313743-91313765 CTGCAGGGACACGTTCTGCAAGG + Exonic
1121407187 14:93726201-93726223 GTGGAGGCACAGTTTCTGCAGGG - Intronic
1123130107 14:105978641-105978663 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123580360 15:21709767-21709789 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123617008 15:22152390-22152412 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123905930 15:24921354-24921376 CTGCAGGAACAGTTTCTGAGAGG - Intronic
1127392464 15:58517684-58517706 ATGCAAGAATAGTTTCGGCAGGG - Intronic
1127543499 15:59966875-59966897 CTTCAGGAACAACTTCAGAAAGG + Intergenic
1127871760 15:63079932-63079954 CTGCATGAAAAGTTTTAGTATGG + Intergenic
1127979120 15:64021410-64021432 CAGCAGCAACAATTTCATCAAGG - Intronic
1128520851 15:68373895-68373917 CTGCAGGTACAGTTTGATCCAGG - Intronic
1128534692 15:68481611-68481633 CTGCAGGAAGCGCTCCAGCAAGG + Intergenic
1128592535 15:68913620-68913642 CTTGGGGTACAGTTTCAGCAGGG - Intronic
1128700079 15:69797560-69797582 CTGCAGGAGCAATTTCAGGTGGG - Intergenic
1131192005 15:90324389-90324411 CTGCAGGAGCAGTTACAGAGCGG - Intergenic
1132386928 15:101407404-101407426 CTGAAGGAACAGTCTCCCCAGGG - Intronic
1202989230 15_KI270727v1_random:444012-444034 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1133330923 16:4973403-4973425 CTTCCGGAACAGTGTCAGCCTGG + Intronic
1133755259 16:8757772-8757794 CTGTTGGATGAGTTTCAGCAGGG - Exonic
1136111212 16:28064370-28064392 CTGCAGGAAGAGTGGCAACAGGG + Intergenic
1138552739 16:57756376-57756398 CTGCAGGATCAGCTTCAGGGAGG - Exonic
1138868973 16:60857860-60857882 ATGCTGGAATAGTTTCATCATGG + Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1141530087 16:84640392-84640414 CTGCAGGAACTGGCTCAGTAGGG - Intergenic
1142230434 16:88897672-88897694 TGGCAGGAACAGTTGCAGCTGGG + Intronic
1144511885 17:15884125-15884147 CTGGAGGAACAGTTTCAGTGTGG - Intergenic
1145124789 17:20291305-20291327 CTGCAGGGCCTCTTTCAGCAGGG + Intronic
1148156135 17:45426117-45426139 CAGCAGGTTCAGTTTCAGCCTGG - Intronic
1149060201 17:52412590-52412612 CTCCAGGAACAGTATCAGCCAGG + Intergenic
1150387804 17:64774736-64774758 CAGCAGGTTCAGTTTCAGCCAGG - Intergenic
1150413821 17:64970566-64970588 CTACAGTAATACTTTCAGCAAGG + Intergenic
1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG + Intronic
1151403492 17:73871659-73871681 CTGCAGGCTCAGGTGCAGCAGGG - Intergenic
1152198867 17:78933764-78933786 CTGCAAGGACAGTTTGAGCAGGG + Intergenic
1152617674 17:81345450-81345472 CTGCAGGAACACTTTGGGCCGGG + Intergenic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1155175432 18:23297702-23297724 CTGCAGAACCAGCTACAGCACGG + Exonic
1155922698 18:31619130-31619152 CCCCAGGAAGATTTTCAGCAAGG + Intergenic
1157933128 18:51845123-51845145 CTGGAGGAGCAGTTCCAGCAAGG - Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1158544373 18:58383383-58383405 ATGCATGAGCTGTTTCAGCAAGG - Intronic
1158631060 18:59114386-59114408 CTGCAGGAAATGTCTCAGCAAGG - Intergenic
1159166521 18:64708660-64708682 TTACAGGAACAGTTTCTTCAGGG - Intergenic
1160206639 18:76839941-76839963 CTGCTGGATCATTTTCAGAAAGG + Intronic
