ID: 1101323955

View in Genome Browser
Species Human (GRCh38)
Location 12:103698284-103698306
Sequence CTGTGGGGAAGGAGAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1675
Summary {0: 1, 1: 0, 2: 20, 3: 194, 4: 1460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101323955_1101323965 30 Left 1101323955 12:103698284-103698306 CCTTCTCCTCTCCTTCCCCACAG 0: 1
1: 0
2: 20
3: 194
4: 1460
Right 1101323965 12:103698337-103698359 AATTCCATTTTGGTTTCACTAGG 0: 1
1: 1
2: 2
3: 27
4: 338
1101323955_1101323964 20 Left 1101323955 12:103698284-103698306 CCTTCTCCTCTCCTTCCCCACAG 0: 1
1: 0
2: 20
3: 194
4: 1460
Right 1101323964 12:103698327-103698349 GATCTCACTAAATTCCATTTTGG 0: 1
1: 0
2: 2
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101323955 Original CRISPR CTGTGGGGAAGGAGAGGAGA AGG (reversed) Intronic
900800435 1:4733748-4733770 TTGTGGGCAGGGATAGGAGAAGG + Intronic
900952618 1:5866320-5866342 CGGTGGCGGAGGAGAGGAGGAGG - Intronic
900974060 1:6006541-6006563 CTGAGGGGTAGGGGAGGAGTGGG - Intronic
901124450 1:6919238-6919260 CTGAGGGGATAGAGAGGTGAAGG - Intronic
901236545 1:7670375-7670397 CTGTGGGGATGGCAAGGTGAGGG - Intronic
901455725 1:9361760-9361782 CTGGAGGGCAGGAGTGGAGATGG + Intronic
901559346 1:10057926-10057948 ATGTAGGTAAAGAGAGGAGAAGG + Intronic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
901879673 1:12186321-12186343 CTGTGAGGAAGGGGAGGAGGAGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902536144 1:17120184-17120206 GTGGGTGGAGGGAGAGGAGAGGG + Intergenic
902712458 1:18249761-18249783 CTGTGGGCCAGTAGAGGAAAGGG - Intronic
902763315 1:18598541-18598563 CTGTGCTGAAGGAGAGGAATAGG - Intergenic
902771454 1:18647488-18647510 GGGTGGGGGGGGAGAGGAGAAGG + Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903141790 1:21343672-21343694 CTGTGGGGAAGTGGAGGGGATGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903519251 1:23934976-23934998 CTGTGGGGAGGGGGAGGGGGAGG - Intergenic
903674344 1:25054810-25054832 CTGGAGGGACGGAGAGGAGGGGG + Intergenic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903917559 1:26775179-26775201 CTGTGTTGAAGCAGAGGAGGCGG + Exonic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904424831 1:30416544-30416566 CTGTGGGGAAGATGGGGAGCAGG + Intergenic
904426004 1:30423603-30423625 CTGTGAGGACTGAGAAGAGAAGG - Intergenic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906010916 1:42524696-42524718 CAGGGGTGGAGGAGAGGAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906326467 1:44849203-44849225 CCATGGGGAAGGACAGGAAAGGG + Intergenic
906477512 1:46179790-46179812 AGATGGGGAAGGAGAGGAGATGG + Intronic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
906931083 1:50170159-50170181 TTGTGGGGCATGAGAGAAGAAGG + Intronic
907301174 1:53487083-53487105 CAGTGGGGAAGGGGAGGCGGTGG + Intergenic
907341929 1:53741183-53741205 CTGAGGGGAAGGGGAGGGGGCGG - Intergenic
907443100 1:54490462-54490484 TAGAAGGGAAGGAGAGGAGAGGG - Intergenic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907700420 1:56781344-56781366 CTGTGGGGAGTGAGATGTGAGGG - Intronic
907714657 1:56915836-56915858 ATTTGGGGAATGAGAGCAGAGGG + Intronic
907762496 1:57375192-57375214 CTGTGGGGGAGGAAATGAGTGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907859527 1:58338297-58338319 GGGAGGGGAAGGAGAGGTGAGGG - Intronic
907872670 1:58457101-58457123 CTGTGCAAAATGAGAGGAGATGG - Intronic
908114143 1:60924734-60924756 CTGTGGGGAAGAACAGGAACAGG - Intronic
908401088 1:63773835-63773857 GTGTGGGGGAGGGGAGGGGAGGG + Intergenic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
908623280 1:66009562-66009584 GTGAGGGGAAGGAAAGGAGTTGG - Intronic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
909040570 1:70644765-70644787 GTGGGGAGAAGGAAAGGAGAGGG - Intergenic
909561803 1:77016076-77016098 ATGAGGGGGAGGAGTGGAGAAGG - Intronic
909962649 1:81865701-81865723 CTAAAGGGAAGCAGAGGAGAGGG + Intronic
910093307 1:83491383-83491405 GTGTTTGGAAGGACAGGAGAGGG - Intergenic
910159584 1:84259023-84259045 CTCTGGGGCAGGGGAGGAGTGGG + Intergenic
910280691 1:85498147-85498169 CCCTGGAGAAGGAGAAGAGAAGG - Intronic
910492302 1:87785912-87785934 CTGCCAGGAAGGAGATGAGATGG - Intergenic
910542358 1:88374547-88374569 CTAAGAGGAAGAAGAGGAGAAGG - Intergenic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911486864 1:98513622-98513644 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913963666 1:143357527-143357549 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
914058025 1:144183116-144183138 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
914121120 1:144783249-144783271 AGGGGGAGAAGGAGAGGAGAAGG + Intergenic
914446325 1:147753432-147753454 CTGTGGGGTAGGGCTGGAGAGGG - Intergenic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
915286542 1:154856931-154856953 ATGGGGGGAAGGGGAGCAGACGG + Intronic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915584414 1:156836485-156836507 CTGTGTGGAAGGACAGGGTAGGG + Intronic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
916290865 1:163164972-163164994 CTGTTGGGCAGGAAGGGAGAGGG - Intronic
916313259 1:163419794-163419816 CTGCAGGGAAGGGGAGGATATGG - Intergenic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
918012030 1:180595710-180595732 GTGAGGTGCAGGAGAGGAGAGGG + Intergenic
918031400 1:180816178-180816200 CTGGCGGGTAGGAGAGGGGATGG + Intronic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918097691 1:181348373-181348395 ATGTGGGGAAGGGGAGGGAAAGG - Intergenic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918543551 1:185657636-185657658 GGGTAGGGGAGGAGAGGAGAGGG - Intergenic
918739153 1:188104794-188104816 CAGTGGGTAAGGGGAGGACAGGG + Intergenic
919806504 1:201383830-201383852 CTGTGGGGGAGGGAAGGGGAGGG - Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919902954 1:202057370-202057392 CTGTAGGGAAGGAAACCAGACGG - Intergenic
919919769 1:202160987-202161009 CTGTGGGGCAGAAGCAGAGAAGG - Exonic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920047299 1:203141520-203141542 CTTGGGGGCAGGAGAGGGGACGG + Intronic
920105470 1:203549995-203550017 CAGTGGGGAAGCACAGGAAAGGG - Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920330427 1:205203538-205203560 CGGTAGGGAAGGGGAGGGGAGGG + Intronic
920403103 1:205689507-205689529 CTGTCAGGCAGCAGAGGAGAGGG + Intergenic
920663234 1:207937475-207937497 TTGTGGGGCAGGAGAGTAAATGG - Intergenic
920721234 1:208388896-208388918 AGCTGGGGAAGGAGAGAAGATGG + Intergenic
920799267 1:209172562-209172584 CTGTGGGGACTGGGAGGAGCGGG + Intergenic
920819052 1:209363239-209363261 GGGTGGGGAAGGGGAGGAGCTGG - Intergenic
920891789 1:209993741-209993763 GAGAGGGGAAGGAGAAGAGATGG - Intronic
921685700 1:218086751-218086773 CTGTGGGGAAGGATGTTAGACGG - Intergenic
921799348 1:219384010-219384032 CAGTAGGGAAGGAGAGGGGAAGG - Intergenic
921936463 1:220801174-220801196 CAGAGGGGAGTGAGAGGAGAAGG - Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922880574 1:228977438-228977460 GGCTGGGGGAGGAGAGGAGAAGG + Intergenic
922887018 1:229028178-229028200 AGGCAGGGAAGGAGAGGAGAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922932632 1:229402375-229402397 TTGTGGGGGATGAGAGTAGACGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923092648 1:230751848-230751870 CTGTGGGGTGGGGGAGGGGAGGG + Intronic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923602058 1:235412129-235412151 GGGAGGGGAAGGGGAGGAGAAGG - Intronic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
924444812 1:244119356-244119378 AAGTGAGGAGGGAGAGGAGATGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063326445 10:5108130-5108152 CTATGGGGGAGGTTAGGAGAAGG + Intronic
1063441591 10:6077553-6077575 TTCTGGGGAAAGTGAGGAGAGGG + Intergenic
1063447729 10:6130168-6130190 CCATGGGGAAGGTGAGCAGAGGG + Intergenic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064112485 10:12550987-12551009 AGGTGGGCAAGGAGAGGAGGAGG + Intronic
1064195971 10:13244367-13244389 TTTTGGGGAGGGAGAGGATAAGG + Intergenic
1064364182 10:14692205-14692227 CTGGGTGGAAAGAAAGGAGAAGG + Intronic
1065285745 10:24186037-24186059 GTGTTGGGAAGGGGAGGAGAAGG - Intronic
1065454711 10:25894864-25894886 TGGTGGGGAAGGAGAGGTCATGG + Intergenic
1066402526 10:35090081-35090103 CTGGGGCGGAGGAGAGGAGTTGG - Intronic
1066700746 10:38125494-38125516 CTGCATGGAGGGAGAGGAGATGG + Exonic
1067043292 10:42969968-42969990 CTGAGGGGGAGGAGATGAGGAGG + Intergenic
1067044934 10:42980226-42980248 CTGTGTGGGAGGGGAGGTGAGGG - Intergenic
1067850373 10:49750512-49750534 CTGTGGACAAGGAGAGGTGGAGG - Intronic
1067985551 10:51139786-51139808 CCAGGTGGAAGGAGAGGAGAAGG - Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069631958 10:69902626-69902648 CTGCCGGGAAGGAGTGGTGATGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069773366 10:70913090-70913112 CTGTGGGGAAATAGTGGAGGAGG + Intergenic
1069786986 10:70994743-70994765 ATGAGGTGGAGGAGAGGAGAGGG + Intergenic
1069801587 10:71085058-71085080 CTGTAGGGAAGGGGTGGGGAGGG + Intergenic
1069889447 10:71644008-71644030 TTCAGGGGAAGGAGAGGAGTTGG + Intronic
1069890619 10:71650052-71650074 CTGAGGGTAAAGAGAGGAGCCGG + Intronic
1069980784 10:72251006-72251028 CAGTGGGCCAGCAGAGGAGAGGG + Intergenic
1070150702 10:73803132-73803154 CTGAAGGGAAGAAGAGGGGAAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071031566 10:81190218-81190240 CTGTTGGGAAGGAAAGCAGCAGG + Intergenic
1071507821 10:86243287-86243309 CTCTGGGGGAGGACAGGATAGGG + Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071849401 10:89553073-89553095 GTGTGGTGAAGGAGTAGAGACGG - Intronic
1072189995 10:93071085-93071107 CTCTGGGGAAGGAGCAGAGGAGG + Intergenic
1072235421 10:93449475-93449497 TTTTGGGGAAGGGGAGGAGAGGG - Intronic
1072421300 10:95292009-95292031 CTGGGGGGCAGGTGAGGAAAGGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072738598 10:97896132-97896154 CTGTTAGGAAGGATAGGAGATGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073072554 10:100803750-100803772 AGGCGGGGAAGCAGAGGAGAGGG - Intronic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073114104 10:101081310-101081332 CTTTGGGGAAAGGTAGGAGAAGG - Intergenic
1073137154 10:101226374-101226396 CTGTGGAGGAGGTGAGGTGAGGG + Exonic
1073215209 10:101832549-101832571 ATGTGTTGAAGGAGAGGAGGTGG - Intronic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073436427 10:103519446-103519468 CTGAGGGGAAGAATATGAGAAGG - Intronic
1073491812 10:103857344-103857366 GTGGGGGGAAGAAGAGGAGGGGG + Intergenic
1073541967 10:104322206-104322228 CTGTCTGGAAGGAGAGGAGGAGG - Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1074919476 10:117992981-117993003 GTGAGGGGAAGGAGCGGGGAGGG + Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075274100 10:121078093-121078115 CTGAGAGGGAGGCGAGGAGAAGG + Intergenic
1075282540 10:121152736-121152758 CGCTGGGGAAGAGGAGGAGAAGG - Intergenic
1075508873 10:123052516-123052538 ATGTGGGTAAGGACACGAGATGG - Intronic
1075567635 10:123516064-123516086 CTATGAAGAAGGAGAGGACATGG - Intergenic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1075713223 10:124541852-124541874 CAGTGGGGAAGTAGGGGTGAAGG - Intronic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076285103 10:129287822-129287844 ATGTGGGGAAGGTGGGGAAAGGG + Intergenic
1076438887 10:130465730-130465752 CCGTGGGCAAGGAGAAGAGCTGG - Intergenic
1076495594 10:130895532-130895554 CTGTGGGACAGGAGAGGTGGGGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077010818 11:378534-378556 GGGTGGGGAAGGACAGGAGTTGG + Intronic
1077028408 11:451914-451936 CCCTCGGGAGGGAGAGGAGATGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077218101 11:1403471-1403493 CTGAGTGGAAGGAGCAGAGAGGG - Intronic
1077267744 11:1660543-1660565 GAGAGGGGAAGGAGAGGAGGAGG + Intergenic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077595341 11:3527046-3527068 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1077731176 11:4731553-4731575 CAGTGTGGAAGGAGAGGGTAAGG - Intronic
1077840340 11:5967726-5967748 CTGTGGTGAAGAAGAGGATGAGG + Exonic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078125459 11:8557244-8557266 TTGTGGGGAAGGGAAGGGGAGGG + Intronic
1078326725 11:10387325-10387347 CGGTGGGGACGCAGAGGAAAAGG + Intronic
1078390587 11:10932201-10932223 GTGGGGGGAAGGAGATGAGGAGG + Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078631014 11:13004449-13004471 CTGTGGGGAAAGGAAGTAGATGG + Intergenic
1078779348 11:14422376-14422398 CTGTGGGGTGGGGGAGGAGGGGG - Intergenic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1080157088 11:29124215-29124237 CAATAGGGAAGGAAAGGAGAAGG - Intergenic
1080836881 11:35947549-35947571 CTGTGGGCAAGGGAAAGAGAGGG + Intronic
1080885796 11:36366916-36366938 CTGTGGGAGAAGGGAGGAGAAGG - Intronic
1080899887 11:36479842-36479864 TTGGGGGAAAAGAGAGGAGATGG + Intergenic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1081650767 11:44822701-44822723 CTTTGGGGAAGGACAGCTGAAGG - Intronic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1081738860 11:45424269-45424291 CTAGGGGGAGGGAGAGGAGAAGG - Intergenic
1081878545 11:46428191-46428213 GGGAGGGGAAGAAGAGGAGAGGG + Intronic
1082740217 11:56902558-56902580 GGATGGGGAAGGAGAGGAGAGGG - Intergenic
1082775629 11:57242420-57242442 CTCTCGGGAAGGAGAGAAAAAGG - Intergenic
1082814865 11:57501115-57501137 CTATGGGGAACGGGAGGACAGGG - Intronic
1082823566 11:57561476-57561498 CGGTAAGGAAGGAGATGAGAGGG + Intronic
1083097441 11:60266269-60266291 ATGTGGGGAAAGACAGGAGAAGG - Intergenic
1083202607 11:61129615-61129637 TTGCGGGGAAGGAGAGGCGGAGG + Intergenic
1083316908 11:61821003-61821025 AGGTGGGTAAGGAGATGAGAGGG - Intronic
1083576145 11:63793252-63793274 CAAAGGGGAAGGAGAGAAGAAGG - Intergenic
1083620524 11:64047187-64047209 CTCTGGGGCAGGGGAGGGGAGGG - Intronic
1083640170 11:64141181-64141203 TGGTGGGGGAGGTGAGGAGACGG + Intronic
1083647923 11:64183884-64183906 CTGTGTGGAGGAAGAGGGGAGGG - Intergenic
1083736502 11:64684652-64684674 GTGGGAGGAAGGGGAGGAGAAGG + Intronic
1083742062 11:64716359-64716381 CTGTGGGAAAGGCGAGGGGCAGG + Intronic
1083743343 11:64722540-64722562 CTTCGTGGGAGGAGAGGAGAGGG - Intronic
1083831437 11:65236363-65236385 CTGAGGAGGAGGGGAGGAGAGGG - Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084004911 11:66317473-66317495 CTGTGGGGCAAGAAAGGAGTGGG - Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084611522 11:70206166-70206188 ATGTGGGGAAAGATTGGAGAAGG + Exonic
1084732049 11:71079919-71079941 GGGGAGGGAAGGAGAGGAGAGGG + Intronic
1084821603 11:71695013-71695035 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1084857029 11:71995989-71996011 CTGTGAGGAGGAAGAGGAGGGGG + Intronic
1084945159 11:72634374-72634396 CTGAGGGGCAGGAGTGGAGGTGG - Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085274550 11:75289930-75289952 CTCTTGGGAAGCAGAGGAAACGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085519915 11:77131693-77131715 CAGAGGGGCAGGAGAGGAGGGGG - Intronic
1085532229 11:77198653-77198675 CAGAGGGGAAGGAGAGGGGCTGG + Intronic
1085709295 11:78814394-78814416 CTCTGGGGAGAGAAAGGAGAAGG + Exonic
1085829934 11:79888822-79888844 CTTTGGGAAAGAAGATGAGAAGG + Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087680383 11:101213317-101213339 CTGAGGGGAAGGAGCGGTGGTGG + Intergenic
1087919702 11:103852451-103852473 CTGGGAGGAAGGTAAGGAGAGGG + Intergenic
1088327653 11:108617272-108617294 TTGTGGGGAGTGAGAGGATAAGG + Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089289251 11:117427938-117427960 CTGGGGGGAAGGTGAGGAGGAGG + Exonic
1089314795 11:117584059-117584081 CAGGGGGGTAGGAGAGGAGGGGG - Intronic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090383536 11:126343487-126343509 CTCTGGGAAAGGTGAGGAAAGGG - Intronic
1090817943 11:130314936-130314958 GGCTGGGGAAGGGGAGGAGAAGG + Intergenic
1090894214 11:130955159-130955181 CTGTGGGGCCTGAAAGGAGAAGG + Intergenic
1090965349 11:131593199-131593221 CACTGGGGAAGGAGAGGTGTAGG - Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091287934 11:134418865-134418887 ATTTGGGGAAGGACTGGAGAAGG + Intergenic
1091305093 11:134531588-134531610 CTGTAGGGAAGGAAACCAGAGGG - Intergenic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091624733 12:2113295-2113317 CTGTGGGGACGGGGTGGAGGTGG + Intronic
1091840169 12:3615003-3615025 CTAAGGGCAAGGGGAGGAGAAGG + Intronic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092329444 12:7569303-7569325 CGGTGGGGAAAACGAGGAGATGG + Intergenic
1092421498 12:8335820-8335842 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1092781189 12:11988915-11988937 CTAAGGGGAAGGGGAGGATATGG - Intergenic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093873111 12:24316239-24316261 TTGAGGGGAAGGGGAGTAGAAGG + Intergenic
1094056427 12:26273773-26273795 ATTTGGGGAAGAAGAGGAAATGG - Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095517646 12:43024233-43024255 CTTTGGGGAGGGTCAGGAGAGGG + Intergenic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095822067 12:46489215-46489237 TTGTGGGGAACCAGAGGGGATGG - Intergenic
1095930435 12:47620081-47620103 CTGAGGGGAAGCAAAGGAAAGGG + Intergenic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096517576 12:52165614-52165636 CTGCTGGGAAGGAGGGGTGACGG - Intergenic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096526528 12:52213309-52213331 CTGCGGGGAGGGAGACGAAAAGG - Intergenic
1096561271 12:52437670-52437692 CTGTGGAGGAGGAGAGGAAGTGG + Intergenic
1096653734 12:53075514-53075536 CTAAGGGGTAGGAGAGCAGAAGG + Intronic
1096670984 12:53198081-53198103 CTGTGGCGAGGAAGAGGGGAGGG - Intronic
1096676460 12:53228982-53229004 CCCAGGGGAAGGGGAGGAGAAGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096807409 12:54149018-54149040 CACTGGGGAAGGAGAGGTGTGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096911592 12:54989739-54989761 GGGTAGGGAAGGAGAGGGGAGGG - Intergenic
1097107552 12:56634552-56634574 CTACGGGGAAGGAGAGGAGTTGG + Intronic
1097177065 12:57149407-57149429 CAGCGGGGGAGGAGAGGACAGGG - Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097268768 12:57761392-57761414 CAGTAGGGAAGGAGTTGAGAAGG + Intergenic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1097583489 12:61486903-61486925 GTGGGGGGAGGGAGAGGAGTGGG + Intergenic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1098461431 12:70736982-70737004 CAGTGGGGCAGGAGAGGATGGGG - Intronic
1098544611 12:71697791-71697813 CAGTAGGGAAGGAAAAGAGAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098805252 12:75014657-75014679 CCCTGGGGAAGGACAGAAGAAGG - Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1100270929 12:93023765-93023787 CAGTGGTGAAGGAGAAGAGAAGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101128532 12:101664664-101664686 CTGGAGGGAGGAAGAGGAGAGGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101337765 12:103811379-103811401 CAGGAGGGGAGGAGAGGAGACGG + Intronic
1101626796 12:106451633-106451655 CGGGGGGGGAGGAGAGGGGAGGG + Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101734303 12:107451664-107451686 CTGGGGGGAAGGAAAGGTGGGGG - Intronic
1101744256 12:107526443-107526465 CTGTGGGGAAGCAGAGGCCCTGG + Intronic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102899172 12:116622976-116622998 CTTTAGGGAAGGAATGGAGATGG - Intergenic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1103018329 12:117513505-117513527 CGCTGGGGAAGGAGAGGGAAAGG + Intronic
1103887364 12:124212829-124212851 CAGAAAGGAAGGAGAGGAGAGGG - Intronic
1104066861 12:125313630-125313652 AGGTGGGGGAGGAGAGGGGAGGG - Intronic
1104083582 12:125455219-125455241 CTAGGGGGAGAGAGAGGAGAGGG + Intronic
1104134392 12:125923499-125923521 GTGAAGGGAGGGAGAGGAGAAGG + Intergenic
1104204630 12:126626678-126626700 GTGAGGGGAAGGGAAGGAGATGG - Intergenic
1104414845 12:128589492-128589514 CTGTGGGGAGGGGGAGGTGCAGG - Intronic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104726783 12:131082704-131082726 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
1105008962 12:132741739-132741761 CTGTCTGCAAGGAGAGGAAAAGG + Intronic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105770886 13:23610717-23610739 CTTTTGGGAAGGAGAGGTGGAGG + Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105936809 13:25107955-25107977 GTGAGGGGAGGGAGAAGAGAGGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106542194 13:30699959-30699981 CTGTGGGGGAACTGAGGAGATGG + Intergenic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107028776 13:35830036-35830058 CTGTGGGGTAGAGGAGGAGAAGG + Intronic
1107166911 13:37293092-37293114 CCATGGGGAAGGAGAGGATGAGG + Intergenic
1107331602 13:39307193-39307215 CCTGGGGGAAGGAGAGGGGATGG - Intergenic
1107511606 13:41091213-41091235 CAGTGGGGAAGGGTAGGAGGGGG + Intergenic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1107559901 13:41549624-41549646 TAGTGGGGAAGGTGATGAGAGGG + Intergenic
1107580651 13:41780568-41780590 CTGTGGGGATGGAAAAGAAAGGG - Intronic
1107650281 13:42538051-42538073 CTGTGGGAAAGGGGAGGCCAGGG - Intergenic
1107800874 13:44107032-44107054 CTGAGGGGTGGCAGAGGAGAGGG - Intergenic
1107867387 13:44716039-44716061 CTGTGGGAAAGGAGATTAGCTGG - Intergenic
1107948412 13:45440596-45440618 CTGTGGGGAAGGACATGATGAGG - Intergenic
1108322680 13:49303198-49303220 CTGGGCGACAGGAGAGGAGAGGG + Intergenic
1108475734 13:50815376-50815398 ATGAGGGGAAGGAAATGAGAGGG + Intronic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1108543497 13:51467117-51467139 CTCTGGAGCAGGAGAGGACAGGG + Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1109371375 13:61424464-61424486 ATTTGGGGAAGGAGAGAGGATGG + Intronic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1110142401 13:72146972-72146994 ATGTGTGGCAGGAGAGGTGATGG - Intergenic
1110193594 13:72759936-72759958 CAGTGGGGAAGGGGAGGATGAGG - Intronic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110412000 13:75214824-75214846 CCGTGGGGAAGGGGAGGAGAGGG - Intergenic
1110522499 13:76497213-76497235 GACAGGGGAAGGAGAGGAGAGGG + Intergenic
1110794117 13:79617737-79617759 ATAGGGGGAAGGTGAGGAGATGG + Intergenic
1111278667 13:85988777-85988799 TTATGGGGAAGGAGTGGGGAAGG + Intergenic
1111397212 13:87678492-87678514 GTGTGGGGCAGGTGTGGAGAAGG + Exonic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111930044 13:94503386-94503408 GGGAAGGGAAGGAGAGGAGAGGG + Intergenic
1112230528 13:97585068-97585090 CTTTCTGGAAGGAGAGGAAATGG - Intergenic
1112455262 13:99555362-99555384 GGGTGGGGAAGGGGAGGAGTAGG - Intronic
1112724029 13:102281428-102281450 CTGTGAGGAGGGAGATGAGGTGG - Intronic
1113445547 13:110363614-110363636 CCTTGGGGAAGGAAAGGAGAGGG + Intronic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113799343 13:113078340-113078362 CTGTTGGGAAGAAGGGGAGCGGG - Intronic
1113850538 13:113415078-113415100 CCCTGGGGCAGGTGAGGAGAGGG + Intergenic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1117103949 14:52379935-52379957 TTCTGAGGGAGGAGAGGAGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117237648 14:53795311-53795333 CTGCAGGGAAGAAGAGGAAAGGG - Intergenic
1117317363 14:54585589-54585611 CTCGGGGGAAGGAGTGGGGATGG - Intronic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1118150802 14:63188328-63188350 CTGTGGGGGAGGGTAGGAGGGGG - Intergenic
1118171826 14:63395860-63395882 GAGTCGGGGAGGAGAGGAGAAGG + Intronic
1118284118 14:64455470-64455492 CAGTTGGGAAGCAGAGGGGAGGG + Intronic
1118315405 14:64722892-64722914 CTGTGGGATAGGGGAGGAGCAGG + Intronic