1161504057 19:4634559-4634581 CTTCAGGCACAGTTTGATCAAGG + Intergenic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1161849562 19:6731485-6731507 ATGCCGGAACAGCTTCAGCTTGG + Exonic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1163898446 19:20079869-20079891 CCGAAGGAGCAGTTCCAGCAGGG - Intronic
1163905029 19:20144746-20144768 CTCCAGGAACAGTTTATGGAAGG + Intergenic
1166950994 19:46428012-46428034 CTGCAGAAAGAGGTTCAGCTTGG + Intergenic
1166993375 19:46706440-46706462 CTGCAAGAAGAGCTTCAGCAGGG + Intronic
1167034669 19:46988045-46988067 CTGCAGAGACAGTTTGATCAAGG + Exonic
1167158126 19:47751476-47751498 CTGCTGGGACAGTCCCAGCATGG - Intronic
1168611708 19:57805987-57806009 CTGCAGGAATAGTTTCACACTGG + Intronic
1168617078 19:57847033-57847055 CTGCAGGAATAGTTTCACACTGG - Intronic
925287856 2:2727503-2727525 CTGCAGCAACAGTGTAGGCATGG - Intergenic
927772466 2:25875750-25875772 TTCGAGGAACAGTTTCATCAAGG - Intronic
929253267 2:39781677-39781699 CGGCAGGAACAATTTTAGAATGG + Intergenic
930699429 2:54444647-54444669 CAGCAGGAACAATGTCAGCCTGG + Intergenic
932126826 2:69152194-69152216 GAGCAGGAACAGGATCAGCAGGG - Exonic
936981485 2:118269272-118269294 CTCCAGGAAATGTTTAAGCAGGG + Intergenic
937491384 2:122371636-122371658 CTGCAGGGACAGGTCCTGCATGG - Intergenic
937530359 2:122820188-122820210 ATGGAGGAACAATTTAAGCAAGG - Intergenic
938314619 2:130317298-130317320 CTGAAGCAACTGTTTCAGCCAGG - Intergenic
938344354 2:130556714-130556736 CTGCAGGAACACTGTCTTCAGGG + Intergenic
938345479 2:130564008-130564030 CTGCAGGAACACTGTCTTCAGGG - Intergenic
939349769 2:141020574-141020596 AAGGATGAACAGTTTCAGCAGGG + Intronic
941285389 2:163606375-163606397 CTGCAGCAACATTTCCAACAGGG - Exonic
942568214 2:177287706-177287728 CTGCTGCACCAGTTTCAGCTGGG + Intronic
942879543 2:180842603-180842625 CTGCTAGAACAGCTTCATCAGGG - Intergenic
946668688 2:222078900-222078922 CTTCAGGAGCAGTTTGATCAAGG + Intergenic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947618885 2:231576111-231576133 CTGCAGGCGCAGTTTGATCAAGG + Intergenic
948105386 2:235409526-235409548 CTGCAGGAACAATTTCTAAAAGG - Intergenic
948378947 2:237540149-237540171 CTCCAGGAGCAGGTTCTGCAGGG - Intronic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1168761048 20:349650-349672 CTGCAGGAACGATTGCAGCTCGG - Exonic
1170110142 20:12796050-12796072 CTGCAGGGCCAGGTTCTGCAGGG - Intergenic
1172635742 20:36408483-36408505 CTGCAGGAACAAGCTCAGCTTGG - Intronic
1175318300 20:58067657-58067679 CTTCAACAACAGTCTCAGCAAGG + Intergenic
1175441015 20:58991325-58991347 CTGCATGAACAGGTCCAGGAAGG - Exonic
1176011693 20:62900272-62900294 CGGCAGCAACAGTTTCATCTGGG - Intronic
1178147288 21:29754828-29754850 CTGCAGCATCAGCTTCAGCCTGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180606401 22:17062105-17062127 CTGAAGTCACAGTGTCAGCACGG + Intergenic
1181086471 22:20441837-20441859 CTGCAGGAACTGCTTCTGAAAGG - Exonic
1182325673 22:29510995-29511017 CTGCAGGGGAAGTTTCAGGAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184943896 22:47787538-47787560 CTGCAGGAACAGTGCCCTCATGG + Intergenic
949114851 3:308833-308855 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
949921273 3:9004020-9004042 CTGCATGAATAAGTTCAGCAAGG + Intronic
950627758 3:14260610-14260632 CTGCAGGAGGAGTTTAAGCAGGG + Intergenic