1118316992 14:64731572-64731594 CCTTTGGGAAGGAGAGAAGATGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118920306 14:70143929-70143951 CTGTGGGGAAGAAGAGGGAGAGG - Intronic
1118959837 14:70518899-70518921 CTGTGGGGAACCTTAGGAGAAGG - Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1119687002 14:76640909-76640931 TTATGGAGCAGGAGAGGAGAAGG - Intergenic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1119825516 14:77654234-77654256 ATGTGGCAAAGGAGAAGAGAGGG - Intergenic
1120034819 14:79684795-79684817 ATGAGAGGAATGAGAGGAGATGG + Intronic
1120489950 14:85164804-85164826 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1120759673 14:88274197-88274219 GTGTGTGGAAGAAGAGGGGAGGG - Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121013840 14:90536490-90536512 AGGTTGGGGAGGAGAGGAGAAGG - Exonic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121632606 14:95432124-95432146 TTTTAGGGAAGGAGAGGAAAAGG + Intronic
1122014001 14:98777887-98777909 TTGTGGGGAATGTGGGGAGAGGG + Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122235816 14:100330154-100330176 CTGTGGGGAAGAAGCCGAGCCGG - Exonic
1122422004 14:101583676-101583698 TAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1122426352 14:101608151-101608173 AGGTGGAGGAGGAGAGGAGAAGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122679933 14:103451895-103451917 CTGCGGGAGAGGAGAGGACACGG - Intronic
1122758042 14:103997959-103997981 CTGTAGGGGAGCAGAGGAAATGG + Intronic
1122774669 14:104111897-104111919 CTATGGGGAAGCAGTGGGGAGGG - Intronic
1122783442 14:104153410-104153432 CTGTGGTGAGGCCGAGGAGAGGG + Intronic
1122826282 14:104372382-104372404 CTGTTGGCAAGGATAGGAGGGGG + Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1123067832 14:105627198-105627220 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123071850 14:105645923-105645945 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123072642 14:105649219-105649241 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123091514 14:105744199-105744221 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123092668 14:105748745-105748767 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123097282 14:105772540-105772562 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123098228 14:105776446-105776468 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123670107 15:22647893-22647915 CTGGGGGGAAGGAGAGCATCAGG + Intergenic
1123683523 15:22781243-22781265 CTGTCAAGCAGGAGAGGAGATGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124652998 15:31486646-31486668 CTGGCAGGAAGGTGAGGAGAGGG - Intronic
1124807831 15:32904314-32904336 CTGTGGGGGAAGTGAGTAGAAGG + Intronic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125584232 15:40808987-40809009 CTGGGAGGAAGAAGAGGAGTGGG - Intronic
1125676443 15:41504740-41504762 CAGTGGGGAAGGGGAGGGGAAGG + Intronic
1125712268 15:41796565-41796587 CTCTGTGGAAGGGGAGGAGCAGG - Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126074848 15:44899251-44899273 CACTAAGGAAGGAGAGGAGAAGG - Intergenic
1126083516 15:44988564-44988586 CACTAAGGAAGGAGAGGAGAAGG + Intergenic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1126757377 15:51937663-51937685 TTGTGGGGAATGAGAGGAAGGGG + Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127272984 15:57417828-57417850 CTGCTGTGAAGGAGAGGTGATGG + Intronic
1127334314 15:57968451-57968473 CTGGGAGGAAGGAAGGGAGAAGG - Intronic
1127337727 15:58006172-58006194 CTTTGGGGAAGGATGGGAGTGGG - Intronic
1127368135 15:58310358-58310380 CTGTGTGGAGTGAGAGGAGGAGG + Intronic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127551688 15:60044782-60044804 TTGTGGGTGAGGAGAGGAGGTGG - Intronic
1127921468 15:63497785-63497807 GTATGGGGAAGGAGTGGGGAAGG - Intergenic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128155455 15:65388979-65389001 CTGGGGTGCGGGAGAGGAGATGG + Intronic
1128432421 15:67609916-67609938 CTCTGGGGAAGGTGTAGAGATGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128578420 15:68791745-68791767 CAGAGGGGAAGGAGGGGACAGGG + Intronic
1128665506 15:69535101-69535123 TTGTGGGGAGGGGGATGAGATGG + Intergenic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1128804779 15:70522464-70522486 CTGCGGGCAGGGAGAGGATAAGG + Intergenic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129296392 15:74602532-74602554 GTGTGGGGAAGGAAAGGTCAAGG + Intronic
1129491327 15:75928593-75928615 GTGTGAGGAAGGAGAGGATCAGG + Intronic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129534429 15:76300531-76300553 CTGTGGGGTAATAGAGGAGAAGG - Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129820986 15:78601864-78601886 CAGTGAGGAAGGAGATGAGCAGG + Exonic
1130088096 15:80795395-80795417 CAGTGGGGAAGGAGAAGTGTGGG + Intronic
1130165349 15:81451247-81451269 CTCTGTGGAAGGAGAGAAGCAGG + Intergenic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130877582 15:88028015-88028037 GGGTGTGGAAGGAAAGGAGAGGG + Intronic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1130915330 15:88300241-88300263 TTATGGGGCAGGGGAGGAGATGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131031153 15:89186933-89186955 GTGTCTGGAAGGAGAGCAGAGGG + Intronic
1131177454 15:90219085-90219107 CCATGGGGAAGGACAGGAGGAGG + Intronic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131833640 15:96369592-96369614 ATGTGGGGAGGGGAAGGAGAAGG + Intergenic
1132237372 15:100232327-100232349 TTGAGGGGAAGGAGAGGAGTTGG - Intronic
1132397560 15:101485746-101485768 CTCTGGGAAAGAAGAGGAGGAGG - Intronic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132922003 16:2400773-2400795 CCGTGGGGAGGGGGAGGAGGAGG + Intergenic
1133038165 16:3046213-3046235 CTGGGGGGAAGGAGAGGGGCGGG + Intergenic
1133048443 16:3102375-3102397 CTGCAGGGAAGAAGGGGAGATGG + Intergenic
1133272897 16:4619330-4619352 CTAGTGGGAGGGAGAGGAGAAGG + Intronic
1133376785 16:5293745-5293767 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133460719 16:5984106-5984128 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1133460730 16:5984132-5984154 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1133460753 16:5984181-5984203 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1134070422 16:11256606-11256628 CTGCAGGGGAGGAGAGGACAGGG - Intronic
1134197841 16:12172502-12172524 GTGAGGTGAAGGAGAGGTGAAGG - Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134790488 16:16985145-16985167 GGATGGGGAAGGAGAGGGGAAGG - Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135204255 16:20469404-20469426 AAGTGGGGAAGGAGAGGATGAGG - Intronic
1135214746 16:20555562-20555584 AAGTGGGGAAGGAGAGGATGGGG + Intronic
1135509336 16:23068766-23068788 CTGTGGCGAAGGAGATGACACGG + Exonic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135557066 16:23446112-23446134 ATATGGGGCAGGAGAGGAGATGG + Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136155010 16:28376714-28376736 CTGTGGGGAGGGAGAGGGAGAGG - Intergenic
1136208082 16:28738548-28738570 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136403916 16:30032352-30032374 CTTTGGGGGAGGCGAGGAGTGGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1137017613 16:35393180-35393202 CTTGGGGGAAGCAGAGGAAATGG - Intergenic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137476172 16:48811478-48811500 GAGAGGGGAAGGAAAGGAGAGGG - Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137712547 16:50576329-50576351 ATCTGGAGGAGGAGAGGAGAGGG - Intronic
1137734483 16:50713739-50713761 CTGGGGGGAAGGTATGGAGACGG + Intronic
1138328431 16:56193362-56193384 GGGTGGGGGAGGAGAGGAGCTGG - Intronic
1138535153 16:57656042-57656064 CTGGAGGGAGGGAGAGGAAAGGG - Intronic
1138618083 16:58188036-58188058 GGGTGGGGAAGGGGAGGGGAGGG + Intronic
1138667719 16:58586307-58586329 GGGAGGGGAAGGGGAGGAGAGGG + Intronic
1138921504 16:61535647-61535669 GGGAGGGGGAGGAGAGGAGAGGG + Intergenic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1139251710 16:65502778-65502800 CCCTGGGGAGGGACAGGAGATGG - Intergenic
1139312744 16:66041020-66041042 CTTTGTGGAAGGAGAAGAGAAGG - Intergenic
1139334232 16:66219884-66219906 CTGTGTGGCAGGGGAGGACAGGG + Intergenic
1139349719 16:66327477-66327499 CTGCGGGGAGGGAGAGGAACGGG + Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139594041 16:67947944-67947966 CTGTGGGGAGGGAGATTATAGGG - Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140128810 16:72139530-72139552 CTGTGGGGTAGGTAGGGAGAAGG + Intronic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1141039204 16:80656801-80656823 CAGTGGGGTGGGAGAGGGGAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141492840 16:84386459-84386481 TTGTTGGCAAGGTGAGGAGATGG - Intronic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141660428 16:85438354-85438376 CTCTGGGGAGGGACAGGAGGCGG + Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141938164 16:87255649-87255671 CAGAGAGGAAGGAGAGGACAGGG + Intronic
1142006578 16:87692212-87692234 CTGTGGGGAGGGAGACGGGGAGG - Intronic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142158972 16:88547312-88547334 GGGTGGGGAAGGCGAGGAGAGGG + Intergenic
1142201167 16:88761771-88761793 CTGTGGGGAAGGACAGGCCCTGG - Intronic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143504156 17:7354787-7354809 CAGTGGGGGAGGAGATGGGAAGG + Exonic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1143638864 17:8183864-8183886 CTGTCTGGAAGAAGAGGAGGAGG - Intergenic
1143704489 17:8687430-8687452 GGGAGGGGGAGGAGAGGAGAGGG - Intergenic
1144107409 17:11998096-11998118 GTGTGGGAAAGGGAAGGAGAAGG - Intergenic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144877719 17:18411124-18411146 GGGTCGGGAAGGAGAGGGGAGGG - Intergenic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145154502 17:20533264-20533286 GGGTCGGGAAGGAGAGGGGAGGG + Intergenic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145994350 17:29096961-29096983 AGGTGGAGAAGGTGAGGAGAGGG + Intronic
1146002685 17:29140559-29140581 GTGTGTGGAAGGGAAGGAGAAGG + Intronic
1146367090 17:32237607-32237629 CTGGGTGGTAGGAGTGGAGATGG - Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146570331 17:33946907-33946929 TTGGGGTGAAGGGGAGGAGATGG + Intronic
1146695246 17:34903926-34903948 GTGGGGTGAAGGAGAGAAGATGG + Intergenic
1146733501 17:35216162-35216184 CAGTGGGGAAGGAGAGGCTTGGG - Intergenic
1146827237 17:36033423-36033445 TGGTGGGGAAGGGAAGGAGAAGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147748091 17:42708269-42708291 TTGTGGGGAGGGTGTGGAGATGG + Intronic
1147758295 17:42782201-42782223 GTGAGGGGAGGGAGAGGAGCCGG + Intronic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148046691 17:44749052-44749074 CTGTGGGGCAGCTGAGGAGCTGG - Intronic
1148051587 17:44772376-44772398 CTGTGGGGAGGGGCAGGTGAGGG - Intronic
1148147356 17:45374129-45374151 CTGCAGGGAAAGAGAGGAGAGGG - Intergenic
1148197849 17:45727611-45727633 ATGTGGGGAAAGTGTGGAGAAGG - Intergenic
1148693121 17:49544478-49544500 CTGGAGGGGAGAAGAGGAGATGG + Intergenic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148953952 17:51337936-51337958 CTTGAGGGAGGGAGAGGAGAAGG + Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1149598222 17:57876360-57876382 ATGTGGAGAAGCAGAGGACAGGG - Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150120728 17:62599540-62599562 TTGCGGGGAGGGAGAGGAGGTGG - Intronic
1150247764 17:63689135-63689157 CTGTGGGGCAGAAGAGGACATGG - Intronic
1150463447 17:65371960-65371982 CAGGGAGGAAGGGGAGGAGAGGG - Intergenic
1150494698 17:65598244-65598266 CTGTTGGTCAGGAGAGGATAGGG + Intronic
1150662315 17:67093720-67093742 CTGTGGGGTAGCAGTGGAAATGG - Intronic
1150716046 17:67573367-67573389 CTGTAGGGAAGGAGTGGAGGAGG + Intronic
1150896982 17:69223042-69223064 ATGAGGGGTAGGGGAGGAGAGGG + Intronic
1150964168 17:69948443-69948465 GGGAGGGGAAGGGGAGGAGAAGG + Intergenic
1151338656 17:73455869-73455891 CTGAGGGGACGGGGAGGGGAGGG - Intronic
1151529909 17:74697555-74697577 CTGTGGGGAGGGAGAAGTGTTGG + Intronic
1152007311 17:77690818-77690840 CTGCCGGGAAGGAGAGGAGCAGG - Intergenic
1152037003 17:77879737-77879759 GGGCGGGGAAGGAGAGGTGATGG - Intergenic
1152233690 17:79127395-79127417 CGGTGAGGGAGGAGAGGAGGTGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152361138 17:79833716-79833738 CAGCGGGGAAGGGCAGGAGAGGG + Exonic
1152519514 17:80846986-80847008 CTCTTGGGAAGGACAGGAGATGG + Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152626887 17:81391910-81391932 CAGAGGGGGAGGAAAGGAGAGGG - Intergenic
1152643899 17:81460178-81460200 CGGTGGGGAGGGTGAGGGGAGGG - Intronic
1152879665 17:82807959-82807981 CTGTGGGGAACGATAGGTGGGGG - Intronic
1153301198 18:3593582-3593604 GTGTGTGTAAGGGGAGGAGAGGG + Intronic
1153899569 18:9604746-9604768 TGTTGGGGAGGGAGAGGAGAAGG - Intronic
1153934031 18:9904895-9904917 CTGCAGGGAAGGAGAGGGGTAGG - Intergenic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1154080108 18:11248078-11248100 GTGTGGGGAGCGTGAGGAGAGGG - Intergenic
1154194162 18:12253965-12253987 GGGTGGGGCAGGTGAGGAGACGG - Intergenic
1154316093 18:13304301-13304323 GCGTGGGGAAGGGGAGGAGGAGG + Intronic
1154354162 18:13612072-13612094 CAGTGTGGAAGGACCGGAGAGGG - Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1155412725 18:25564075-25564097 CCTTCTGGAAGGAGAGGAGAGGG - Intergenic
1155493931 18:26424703-26424725 ATTTGGAGAAGGAGAGGACATGG - Intergenic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156193574 18:34747500-34747522 CTTTGGGGACTCAGAGGAGAAGG - Intronic
1156368815 18:36454184-36454206 TTGCTGGGAAGGAAAGGAGATGG + Intronic
1156386064 18:36606364-36606386 TTGTAGGGGAAGAGAGGAGAAGG + Intronic
1156440638 18:37183941-37183963 TTGTGGGGCAGGAGAGGAAGGGG - Intronic
1156450280 18:37262788-37262810 CTGTGGGGAAGGCAAGGGCAAGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156888179 18:42159559-42159581 CTGTGGGGAAAGAAAGCTGAAGG + Intergenic
1157105843 18:44773490-44773512 CTGTTGTGAAGAAGAGGGGAGGG - Intronic
1157166965 18:45366575-45366597 CTGGGTGATAGGAGAGGAGAAGG - Intronic
1157304000 18:46503319-46503341 GTGTGGGGAAGGTAAGGACAAGG - Intronic
1157428133 18:47601585-47601607 ATGCTGGGAGGGAGAGGAGATGG - Intergenic
1157479393 18:48043903-48043925 CTGTAAGGGAGGAGAGGAGGGGG + Intronic
1157680130 18:49598559-49598581 AAGAGGAGAAGGAGAGGAGAAGG - Exonic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1158110117 18:53931438-53931460 GTGTGAGGAAGGAGAGGATCAGG + Intergenic
1158224307 18:55184630-55184652 CTTGGGGGAAGAAGAGGAGCTGG + Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158830873 18:61277306-61277328 GTGAGGGGAAGTAGAGCAGAGGG + Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159022616 18:63155809-63155831 CTCTGGAGAAAGAAAGGAGAGGG - Intronic
1159194208 18:65090837-65090859 GAGTGGGGAAGGAGAAGGGAGGG - Intergenic
1159946202 18:74446532-74446554 CTGGAGGGAAGGAAATGAGAAGG - Intronic
1159995426 18:74960190-74960212 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995435 18:74960226-74960248 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995472 18:74960406-74960428 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995509 18:74960586-74960608 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995516 18:74960622-74960644 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995524 18:74960658-74960680 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995532 18:74960694-74960716 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995541 18:74960730-74960752 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995570 18:74960874-74960896 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995595 18:74960982-74961004 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995604 18:74961018-74961040 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995613 18:74961054-74961076 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995622 18:74961090-74961112 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1160161277 18:76472957-76472979 ATGTGGGGAGAGGGAGGAGATGG + Intronic
1160181005 18:76636180-76636202 GTGTATCGAAGGAGAGGAGAGGG + Intergenic
1160451683 18:78970733-78970755 AGGTGGGGAAGGAGAGGAGCAGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160709344 19:543988-544010 CTGTGGGGGAGGTGAGGTGACGG - Intergenic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160778336 19:866831-866853 GTGGGCGGACGGAGAGGAGATGG - Intergenic
1160778351 19:866882-866904 GTGGGTGGACGGAGAGGAGATGG - Intergenic
1160778366 19:866933-866955 GTGGGTGGACGGAGAGGAGATGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160856215 19:1219111-1219133 CTACGGGGAAGGGGAGGACAGGG - Intronic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161625556 19:5324538-5324560 CAATGGAGGAGGAGAGGAGAAGG + Intronic
1161643169 19:5436678-5436700 AAGGGGGGAAGGGGAGGAGAGGG - Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162001195 19:7746284-7746306 CTCTAGGGCAGGACAGGAGAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1162553149 19:11369571-11369593 CGGTGGGGAAGTTGAGGAGATGG + Intergenic
1162744561 19:12791358-12791380 GCGTGGGGAAGGGGAGGAGGCGG - Intronic
1163255716 19:16154529-16154551 CTGAGGGGCAGGAGTGGAGGTGG + Intronic
1163428379 19:17251705-17251727 CTGTTGCGAAGGAGAAGAGAGGG + Intronic
1163611256 19:18302953-18302975 CTGTGGGGAAGGGGCAGAGGGGG - Intergenic
1163717704 19:18881547-18881569 CTCTGTGGAAGGACAGGGGATGG - Intronic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1164249793 19:23466674-23466696 GAGAGGGGAAGGAGAAGAGAAGG - Intergenic
1164452956 19:28382417-28382439 GTGTGGGGAAGGAAGGGAGGTGG - Intergenic
1164618113 19:29678602-29678624 CTGTGGCGAAGCAGGAGAGACGG - Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165186579 19:34027556-34027578 CAGATGGGAAAGAGAGGAGACGG + Intergenic
1165307912 19:35013518-35013540 CTGTGGGAAAGGGGAGGAAGCGG - Intronic
1165327194 19:35121045-35121067 AAGAGGGGAAGGAGGGGAGATGG - Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165404118 19:35619590-35619612 CTGTGGGGAAGGGGAGGGGTGGG - Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1165871551 19:38976326-38976348 CTGGGGGGATGGGGAGGACAGGG - Intergenic
1165993448 19:39828584-39828606 CTGCGGGGGAGGGGAGGAAATGG + Intronic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166302743 19:41921637-41921659 TTGGGAGGAAGGAGAGAAGAGGG + Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166794582 19:45418930-45418952 ATGTTGGCAAGGAGAGGGGAGGG - Intronic
1166881656 19:45933915-45933937 ATGTGGGGAGTGGGAGGAGACGG + Exonic
1166960308 19:46492968-46492990 CGGTTGGGAAGGGGAGGAGGAGG - Exonic
1167147881 19:47693933-47693955 CTGTGGGGAATGAGAGGCGAGGG + Intronic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167391203 19:49196417-49196439 CTGTGGGGGAAGAGAAGAGAAGG - Intronic
1167565669 19:50255124-50255146 AAGAGGGGAAGGAGAGGAGGTGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167735282 19:51290782-51290804 ATGTGGTGAAAGGGAGGAGATGG - Intergenic
1167782512 19:51608302-51608324 CTTTTGGGAAGGAGAGGCCAGGG + Intergenic
1167831811 19:52028969-52028991 CAGTGGGGAAGGGGATGAGGAGG + Intronic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168243079 19:55096863-55096885 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243087 19:55096893-55096915 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243123 19:55097049-55097071 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243189 19:55097345-55097367 CTGCGGGGAAGGGGCGAAGACGG - Intronic
1168243203 19:55097402-55097424 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243255 19:55097631-55097653 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
1168602118 19:57726552-57726574 CTCTGGGGTAAGAGATGAGAAGG - Intronic
1202697509 1_KI270712v1_random:135784-135806 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
925462554 2:4075854-4075876 GGGAAGGGAAGGAGAGGAGAAGG - Intergenic
925464685 2:4096313-4096335 CTCTGGGGAAGGCGAGGATATGG + Intergenic
925811701 2:7707787-7707809 TTGAGGAGAAGGAGAGTAGAGGG - Intergenic
925907271 2:8547001-8547023 CTGTGAGGGAAGAGAGGTGAAGG - Intergenic
926124343 2:10262738-10262760 GTGTGTCCAAGGAGAGGAGATGG + Intergenic
926207586 2:10845237-10845259 CTGTGGGGAAGAAGTTGATACGG - Intergenic
926704526 2:15827249-15827271 CTGGAGGCAAGGAGAGGAGCTGG - Intergenic
926771982 2:16386517-16386539 CTGTGGGGAAGCAAAGGTCACGG - Intergenic
926867498 2:17375884-17375906 CATTGGGGAAGGGGAGGGGAGGG - Intergenic
927043954 2:19258176-19258198 CGGTGGGGAAGGTGAGGAGTGGG + Intergenic
927234544 2:20858532-20858554 CTATGGAGAAGAAGAGGAGGAGG + Intergenic
927345492 2:22033880-22033902 ATGTGGGTAAAGAGAGGAGGGGG - Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927810830 2:26179469-26179491 CTGTGGGGCAGGCATGGAGAAGG + Intronic
927897407 2:26792725-26792747 GAGTGGGGAAGGGGAGGAGTAGG - Intronic
928134749 2:28679870-28679892 CTGTGGGGAAGGAGTCTACAGGG - Intergenic
928137755 2:28701164-28701186 ATGTGGGGGAGGAAAAGAGAAGG - Intergenic
928270350 2:29849765-29849787 CTCTGAGGAAGAAGAGGAGTGGG + Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
928624701 2:33127811-33127833 ATGTGGGGAAGAAGAGGAAAAGG + Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929433346 2:41907384-41907406 CTGTGGAGCAGGACATGAGATGG + Intergenic
929451073 2:42037774-42037796 ATGTGGGGAAGGGAATGAGAGGG + Intergenic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929931879 2:46263619-46263641 CTGTTGGGGAAGGGAGGAGATGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930101396 2:47606188-47606210 GTGTGGGGAGGGACAGGACAGGG - Intergenic
930407363 2:50975917-50975939 CTGTTAGGAAGGCAAGGAGAAGG + Intronic
930826329 2:55700300-55700322 CTGAGGGGAGGGGGAGGGGAGGG - Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931271900 2:60710993-60711015 CTGCAGGAAAGGAGAAGAGAAGG - Intergenic
931350461 2:61483360-61483382 TTGTGGGGAAGGGCAGGAGTGGG + Intronic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932377752 2:71253082-71253104 GTATAGGTAAGGAGAGGAGAGGG + Intergenic
932433303 2:71688064-71688086 TTCTGGAGAAGGAGAGGAGGGGG + Intergenic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933048026 2:77563658-77563680 GTGGGAGGAAGGAGAGGATAAGG + Intronic
933209090 2:79545287-79545309 GAGTGGGGAAGGAGAAGTGAAGG - Intronic
933764368 2:85696958-85696980 GTTTGGGGCAGCAGAGGAGAGGG - Intronic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
933852991 2:86385752-86385774 ATGTGGGGAGGGAAAGGAGGAGG + Intergenic
934278682 2:91592808-91592830 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
934560673 2:95311726-95311748 CTGTGGGGAAGCAGAGGTGGTGG - Intronic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934564807 2:95332537-95332559 GTGAGGGGACGGAGAGGAGGAGG + Intronic
934579614 2:95427701-95427723 GGGTGGGGTAGCAGAGGAGAAGG - Intergenic
934599831 2:95649024-95649046 GGGTGGGGTAGCAGAGGAGAAGG + Intergenic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
935888765 2:107652711-107652733 CTGGGGGGAAGGAAAGGATCAGG - Intergenic
936165066 2:110114169-110114191 CTGGGGGGAAAGAGAGGGAAAGG - Intronic
936533176 2:113291029-113291051 GGGTGGGGTAGCAGAGGAGAAGG + Intergenic
936605863 2:113952882-113952904 ATGTGGGTAAGGGGAGTAGACGG - Intronic
936606240 2:113957988-113958010 TTGGGGGGAAGGGGTGGAGAGGG - Exonic
936722312 2:115267574-115267596 AGGTAGGCAAGGAGAGGAGAGGG - Intronic
936980029 2:118255680-118255702 CTGGGGGGAGTGAGAGGAGGAGG - Intergenic