951044520 3:18023142-18023164 CTGCAGCAACAGTATCAACCTGG + Intronic
951106649 3:18751688-18751710 CTGCAGGTTCAGTTTCACCCTGG - Intergenic
951127186 3:18997542-18997564 CGGAAGGAACAGAATCAGCAAGG - Intergenic
952301714 3:32109333-32109355 CTCCAGGCCCAGTTCCAGCATGG - Intronic
952573919 3:34751352-34751374 TTTCTGGAACAGTTTCAGCAAGG - Intergenic
953031683 3:39183998-39184020 GTGCAGGAACTGCCTCAGCAAGG + Exonic
953589750 3:44240466-44240488 GTGCAAGAACAGTTGCAGGAAGG + Intergenic
953663188 3:44905845-44905867 CTGCAGGAAGATTCTCAGCAGGG + Intronic
955274038 3:57530466-57530488 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
955417718 3:58708245-58708267 CTGATGGAACTGTTTCAGAAGGG + Intergenic
955683546 3:61527439-61527461 CTCCATGAATAGTTTCACCAAGG + Intergenic
955987249 3:64586878-64586900 TTGAAGGAAAAGTTTCAGGAAGG - Intronic
956775728 3:72563920-72563942 CTTCAGGAATAGTTTGATCAAGG - Intergenic
957963056 3:87284599-87284621 CTGCAGAGACAGTTCCTGCAGGG - Intergenic
958015359 3:87934007-87934029 CAGCAGGAACAGTTTTCCCAGGG - Intergenic
958488526 3:94743306-94743328 ATGAAAGAACAGTATCAGCAGGG + Intergenic
960142889 3:114168011-114168033 CTGCAGGCACAGTTCCATCAGGG - Intronic
962615073 3:137117390-137117412 TTACAGGCACAGTTTCAACAGGG - Intergenic
969834755 4:9831569-9831591 GTGCATGTACAGTGTCAGCAGGG - Intronic
974286149 4:59870076-59870098 CAGAAGGAACAGTTTCAGAAAGG - Intergenic
975666869 4:76741400-76741422 CTGCTGGAACTGCTTCAGCTCGG - Exonic
979031166 4:115649340-115649362 CTTCAGGATCTGTCTCAGCAGGG + Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
984532570 4:180934576-180934598 TTGCAGGAACAATTTTTGCAAGG - Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
987964150 5:24850636-24850658 CTGCAGCAACCGGTTCAGAATGG + Intergenic
988651997 5:33162664-33162686 CTGGAAGAGCAGTTCCAGCAGGG + Intergenic
989380603 5:40806080-40806102 CTGCATGACCAGTATCATCATGG - Intergenic
991659191 5:68932969-68932991 CTGCACGTACAATGTCAGCAGGG + Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
993361428 5:86981414-86981436 CTTAAGGAACAGTTTCCACAGGG + Intergenic
995562114 5:113393794-113393816 CTGAAGGAAGAGTTTCAAGAAGG - Intronic
996225502 5:120989102-120989124 CTACAGCAACAGTATCAGCTGGG + Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
998053023 5:139052263-139052285 CGGCAGGAACAGCAACAGCATGG - Intronic
1003117314 6:3291641-3291663 CTACAGGCACAGTTTCTCCATGG + Intronic
1003464224 6:6363046-6363068 CTGCATGAAGAGTTTGAGAAAGG - Intergenic
1003805251 6:9720971-9720993 CTGGAGGAACAGTTTCCAGATGG - Intronic
1004069782 6:12288053-12288075 CTGCAGGGGCAGCCTCAGCAAGG + Intergenic
1004867305 6:19866835-19866857 CTATAGAAACAGTTTCATCAGGG - Intergenic
1004892578 6:20115696-20115718 CCCCAGGAAAAGTTTCATCATGG + Intronic
1006939543 6:37742710-37742732 CTGGAGGAACAGTTACGGCTTGG + Intergenic
1007414690 6:41684619-41684641 CCGCCGGAGCAGCTTCAGCATGG - Exonic
1008003001 6:46380253-46380275 CTGTAGGAACAGTCACACCAAGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010475942 6:76287364-76287386 CTGCAAGAGCAATTTCAGCAGGG - Intergenic
1011998554 6:93623801-93623823 CTGCTGGAAAAATATCAGCAAGG - Intergenic
1016452237 6:144195233-144195255 CTGCAGGGTCAGCTTCAGCAGGG - Intergenic