936981463 2:118269105-118269127 CTGTGGGGTAGGGGAAGGGAAGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937791481 2:125967315-125967337 CTCTGGTTAATGAGAGGAGATGG - Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
937907464 2:127059156-127059178 CTGTGGGGGAGGACAAGAAAGGG + Intronic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
938464069 2:131515491-131515513 CTGTGGGGAAGCAGAGCAACTGG + Intergenic
938701784 2:133886017-133886039 CTGGGAGGAAGGAAAGGAAAGGG - Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938750222 2:134321117-134321139 CTCTGGAGAAGGAAATGAGAAGG - Intronic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939671804 2:145022174-145022196 GTGGGGGGAAGGAGAGGAAGAGG - Intergenic
939799998 2:146696910-146696932 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
940890547 2:159031305-159031327 CTGTGGGGAAGGAAGGGCCATGG + Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941581567 2:167303310-167303332 ATATGGGGAAGGATACGAGAGGG - Intergenic
941721506 2:168817587-168817609 GTGTGGGGTAGGGGAGGACAGGG - Intronic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
942568210 2:177287658-177287680 CTGTGATGAAGTAGAGCAGAGGG - Intronic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942976141 2:182020664-182020686 CAGTGGGGAAAGAGAGGATCAGG - Intronic
943498286 2:188652367-188652389 CTGTAGGGAAAGGGTGGAGAAGG + Intergenic
944154975 2:196598441-196598463 GGGAGGGGAAGGGGAGGAGAAGG + Intergenic
944353489 2:198758042-198758064 CTGTGGGGAAGGAGTAGACTAGG - Intergenic
945176010 2:207044183-207044205 CTGGTTGGAAGGGGAGGAGAGGG - Intergenic
945435193 2:209809975-209809997 CTTCGGGGAAGGAGTGGGGAGGG - Intronic
945437771 2:209839199-209839221 CTGTAGGCAAGCAGAGGATAGGG - Intronic
945453135 2:210016732-210016754 CTGTTCTGAAGGTGAGGAGATGG + Intronic
945512858 2:210724163-210724185 CTGCAGGGAAGGTGGGGAGAAGG + Intergenic
945610667 2:211997672-211997694 CAGAGGGGAAGAAGGGGAGAGGG - Intronic
945679582 2:212897887-212897909 CTCTGGGGAAGGATAGGAGGAGG + Intergenic
945869862 2:215215316-215215338 ATGTGGGGTGGGAGAGGAAAGGG + Intergenic
945955904 2:216085533-216085555 CAGAGGGGAAGCAGTGGAGATGG + Intronic
946043521 2:216802810-216802832 GAGTGGGGAAGGAGAGGAGGAGG + Intergenic
946170905 2:217894968-217894990 TTTTGGGGTAGGGGAGGAGAAGG - Intronic
946201022 2:218070866-218070888 GGATGGGGAAGGGGAGGAGAAGG - Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946673071 2:222127386-222127408 CTGCCAGGAAGGAGAAGAGATGG + Intergenic
946800668 2:223412992-223413014 CTCTTGGGAAGGAGAAGGGAAGG + Intergenic
946809528 2:223508936-223508958 TTCTGGGGAAGGAGAAGTGATGG - Intergenic
947009189 2:225547089-225547111 TTGTGTGGGAGGGGAGGAGAGGG - Intronic
947106684 2:226675074-226675096 GTGTGGGGAGGGAGAGGATCAGG + Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
947398365 2:229708432-229708454 ATGTGGGGAAGCAGAGGAAGGGG + Intronic
947702091 2:232242984-232243006 CCCTGGGGAAGCAGAGGAGGTGG + Intronic
947740159 2:232481252-232481274 CTCTGGGCAAGGGAAGGAGAGGG - Intronic
947963918 2:234262866-234262888 CTGGGGGCAAGGAGTGGAGGCGG + Intergenic
948179182 2:235966286-235966308 CTCTGGGGATGGAGAAGAGGGGG + Intronic
948664367 2:239525911-239525933 CTGAGAGGAGGGAGAGGAGCAGG - Intergenic
948674388 2:239588545-239588567 ATGTGGGGACAGAGAGGAGTGGG - Intergenic
948788477 2:240365230-240365252 ATGTGGGGAAGCAGAGGTGCCGG - Intergenic
948796100 2:240402728-240402750 GTGGTGGGAAGGAGAGGTGAAGG - Intergenic
948871924 2:240805043-240805065 AAGTGGGGAGGGAGAGGGGAGGG + Intronic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1168878046 20:1184941-1184963 CTGTGGGCAAGGGCAGGAGCAGG - Intronic
1168989921 20:2086336-2086358 CTTTGGGGACGGACAGGAGTCGG - Intergenic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169137383 20:3205339-3205361 TTGAGGGGAAGGGGAGGGGAGGG + Intergenic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169664956 20:8023153-8023175 CTGTGGGGCAGGGAAAGAGAGGG - Intergenic
1169878643 20:10323932-10323954 GTGTGGGGTAGGGCAGGAGAGGG + Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170441906 20:16387653-16387675 ATGTCTGGAAGGGGAGGAGAAGG + Intronic
1170764558 20:19279146-19279168 CACTGTGGAAGTAGAGGAGAGGG + Intronic
1170792806 20:19521600-19521622 GTCTGGGGGAGGAGAGGAGGAGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171027439 20:21643782-21643804 CTGAGGGGAAAGAAAGGAGAAGG + Intergenic
1171276078 20:23857574-23857596 CTGGGGAGAAGCACAGGAGAAGG + Intergenic
1171389196 20:24790264-24790286 GTGAGGGGGAGGAGAGGAGGAGG + Intergenic
1171958321 20:31475977-31475999 CGGTGGGGAAGGGGAGGAGGGGG + Intronic
1172423934 20:34842276-34842298 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1172429385 20:34876909-34876931 CTGAGGGGTGGGTGAGGAGATGG + Intronic
1172443726 20:34982353-34982375 CTGGGGGGAAGGAGAGGTGGAGG + Intronic
1172472201 20:35207862-35207884 TTTTGTGGAAGGAGAGGAAATGG - Intergenic
1172589255 20:36105930-36105952 CTGGGGAGGAGGGGAGGAGAGGG - Intronic
1172773489 20:37394688-37394710 CTCAGGGGAGGGACAGGAGAGGG - Intronic
1172808877 20:37633120-37633142 AGATGAGGAAGGAGAGGAGATGG + Intergenic
1172854476 20:37991390-37991412 GTGTGGGTAAAGAGAGGAGTTGG + Intronic
1172895946 20:38300077-38300099 CTGAGGGGAGGGAGAGTACAGGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173250219 20:41360436-41360458 CTTAGGGGAAGGAAAGGAAAAGG + Exonic
1173754420 20:45502901-45502923 CAGGGAAGAAGGAGAGGAGAGGG + Intergenic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1173808190 20:45939702-45939724 CTCTGGGGAAGGCAAGGAGATGG + Intronic
1173854724 20:46242676-46242698 TTGGGGCGAGGGAGAGGAGAGGG + Intronic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174387848 20:50197834-50197856 GAGTGGGGAAGAAGAGGACAGGG + Intergenic
1174400905 20:50275288-50275310 CTTTGGGGAAACAGAGGAGGAGG - Intergenic
1174723576 20:52838872-52838894 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1174749999 20:53102443-53102465 AGGTGGGGGAAGAGAGGAGAGGG + Intronic
1174753125 20:53131960-53131982 GAGTGGTGAAGGAGAGTAGAGGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175291955 20:57881897-57881919 CTGTGGGGAGGGATAGCGGAGGG - Intergenic
1175531460 20:59676150-59676172 TGGTAGGGAAGGAGAAGAGAGGG + Intronic
1175644048 20:60656535-60656557 CTGTGGGCAGGCAGATGAGAGGG + Intergenic
1175658432 20:60792100-60792122 CAGGAGGGGAGGAGAGGAGAAGG - Intergenic
1175774995 20:61647579-61647601 TTGTGAGGAGAGAGAGGAGAGGG - Intronic
1175792165 20:61746525-61746547 GTGTGGGGAAGGAGTGGAAAAGG + Intronic
1176093944 20:63331021-63331043 CAGTGGGGAAGGGGAGGGGCTGG + Intronic
1176125448 20:63472790-63472812 GAGGGGGGAAGGAGAGGAGAGGG + Intergenic
1176128001 20:63484501-63484523 CAGTGGGGAAGGCGAGGGGTGGG - Intergenic
1176169334 20:63689924-63689946 ATGTGGGGAAGGAGAGTCCAGGG - Intronic
1176249927 20:64115774-64115796 CAGTGGGGAAGGGCAGGAGCTGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176603411 21:8812160-8812182 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1178553973 21:33569765-33569787 CTGTGGTGAAGGGGATGGGATGG + Intronic
1179029677 21:37709849-37709871 CTGTGGTGAAGGATGGGTGATGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180131672 21:45830661-45830683 CAGTGGGGAAGGGGTGGAAAGGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180345695 22:11703718-11703740 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1180855412 22:19041960-19041982 CTGAGGGGGAGGGGAGGAAATGG + Intronic
1180956342 22:19743065-19743087 TTGGGGGCGAGGAGAGGAGAGGG + Intergenic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181149857 22:20875477-20875499 CAGTGGGGACCCAGAGGAGAGGG + Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181477604 22:23178550-23178572 CTGATGGGAAGGGGATGAGAAGG + Intergenic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181565732 22:23736144-23736166 CTGTGGGGGAAGACAGGAGAGGG - Intergenic
1181717573 22:24743663-24743685 CTGCGGGGAAGGATGGGAGGGGG + Intronic
1181919249 22:26307314-26307336 CTGAGGGGTAGGAGAGGGTAGGG + Intronic
1182011650 22:27006297-27006319 CTGTGAGCAAGGACAGCAGAGGG - Intergenic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1182280832 22:29216981-29217003 CTGGTGGGAGGGAGAGGGGAAGG + Intronic
1182333716 22:29569288-29569310 CTGTGGGGGAGGTGCAGAGAGGG + Intronic
1182916505 22:34037672-34037694 CTGAGGGGACAGAGAAGAGATGG + Intergenic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183108341 22:35630314-35630336 CGGAGGGGAAGGAGAAGAGGAGG + Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183967657 22:41452291-41452313 CTGCGTGGAAGGAGAGGCAAAGG + Intergenic
1184080288 22:42214553-42214575 CTGTGGTGAAGGGAAGGAGGAGG + Exonic
1184084949 22:42255749-42255771 GTGGTGGGAAGGAGAGGGGAGGG - Intronic
1184119513 22:42440998-42441020 CAGTGGGGAAACAGAGTAGAGGG - Intergenic
1184142077 22:42583786-42583808 CTGTGCAGAAGGAGAGGAAGGGG - Exonic
1184147010 22:42617690-42617712 GAGTGGGGAAGAAGAGGGGACGG - Intergenic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184257919 22:43297472-43297494 CTGTGAGGACCGAGTGGAGATGG - Intronic
1184313132 22:43661605-43661627 CTGTGAGGAGGGGAAGGAGAAGG - Intronic
1184345536 22:43910405-43910427 CAGTCTGGAAGCAGAGGAGAGGG - Intergenic
1184386866 22:44181571-44181593 GTTTGGGGAAGGCGGGGAGAGGG + Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
1185118754 22:48953051-48953073 CTGAGCAGAAGGGGAGGAGAAGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949475514 3:4441464-4441486 ATGTGGGGCAGGGGAGGGGATGG - Intronic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949756040 3:7411971-7411993 ATGTTGGGAAGGGGAGGGGAGGG - Intronic
949773717 3:7607866-7607888 GTGAGAGGAAGGAGAGGAGCAGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950145544 3:10647240-10647262 CAATAAGGAAGGAGAGGAGATGG + Intronic
950154235 3:10709649-10709671 AGGTGGGGAAGGAGTGGAAAGGG - Intergenic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950334668 3:12183835-12183857 CTTGGGGGGAGGAGAGGAGTTGG - Intronic
950451363 3:13067523-13067545 CAGTGGGGAAGGGGTGGGGAGGG + Intronic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
950712909 3:14826289-14826311 AAGAGGGGAAGAAGAGGAGAGGG - Intronic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951543474 3:23805552-23805574 CTTTTGGAAAGGAGAGGAGTAGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952160112 3:30684868-30684890 CCATGGGGAATGAGAGAAGATGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952537113 3:34322681-34322703 CTGTGGAGCAGGAAAAGAGAGGG + Intergenic
952686050 3:36149415-36149437 GAGTGGGGAAGGAGAGGAAGGGG + Intergenic
952900349 3:38108215-38108237 GGGTTGGGGAGGAGAGGAGAAGG + Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953374280 3:42415691-42415713 TTGTGGGGAGGAAGAAGAGAAGG + Intergenic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953604356 3:44401144-44401166 CTCTGGTGGGGGAGAGGAGAGGG + Intronic
953756190 3:45647817-45647839 CTGTGGGGCAGCGGAGGAGGGGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954222448 3:49163033-49163055 CTGTTGGGCAGAAGAGGAAAAGG - Exonic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954419771 3:50412613-50412635 GGGTGGGGAGGGAGAGGATAGGG + Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954934683 3:54315541-54315563 TTGTGGGGAAGGGGAGTAGAGGG - Intronic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955340230 3:58119740-58119762 CTAGGGAGAAGGAGAGGTGAGGG - Intronic
955353341 3:58210030-58210052 GAGTGGGGAAGTAGAGGAGAGGG + Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956483316 3:69694897-69694919 GTGGGGTGAAGGAGAAGAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956675848 3:71731146-71731168 CTGTCTGGCAGGAGATGAGAGGG - Intronic
956952833 3:74301971-74301993 ATGCGGGGAGGGAGAGTAGAGGG - Intronic
957181732 3:76887522-76887544 ATGTGGGGAAGGGCAGGAGCGGG + Intronic
957336739 3:78839829-78839851 CTGAGAGGCAGCAGAGGAGATGG - Intronic
957494441 3:80972888-80972910 GTGGGAGGAAGGAGAGGATAAGG + Intergenic
957521576 3:81325220-81325242 TTGTCAGGAGGGAGAGGAGAGGG + Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
957670272 3:83292240-83292262 TTGTGGGGTAGGAGAGGGGAGGG + Intergenic
957940212 3:86993636-86993658 GTGTGGGGACTGTGAGGAGAAGG - Intergenic
959084100 3:101833345-101833367 GGGTGTGGAAGGGGAGGAGAAGG - Intronic
959318341 3:104838140-104838162 GTGGGAGGAAGGAGAGGATAAGG + Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959478714 3:106845056-106845078 ATTTGGGGAAGGGAAGGAGATGG + Intergenic
959537759 3:107506154-107506176 CTGAGGAGAAGAAGAGGATAGGG - Intergenic
959721329 3:109492951-109492973 CAGTGGAGAAGTAGATGAGATGG + Intergenic
959787378 3:110316767-110316789 CTGAGGGGGAGGGGAGGGGAGGG + Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960418347 3:117412755-117412777 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
960663256 3:120083966-120083988 CTGTGGGGAAGGGGAACATAGGG + Intronic
960835027 3:121897064-121897086 TTGCTGGGAAGGAGAGGAGAGGG + Intronic
960915858 3:122694179-122694201 CTGTGGGAAATGGGAGGAAAGGG + Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
961248872 3:125482378-125482400 ATGAGGTGAAGGAGAGGAGAAGG - Intronic
961287823 3:125820650-125820672 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961899247 3:130195343-130195365 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962532726 3:136298415-136298437 GTGAGGGGAAGGAAAGGAAATGG - Intronic
962573677 3:136736277-136736299 CTAGGGGCAAGGAGAGGGGAAGG + Intronic
962625366 3:137220587-137220609 CTGTGGGGAGGGGGAGGGGGAGG + Intergenic
963275996 3:143330192-143330214 CTTTAGGGCAGGAGAGTAGAAGG + Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963327338 3:143877114-143877136 GTGTGGGGAGGGGGAGGAGGGGG - Intergenic
963628545 3:147704522-147704544 CTGGGAGGAAGGAGAGGATCAGG + Intergenic
963722782 3:148882764-148882786 CTGTGTGGAAGGAAATGAGGAGG + Intronic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
963926324 3:150955231-150955253 GTTGGGGGTAGGAGAGGAGATGG + Intronic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
964434732 3:156639664-156639686 CTGTAGGGAATGAGATCAGAGGG - Intergenic
965520201 3:169662946-169662968 CTGGGGGGAAGGGGAGGGGAGGG + Intronic
965610123 3:170535060-170535082 CCATGGAAAAGGAGAGGAGAAGG - Intronic
965694396 3:171392342-171392364 CTATGAGAAAGGGGAGGAGAGGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966565572 3:181377089-181377111 TTGAGGTGAAGGAGAGGATAGGG - Intergenic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966830764 3:184006424-184006446 CTGTTAGGAAGGAGAGCAGGAGG - Intronic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
966925927 3:184644549-184644571 CCGTGGGGAGGGAGAGGCAAGGG - Intronic
967168505 3:186805573-186805595 CTGTGGGGAAGGGAAGGTGGGGG + Intronic
967425686 3:189324642-189324664 TTGTGGGGCAGGAGAGGGGGAGG + Exonic
967603294 3:191414813-191414835 TGATGGGGGAGGAGAGGAGAGGG - Intergenic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
967875739 3:194267496-194267518 CTGTGACGAAAGAGAGCAGAGGG - Intergenic
968107869 3:196015126-196015148 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
968472921 4:790140-790162 CTGTGGGGAAGGTGTGGACGTGG + Intronic
968558311 4:1261621-1261643 CAGTGGGTAAGGCAAGGAGAGGG + Intergenic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968914736 4:3492457-3492479 CTCTAGGGAAGGGGAGGAGGCGG + Intronic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
968985035 4:3870327-3870349 CATTGGGGAAAGGGAGGAGATGG + Intergenic
969005949 4:4020165-4020187 CTGGGGGGAAGTGAAGGAGAGGG + Intergenic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969443524 4:7231692-7231714 CGGTGGGGACACAGAGGAGAGGG + Intronic
969705496 4:8789167-8789189 CTGGGGGGAGGGAGAGGTGGAGG + Intergenic
969807000 4:9617125-9617147 CTGGGGGGAAGTGAAGGAGAGGG - Intergenic
970215442 4:13754536-13754558 CTGGGGGGAAGGATGGGAGGAGG - Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970479319 4:16457714-16457736 GGGGAGGGAAGGAGAGGAGAGGG - Intergenic
970959013 4:21851175-21851197 CAGGGAGGGAGGAGAGGAGAGGG + Intronic
971639440 4:29111863-29111885 GGATGGGGAAAGAGAGGAGAGGG + Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973652324 4:53008335-53008357 GGGTGGGGAGGGAGAGGGGAAGG - Intronic
974036443 4:56821909-56821931 CCATGGGGAAGGAGGGGCGAGGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
974668663 4:64999797-64999819 TTGTGGGGAAGGAGAGCATCAGG + Intergenic
974819144 4:67044189-67044211 CAGTGAGGAAGGTGAAGAGATGG - Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976291806 4:83426347-83426369 CTGAGGGGAAGGAGAAGGAAAGG + Intronic
976586935 4:86809095-86809117 CCATGGGGAAAGAGAGGAGGAGG + Intronic
976589014 4:86830586-86830608 CGATGGAGAATGAGAGGAGAGGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
976847803 4:89510312-89510334 TTGTGAGGAAGGAGAAGAAATGG + Intergenic
977138427 4:93336162-93336184 CTGTAAAGAAAGAGAGGAGAAGG - Intronic
977226194 4:94394644-94394666 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
977459505 4:97307759-97307781 CTTTGGGGAAGAAGAGGTAAGGG + Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977744864 4:100534892-100534914 CTTTGTGGCAGGAGACGAGAGGG - Intronic
978050536 4:104194082-104194104 CTGGGGGGAAGGAGAGCATTAGG - Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978905086 4:113996066-113996088 GAGTGGGGAAGAGGAGGAGAAGG + Intergenic
979202270 4:117992867-117992889 CAGTGGGGAAGGGTGGGAGAAGG + Intergenic
979562775 4:122119161-122119183 CTGTGGAGTAAGAGTGGAGAAGG + Intergenic
979906009 4:126294562-126294584 CTGGGAGGAAGGAGAGGATCAGG - Intergenic
980145133 4:128973423-128973445 GTGGGGGGAGGGAGAGGGGAGGG + Intronic
980309664 4:131109672-131109694 GTAGGGGGAAGGAGAGGAGAGGG + Intergenic
980342054 4:131563482-131563504 CTATGGGGAAGGAGAGCATTAGG - Intergenic
980471866 4:133263239-133263261 CTGAGGGGAGGGAGAGGGGGCGG - Intergenic
981046212 4:140267596-140267618 CGGCTGGGAAGGAGGGGAGAAGG - Intronic
981238316 4:142443876-142443898 AAGTGGGGCAGAAGAGGAGAAGG + Intronic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982308107 4:153954839-153954861 CTGTGTGGAAGCAGATGATAAGG + Intergenic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
983106897 4:163697676-163697698 CTGTGTCTAAGGACAGGAGATGG + Intronic
983271005 4:165561637-165561659 TTGAGGGGAAAGAGAGGTGAGGG - Intergenic
983625796 4:169800853-169800875 TTGAGGGGAAGGAGAGGAGTAGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983944043 4:173566717-173566739 TTGGGGGGAAGGGGTGGAGAAGG - Intergenic
984026471 4:174548676-174548698 CTGGAGGGAAGGAGAGGAAATGG + Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
984783583 4:183548098-183548120 CTGGAGGTAAGGGGAGGAGATGG - Intergenic
985211821 4:187603962-187603984 GGGGAGGGAAGGAGAGGAGAGGG - Intergenic
985314541 4:188642577-188642599 CTTTGGAGAAGGGCAGGAGAAGG + Intergenic
985377537 4:189356477-189356499 CTGGGGGGACGCACAGGAGATGG + Intergenic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985404558 4:189624408-189624430 CTGTGAGGAAGGCTAGGGGATGG - Intergenic
985469805 5:33193-33215 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985836257 5:2274294-2274316 CCGGGGGGAAGGAGAGGATCAGG - Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986234726 5:5896256-5896278 CAATGGGGAAGGGGAGGTGATGG - Intergenic
986885294 5:12226442-12226464 CTCTGCTTAAGGAGAGGAGATGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987358256 5:17083685-17083707 CCGCGGGGAAGGGGAGGGGAGGG + Intronic
987903834 5:24050432-24050454 CTCTGCTTAAGGAGAGGAGAGGG + Intronic
988987027 5:36630392-36630414 CTGTGGGGAAAGAGAAGAGTGGG - Intronic
988998554 5:36737922-36737944 ATGTGGAGAAGGAGAGGTGGAGG - Intergenic
989084905 5:37665898-37665920 GGGTGAGGAAGCAGAGGAGAGGG - Intronic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
989753336 5:44922073-44922095 CTGTTGGGAACTAGAGTAGATGG + Intergenic
989760465 5:45009592-45009614 GTGGGAGGAAGGAGAGGAGCAGG + Intergenic
990128594 5:52550718-52550740 CTGTGAAGTATGAGAGGAGAAGG - Intergenic
990356303 5:54969641-54969663 CTGTGGAGAAGCTGTGGAGATGG - Intergenic
991054846 5:62308763-62308785 TGGTGGGGAAGGAGAGGAAATGG + Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992474011 5:77084741-77084763 CTGTGGGGCATGGGAGGGGAAGG - Intronic
992550228 5:77852627-77852649 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
992636620 5:78730945-78730967 CTGAGGGGGAGGTGAGGGGAAGG + Intronic
992911673 5:81401313-81401335 CGGAGGGGAAGGGAAGGAGAAGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994689198 5:102995781-102995803 CTGTGAGGCAGGAAAAGAGATGG - Intronic
995145145 5:108779823-108779845 ATGTTGAGAAGGAGAGGTGACGG + Intronic
995236410 5:109833686-109833708 CTGTGGGGAGGGGGAGGGGGAGG + Intronic
995552390 5:113294246-113294268 CTGTGGGGAGGTCGAGGGGAGGG + Intronic
996404349 5:123090845-123090867 CTGTGAAGCAGGTGAGGAGAGGG - Intronic
997827794 5:137123188-137123210 CAGTGTTGGAGGAGAGGAGACGG + Intronic
997880156 5:137582214-137582236 TTTTGGGGAAGGAGAAGAGAGGG - Intronic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998232409 5:140369340-140369362 CTCTGGTGAAGGAGAAGTGAAGG - Intronic
998262973 5:140645234-140645256 CTGAGTGGAAGGGGAGGAGCTGG - Exonic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998368319 5:141645103-141645125 CTTTGAGGAATGTGAGGAGACGG - Exonic
998430320 5:142064776-142064798 CACTGTGGAAGGAGAGGGGAGGG - Intergenic
998474577 5:142409437-142409459 CTGTGGGGAAGGCGGGGACCAGG + Intergenic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
998977283 5:147662318-147662340 TTGTGGGGCAGGAAGGGAGAAGG - Intronic
999343817 5:150797208-150797230 AGGAGGGGAAGGAGAGTAGAAGG + Intergenic
999484202 5:151978326-151978348 ATGGGGGGAAGGGTAGGAGAGGG - Intergenic
999590038 5:153134894-153134916 CTCTAGGGAATGAGAAGAGAAGG + Intergenic
999775395 5:154808828-154808850 CTGTGGGGAAAGACACCAGATGG - Intronic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000120631 5:158194647-158194669 CTGGAGGGAGGGAGAGGAGGAGG - Intergenic
1000173831 5:158730249-158730271 CTGTGAGGACTCAGAGGAGAGGG - Intronic
1000308461 5:160018144-160018166 CTTTGTGGAAGGGGAGTAGAAGG - Intronic
1000404011 5:160866732-160866754 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1000957863 5:167563424-167563446 TTGTGGTCAAGGAGAAGAGAAGG - Intronic
1001283336 5:170403968-170403990 CTGTGGGGAAGAAGCAGAGTGGG + Intronic
1001313000 5:170624678-170624700 GTGGAGGGGAGGAGAGGAGAGGG + Intronic
1001332585 5:170772710-170772732 GTGTGGGGAAGGAGGGGTGGTGG + Intronic
1001634132 5:173197573-173197595 ATGGGAGGAAGGAGAGGAGGAGG + Intergenic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001691785 5:173638774-173638796 CAGTCGGGAAGGAGAGAGGAAGG - Intergenic
1001810756 5:174626545-174626567 CTGGGAGGAAGAAGAGGAGGTGG - Intergenic
1001868336 5:175125685-175125707 CAGGGGTGAAGGAGAGGGGAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002490032 5:179569234-179569256 GGGTGGGGAAGGAGTGGGGATGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003194681 6:3904128-3904150 CTGCCGGCAAGGAGAGCAGAGGG + Intergenic
1003445393 6:6178967-6178989 GTGCGCGGAAGGAGTGGAGAAGG + Intronic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003576074 6:7296643-7296665 CTGGAGGGAAGGAAAGGAGGAGG + Intronic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1003965522 6:11248957-11248979 CTCTGGGGAGAGAGAAGAGAAGG - Intronic