1017466521 6:154699018-154699040 TTGGAGGAAGTGTTTCAGCAAGG + Intergenic
1017723093 6:157258127-157258149 CTGCAGGAAAAGTTTCATATGGG - Intergenic
1018483601 6:164216717-164216739 CTGCAGGAATCGGTTCAGCAAGG - Intergenic
1019141674 6:169950874-169950896 CTGCAGGAAGAAGATCAGCATGG - Intergenic
1021037481 7:15817861-15817883 GTGCAGGGAGACTTTCAGCAGGG + Intergenic
1022292123 7:29014838-29014860 CTGAAGGAACAGTTCCAGAAGGG - Intronic
1023802212 7:43844965-43844987 TTGCAAGAACAATTTCAGTAAGG - Intergenic
1024719542 7:52119773-52119795 TTGCAGGCACAGTCACAGCAAGG - Intergenic
1025079134 7:55967006-55967028 TTGCTGAATCAGTTTCAGCAAGG + Intronic
1026322545 7:69280159-69280181 CTGCTGGAACACTCTCAGTACGG + Intergenic
1026503529 7:70963157-70963179 CTGCAGGACAAGTTTCTCCATGG - Intergenic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1031092245 7:117372431-117372453 CTGGAGGAACAGTCTCAACCTGG - Intronic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1031757866 7:125668625-125668647 CTTCAGAAACACTTTCAGCTTGG + Intergenic
1033420202 7:141198805-141198827 CTCCAGGTACAGTTTCAGCCAGG - Intronic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1040574108 8:48635812-48635834 CTGCAGGCAAGGTGTCAGCAGGG + Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1048395782 8:134012645-134012667 CAGCAGGAACAGTGTGTGCAGGG + Intergenic
1048786184 8:138052853-138052875 CTGCATGAACAGTTTCCTCATGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049254936 8:141608736-141608758 CTGCAGGAACAGGTACTGCAGGG + Intergenic
1049302929 8:141881260-141881282 CTGCAGGTACACTCTCAGCTGGG + Intergenic
1049614028 8:143568606-143568628 CTGCAGCACCAGCTTCCGCAGGG + Exonic
1049764906 8:144350627-144350649 CTGCAGGAACAGCCTCAAGAAGG - Intergenic
1049789958 8:144467999-144468021 CTGCAGGAACGGCTGCAGCTCGG - Intronic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1052952473 9:34224105-34224127 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
1053160533 9:35810648-35810670 CTGCAGGAGCATCTCCAGCATGG + Exonic
1053186528 9:36021233-36021255 CTACAGGAGCACTTCCAGCAAGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057820971 9:98330429-98330451 CTTCAGGCACAGTTTGATCAGGG - Intronic
1060500903 9:124154302-124154324 CTTTTGGAACAGTTTCAGTAGGG - Intergenic
1061377864 9:130236732-130236754 CTGCAGGAACAGGGACAACAGGG - Exonic
1062095239 9:134699742-134699764 CTGCAGGAGCAGTTTGATCAAGG + Intronic
1186373944 X:8978308-8978330 CTACAGTAACAGTAACAGCATGG - Intergenic
1186615277 X:11179360-11179382 CCTCAGGAACTCTTTCAGCAAGG + Exonic
1186890909 X:13958254-13958276 CAGCAGCAACAGTATCAGCTGGG + Intergenic
1188615423 X:32152482-32152504 ATCCAGGAACATTTTCAGCCTGG - Intronic
1188918152 X:35937421-35937443 CTGGAGGAACAATAGCAGCAGGG - Intronic
1189898147 X:45677759-45677781 CTACAGTAACCGTTACAGCATGG + Intergenic
1190089048 X:47421564-47421586 CTGCAGGGACTGTTTCCCCAGGG - Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1194792240 X:98164655-98164677 CTTCAGCAGCAGTTTAAGCAGGG - Intergenic
1194848597 X:98843226-98843248 CTATAGGAACAATATCAGCATGG - Intergenic
1200021749 X:153217605-153217627 CTTCAGGCTCAGTTTGAGCACGG + Intergenic
1201400874 Y:13602583-13602605 CTGTAGCAACAGTTTCAGGGGGG + Intergenic