1004005939 6:11637229-11637251 TTGTGTGGAAAGAGAGGAGGAGG + Intergenic
1004296875 6:14420975-14420997 CTGTGGGAAAGCAAAGGAGGAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005197790 6:23309456-23309478 ATGTGGGGAAGCAGAAGACAGGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005857018 6:29870356-29870378 ATGTGGGGAAGGATAATAGAGGG + Intergenic
1005862836 6:29914495-29914517 ATGTGGGGAAGGATAGTAGAGGG + Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006452582 6:34113689-34113711 CTGGGAGGAGTGAGAGGAGAAGG + Intronic
1006510842 6:34520276-34520298 CTCTGGGTAAGGCGAGGAGTGGG + Intronic
1006650388 6:35546183-35546205 CTGTGGGGAGGGAGAGCATCAGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006854583 6:37124087-37124109 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1006854589 6:37124103-37124125 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1007325989 6:41059848-41059870 CTTTGGGGAAAGAGAAGAGGTGG + Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007629419 6:43264595-43264617 CTAGGGGGAATGAGAGGAGAAGG + Intronic
1007816949 6:44531400-44531422 ATATGGGGAAGGAGAGAAGGGGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008886445 6:56436191-56436213 CTGTGGGGTAGGGATGGAGAAGG + Intergenic
1008890287 6:56480599-56480621 ATGAAGGGAAGCAGAGGAGATGG + Intronic
1009486103 6:64224300-64224322 TGGTGGGGAAGAAGATGAGATGG - Intronic
1009593707 6:65708688-65708710 CAGAGGGCAAGGAGAGGAGGGGG - Intergenic
1009860649 6:69326770-69326792 ATGTGTGGAGGAAGAGGAGAAGG + Intronic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010153321 6:72762198-72762220 CTGGGGGGAAGGAAAGGAAAGGG + Intronic
1010259506 6:73798971-73798993 GAGAGGAGAAGGAGAGGAGAGGG - Intronic
1010735306 6:79437198-79437220 CCGTGGAGGAGGAGAGGAGCAGG + Intergenic
1011164236 6:84428105-84428127 CTGTGGGGAGGGGAAGGAAATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1012552208 6:100473946-100473968 CTGTGAGGAAGAAAAAGAGATGG + Intergenic
1012671999 6:102064296-102064318 AGGAGGAGAAGGAGAGGAGAAGG - Intronic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013661211 6:112298960-112298982 CGGCTGGGAGGGAGAGGAGAAGG - Intergenic
1013744268 6:113326430-113326452 AAGTGGGGAAGGGTAGGAGAAGG - Intergenic
1014176368 6:118335748-118335770 ATGGGAGGAAGGAGAGGGGAAGG + Intergenic
1014209105 6:118689457-118689479 CTGTTAGGAATGAGAAGAGATGG + Intronic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015097192 6:129429823-129429845 TTGTGGGGAAATAGAGGCGAGGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015540551 6:134309395-134309417 ATGTGGGAAAGTGGAGGAGAAGG - Intronic
1015620602 6:135127858-135127880 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016245908 6:141980586-141980608 GGGAGGGGAAGGAGAAGAGAAGG + Intergenic
1016471548 6:144379907-144379929 CTGTGGAGGAGTGGAGGAGAAGG + Intronic
1016642160 6:146361471-146361493 CTGTAGTGAAGGACAGGAAAGGG + Intronic
1016899172 6:149084021-149084043 GAGTGGGGAAGGGGAGGAGTGGG + Intergenic
1017212830 6:151875971-151875993 CTGTGGGGAAGGATTGGCGGGGG + Intronic
1017293255 6:152765634-152765656 GAGAGGGGAAGGAGAGGGGAGGG - Intergenic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017545193 6:155443272-155443294 CTGTGGGGAAGGTCCGGACAGGG + Exonic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1018146741 6:160898679-160898701 AGGAGGGGGAGGAGAGGAGAAGG - Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1018233746 6:161702534-161702556 ATGGGGGGAGGGGGAGGAGAGGG + Intronic
1018839441 6:167507893-167507915 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1018839595 6:167508264-167508286 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019049135 6:169169966-169169988 CTGTGGGGTAGGAGGGGTGGGGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019599562 7:1874456-1874478 CTCTGGTGGAGGAGAGGAGGCGG + Intronic
1019705637 7:2495969-2495991 CTGTGGGGAGGGAGTGGGGCGGG + Intergenic
1019999099 7:4744772-4744794 CTGGGCGGAAGGAGGGGAAAGGG - Intronic
1020141532 7:5614640-5614662 CTTTGAGGGAGGGGAGGAGATGG + Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021135875 7:16964685-16964707 CTGTGTGGAAGGTGACCAGAGGG - Intergenic
1021380579 7:19961235-19961257 AGGTGTGGAAGGAGAAGAGAGGG - Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1022070438 7:26908494-26908516 CGGAGGGGAAGGGGAGGGGAGGG + Intronic
1022376095 7:29812726-29812748 CTGTGAGGAAGAAGAGGGAATGG + Intronic
1022377587 7:29828963-29828985 GTGTGGGGGAGAAGAGGAAAAGG - Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022403604 7:30065203-30065225 TTGTGCCGAAGGAGAAGAGAGGG - Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023236515 7:38095795-38095817 AAGAGGGCAAGGAGAGGAGATGG + Intergenic
1023272741 7:38482884-38482906 TTGTGGGGAAGGAGAGTCCAGGG - Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023280328 7:38562663-38562685 AAGAGGGGAGGGAGAGGAGAGGG + Intronic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1023981580 7:45073629-45073651 ATGGGGGGAAGGGGAGGAGGAGG + Intronic
1024080906 7:45854085-45854107 CTGTCGGGAAGGGGAGAAGAGGG + Intergenic
1024097140 7:45991260-45991282 CTGAGGGAGAGGAGAGGAGGGGG + Intergenic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1024248814 7:47490946-47490968 GTGTCGGGAAGTAGAGGAAAGGG + Intronic
1024604640 7:51013653-51013675 CTGTGGGGGACGAGGGGAGGAGG - Intergenic
1024903333 7:54347396-54347418 CGGTGGGGGAGGGGATGAGATGG + Intergenic
1024939249 7:54745220-54745242 GTGTGGGCTAGGAGAGGAGGAGG - Intergenic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1025123599 7:56327754-56327776 CTGTCGGGAAGGGGAGAAGAGGG - Intergenic
1025847857 7:65216872-65216894 CTGTCGGGAAGGGGAGAGGAGGG - Intergenic
1025898104 7:65722737-65722759 CTGTCGGGAAGGGGAGAGGAGGG - Intergenic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026741786 7:72983474-72983496 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026762566 7:73137768-73137790 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762574 7:73137790-73137812 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762582 7:73137812-73137834 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762590 7:73137834-73137856 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762598 7:73137856-73137878 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762608 7:73137878-73137900 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026801629 7:73403902-73403924 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026886297 7:73949379-73949401 TGGAGGAGAAGGAGAGGAGAAGG - Intergenic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027039029 7:74947544-74947566 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039037 7:74947566-74947588 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039045 7:74947588-74947610 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039053 7:74947610-74947632 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039061 7:74947632-74947654 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039071 7:74947654-74947676 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039081 7:74947676-74947698 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027084570 7:75254712-75254734 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084580 7:75254734-75254756 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084590 7:75254756-75254778 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084598 7:75254778-75254800 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084606 7:75254800-75254822 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084616 7:75254822-75254844 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084624 7:75254844-75254866 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084632 7:75254866-75254888 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084640 7:75254888-75254910 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084648 7:75254910-75254932 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084658 7:75254932-75254954 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027101949 7:75381603-75381625 TTATGAGGAAGGAGAGAAGAGGG - Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027251054 7:76398937-76398959 CACTGGGGTATGAGAGGAGAGGG + Intronic
1027428050 7:78081887-78081909 CTGTGGGGAAGGAGATGATGAGG + Intronic
1027505547 7:79013378-79013400 CTGTGAGGAATTAGAAGAGAAGG + Intronic
1028618898 7:92801978-92802000 GGGAGGGGAAGGAAAGGAGAAGG - Intronic
1029069190 7:97881422-97881444 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029392155 7:100282539-100282561 GTAAGGGGAAGGGGAGGAGAAGG - Intergenic
1029492760 7:100881431-100881453 CTGAGGCAAAGGGGAGGAGAGGG - Intronic
1029507712 7:100972342-100972364 CTCTAGGGAAGGAGAGGCGCGGG - Intronic
1029608737 7:101615334-101615356 GCCTGGAGAAGGAGAGGAGAGGG - Intronic
1029629605 7:101742329-101742351 CTGTGGGGAGCGAGAGGTGCAGG - Intergenic
1029724970 7:102396670-102396692 CTTTGGGGAGGAGGAGGAGAAGG + Intronic
1029887830 7:103891568-103891590 CTGAGGTGGAGTAGAGGAGAAGG - Intronic
1030007062 7:105130205-105130227 CTGTTGGGAATGAGAGCTGACGG - Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030147343 7:106370034-106370056 CTCAGGGGAAAGGGAGGAGAAGG + Intergenic
1030162012 7:106518603-106518625 GAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1030162017 7:106518621-106518643 AAGGGGAGAAGGAGAGGAGAGGG - Intergenic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030509049 7:110460516-110460538 GGGAGGAGAAGGAGAGGAGAAGG + Intergenic
1030727925 7:112948109-112948131 TTGTGGGGAAGGATGGGAGGGGG - Intergenic
1030783080 7:113625744-113625766 GAAGGGGGAAGGAGAGGAGAGGG - Intergenic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031083681 7:117281892-117281914 ATGTGGTGGAGGAGAGGACATGG + Intronic
1031318768 7:120293367-120293389 CAGAAGGGAAGGAGAAGAGAAGG + Intronic
1031392452 7:121232251-121232273 TTTTGGGGAAGGTGAGGAGATGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032189494 7:129755947-129755969 TTCCTGGGAAGGAGAGGAGATGG - Exonic
1032242910 7:130179327-130179349 CTCTGGGGAAGGGGAGGAGGGGG - Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032557519 7:132852734-132852756 CTGTGAGGAAGGAGAAGTGTTGG + Intronic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033643403 7:143283910-143283932 GGGTGGGGAAGCATAGGAGAGGG - Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1033880519 7:145877032-145877054 AGGTGGGGAATGAGAGGAAATGG - Intergenic
1034252893 7:149706543-149706565 AGGGGGGGAAGGAGAGGAGAGGG - Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034529242 7:151685118-151685140 CTGGGGGGAAAGAGAAGAAATGG - Intronic
1034567049 7:151923747-151923769 CTGTGGGGAAAGGGAGGACGTGG + Intergenic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034679208 7:152915817-152915839 ATGAGGGGAGGGGGAGGAGAAGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034872312 7:154695583-154695605 GTTTGGAGAAGGAGAGGTGAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035574336 8:695489-695511 TGGGGAGGAAGGAGAGGAGAGGG - Intronic
1035655211 8:1300323-1300345 CTGAGGGGAAGGGTAGGAAAGGG + Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035701325 8:1641029-1641051 CTGTGGGGAAGGAGAAGCCCTGG + Intronic
1036066115 8:5383379-5383401 CAGTGGGAAAGGAGACGACAAGG + Intergenic
1036251446 8:7166193-7166215 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1036366042 8:8121267-8121289 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1036399026 8:8391842-8391864 CTGAGAGGAAAGAGAGGAGTGGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036707520 8:11056332-11056354 ATGTGGAGAAGGGAAGGAGATGG - Intronic
1036884895 8:12544813-12544835 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1037147282 8:15587711-15587733 GTAGGGGGAAGGAGAGGATAGGG - Intronic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1037322826 8:17659877-17659899 CCTTGGGGAAGGGGAGGGGATGG - Intronic
1037386479 8:18347855-18347877 CTTGGGGGAAGGAGTGGAAAGGG + Intergenic
1037603846 8:20421217-20421239 ATGACGGGAAGGAAAGGAGAAGG - Intergenic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1037986180 8:23292004-23292026 ATGTGGGGAAGCTGAGGAGGAGG - Intronic
1038415248 8:27390170-27390192 CTGTGCAGGAGCAGAGGAGAGGG + Intronic
1038831531 8:31066482-31066504 CTGGGAGGAAGGAAAAGAGAAGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039643668 8:39254859-39254881 TTGAGGGGAAGGATAGGAGTAGG - Intronic
1039669945 8:39584628-39584650 CAGTGAGGAGGGCGAGGAGAAGG - Exonic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039884261 8:41646366-41646388 GCGTGGGGAAGGGGAGGGGAAGG + Exonic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1040970318 8:53128930-53128952 TGGAGGGGAAGGTGAGGAGAGGG + Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041487152 8:58392037-58392059 CTCAGGGGAAGAAGAGGACAAGG - Intergenic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1042951615 8:74205951-74205973 ATGTGTGGAAGGAGAGGCTATGG - Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043541282 8:81265676-81265698 CTTTTGGGAAGGAGAGAAGGAGG - Intergenic
1043822895 8:84890347-84890369 CTCTGGGGAATGAGGAGAGATGG + Intronic
1043919805 8:85968426-85968448 GTGAGGGGAAGAAGAGGTGAAGG + Intergenic
1044065930 8:87700171-87700193 TTGGGGGGAAGGGGAGGAGCAGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044289110 8:90446948-90446970 GTGGAGGGAGGGAGAGGAGAAGG - Intergenic
1044451387 8:92339460-92339482 ATGTGGGGAAGGATGGGAGTGGG + Intergenic
1044457116 8:92401497-92401519 AGGTGGGGAGGGAGAGGAGCAGG - Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044511901 8:93091321-93091343 GTGTGTGGAAGTAGAGGTGAAGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045234048 8:100334323-100334345 CTGTGTGGAAACAGAGCAGAGGG - Intronic
1045387547 8:101686282-101686304 GTTTGAGGAAGGAGAGGATATGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045714239 8:105022779-105022801 CTGGAGGGAAGGAGAGACGAAGG - Intronic
1045800601 8:106096785-106096807 CTCTGCCTAAGGAGAGGAGAAGG + Intergenic
1046038228 8:108870875-108870897 CAAAGGGGAAGGAGAAGAGATGG - Intergenic
1046085451 8:109428434-109428456 ATTTGGGGAAGGAGAGGAAGTGG + Intronic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1047068216 8:121311330-121311352 CTGGGAGGAAGGAGAGGATCAGG - Intergenic
1047170367 8:122486774-122486796 CCCTGGGGAAGGGGTGGAGATGG - Intergenic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047798664 8:128285588-128285610 GGGAGGGGAAGAAGAGGAGAGGG + Intergenic
1047810543 8:128403859-128403881 TTGTGGTGAAGGACAGGAGTCGG + Intergenic
1047996617 8:130342787-130342809 TTGAGGGGAAGGAGAAGAGGAGG - Intronic
1048044056 8:130756700-130756722 CCTTGGGGAGGAAGAGGAGATGG + Intergenic
1048089673 8:131225444-131225466 CTGGGAGGAAGGAGAGGATCAGG + Intergenic
1048200218 8:132367156-132367178 CAGGGTTGAAGGAGAGGAGAAGG - Intronic
1048298301 8:133232698-133232720 CTGGGGGCAAGTAGATGAGAGGG - Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049006493 8:139858939-139858961 CCGTGCAGAAGCAGAGGAGACGG - Intronic
1049026486 8:139994196-139994218 AAGTGGGGCAGCAGAGGAGAAGG + Intronic
1049233640 8:141497010-141497032 CTTGGAGGAAGGAGAGGAGGAGG - Intergenic
1049267331 8:141675527-141675549 CTGTTGTGCAGGAGTGGAGAAGG + Intergenic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049425376 8:142535734-142535756 CTGTGGGCGAGCAGAGGAGCTGG - Intronic
1049495011 8:142925875-142925897 GTGTGGGGCAGCAGATGAGACGG + Intergenic
1049763034 8:144339353-144339375 CTTTGTTGCAGGAGAGGAGATGG + Intergenic
1049822372 8:144643576-144643598 CCCAGGGGAAGGTGAGGAGATGG - Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050587344 9:7126191-7126213 ATGTGTGGAAGGAGAAGAGGGGG + Intergenic
1050602582 9:7267662-7267684 CTGTGAGAAAGGACAGGAAAGGG - Intergenic
1051207281 9:14701488-14701510 CTCTGGGAAAGGAGATGAAAAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1051831174 9:21278845-21278867 CTATGGGGAAGGAGAAGAGGAGG - Intergenic
1052392997 9:27903044-27903066 TTGCGGGGAAGGAGAGAAGCAGG - Intergenic
1052401456 9:28005468-28005490 CTGTGGGGAAGAAAAGTAGAGGG - Intronic
1052963586 9:34320726-34320748 CCCTTGGGAAGGAGGGGAGAGGG + Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053433796 9:38061635-38061657 CTGGGGGCAAAGAGAGGATAGGG + Intronic
1053494184 9:38537731-38537753 CTGGGTGCAAGGACAGGAGAAGG + Intergenic
1054542289 9:66278137-66278159 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1054896664 9:70321138-70321160 CTGAATGGTAGGAGAGGAGAGGG + Intronic
1055254862 9:74356671-74356693 CTGAGGGGCAGGGAAGGAGATGG + Intergenic
1055255344 9:74363165-74363187 CAGGAGGGAAGCAGAGGAGATGG - Intergenic
1055394799 9:75862695-75862717 CTGTGGGTAAGTAGAGGTTAGGG + Intergenic
1055734360 9:79312071-79312093 CTGGGTGGAAGAAGAGGATATGG - Intergenic
1055964087 9:81848406-81848428 CAGAGAGGAAGAAGAGGAGAGGG - Intergenic
1056089058 9:83186604-83186626 CTGTTAGGAAGAAGAGGAGCAGG - Intergenic
1056153067 9:83806561-83806583 CTGTGGGGAGGCAGAAGAGTAGG + Intronic
1056167992 9:83956971-83956993 CTGCGGGAAAGGAGAGGGGTGGG - Intronic
1056336263 9:85573089-85573111 CCGTGGGGAAGGGGAGGGGGAGG - Intronic
1056460561 9:86805865-86805887 CTGTTAGGAAGGGGAGGGGAGGG + Intergenic
1056579457 9:87880454-87880476 CTGCAGGGAAGCAGAGGAAAGGG - Intergenic
1056838547 9:89978564-89978586 CTAAAGGGAAGGAGAGGGGAGGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057139270 9:92716925-92716947 ATCTGGGGAGGGTGAGGAGAGGG - Intronic
1057144731 9:92750113-92750135 CTCTGGGGATTGCGAGGAGATGG - Intronic
1057197333 9:93122292-93122314 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057197341 9:93122322-93122344 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057197349 9:93122352-93122374 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057918447 9:99075671-99075693 AAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1058695462 9:107555216-107555238 TTGTGGGGTAACAGAGGAGATGG + Intergenic
1059114087 9:111585330-111585352 GTGTGGGGTAGGAGAGGTGAAGG - Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060383228 9:123197244-123197266 GGGTGGGGAAGAAGTGGAGATGG + Intronic
1060508669 9:124216691-124216713 CTGTGGGGAAGGGGTGCACAGGG + Intergenic
1060526362 9:124323470-124323492 CCGGGTGGAAGGAGAGGTGAGGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060698634 9:125731462-125731484 CCCTGGGGAAGTAGAGGGGATGG - Intergenic
1060826719 9:126692007-126692029 CAGTGGGGAAGGACTGGAGCAGG + Intronic
1061026842 9:128055324-128055346 GAGGGGGGAAGGGGAGGAGAGGG + Intergenic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061248644 9:129414118-129414140 CTGTAGGCCAGGAGAGGAGGGGG + Intergenic
1061252857 9:129436784-129436806 ATGAGAGGAAGGAGAGGAGGGGG - Intergenic
1061315817 9:129795217-129795239 CCAAGGGGAAGGAGAGGAGCAGG + Intergenic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061644540 9:131990115-131990137 CTGTGGGGAAGCAGTGGTGGGGG - Intronic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061774045 9:132948794-132948816 TGGTGCGGAGGGAGAGGAGACGG - Intronic
1061947129 9:133914696-133914718 GGGAGGGGAAGGAGAGGGGAGGG + Intronic
1062059192 9:134485894-134485916 CTGTGGCGAGGGACAGGAGTGGG - Intergenic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062264271 9:135679692-135679714 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264315 9:135679815-135679837 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264329 9:135679850-135679872 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062289825 9:135789503-135789525 CTGTGAGGAAGGCGTGAAGAGGG - Intronic
1062320659 9:135989184-135989206 CTGTGGGGAGGGGGAGGTCAGGG - Intergenic
1062323275 9:136000948-136000970 CGGTGGGGAGGGAAAGGAGTGGG + Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062551189 9:137087329-137087351 TTGCGGGGAAGGGGTGGAGAGGG - Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185701463 X:2233995-2234017 TAGCAGGGAAGGAGAGGAGAAGG + Intronic
1185972974 X:4685106-4685128 CTATGGGGAAGGTCAGGTGAGGG + Intergenic
1186182932 X:6990520-6990542 TTTTGGGGCAGGAGAGGTGAAGG - Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186760952 X:12721111-12721133 TGGTGAGGAAGAAGAGGAGAGGG + Exonic
1186868654 X:13747561-13747583 GTGAAGGGAAGCAGAGGAGAGGG + Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187192222 X:17045963-17045985 GTGTGGGGAATGGGAGGAGATGG + Intronic
1187447728 X:19373319-19373341 ATGTGGGGAATGAAAGGACAGGG + Intronic
1187463898 X:19512168-19512190 CTGTGGGGAGTGGGAGGGGAGGG + Intronic
1187586780 X:20671742-20671764 CTGGGAGGAGGGAGAGGAGCAGG - Intergenic
1187588184 X:20687151-20687173 GTGGGGGGAAGGACAGGATATGG - Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188512469 X:30950969-30950991 CTGTGGTGAGGGCCAGGAGATGG - Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189225154 X:39406684-39406706 CCCTGTGGAAGGAGAGGGGAAGG - Intergenic
1189269052 X:39737477-39737499 CTGTAGGGAGACAGAGGAGAGGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189314148 X:40041912-40041934 TCCTGTGGAAGGAGAGGAGAAGG + Intergenic
1189358418 X:40329007-40329029 CTGTGGGGTAGGAGATGATGAGG + Intergenic
1189491675 X:41475192-41475214 ATGAGGGGAAGGGGAGGGGAGGG - Exonic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1190733761 X:53241752-53241774 CTGTGGGGGAGGAGATGGGAGGG - Intronic
1190821240 X:53974913-53974935 TGGTGGGGAAGGAGAGTACAAGG + Intronic
1190831632 X:54063963-54063985 CTCTGGGGAAGGTAAAGAGATGG + Intergenic
1191641126 X:63430587-63430609 GTGTTGGAAAGGGGAGGAGAGGG + Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192020332 X:67384465-67384487 GAGTGGGGAAGGAGTGGTGATGG - Intergenic
1192173071 X:68868631-68868653 TTGTGGGGAAGGGGTGGTGAGGG + Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1192762584 X:74109097-74109119 TTGTGGGGAAGGGTGGGAGAGGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193976450 X:88125447-88125469 CTGTGGGGAGGGTGTGGAGCTGG + Intergenic
1195107689 X:101616638-101616660 CCTTGGGGCAGGACAGGAGAGGG + Exonic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195626490 X:107009557-107009579 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195655309 X:107326864-107326886 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195675502 X:107504395-107504417 CTAGTGGGAAGGAGAGGGGAAGG + Intergenic
1195802867 X:108733337-108733359 CTGAGGGGAAGGGGAGGAAGTGG + Exonic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197584385 X:128327362-128327384 AAGTGGGGAAGGGAAGGAGAGGG - Intergenic
1197703985 X:129620623-129620645 CTGGAGGGAAAGAGAGGAGCAGG - Intergenic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1197728598 X:129792601-129792623 TTGGGGGAGAGGAGAGGAGAAGG - Intronic
1197971388 X:132118841-132118863 CTGTGGGGGAGCAGAGATGAAGG - Intronic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG + Exonic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1199404630 X:147442668-147442690 CAGTGGGGAAGGTTAGGAGAGGG + Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199582350 X:149372910-149372932 CTATGGGGAGGGGAAGGAGAAGG + Intergenic
1199598803 X:149528418-149528440 GAATGGGAAAGGAGAGGAGAGGG - Intronic
1199599776 X:149535056-149535078 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
1199650863 X:149945191-149945213 ATGAGGAGGAGGAGAGGAGAAGG + Intergenic
1199771887 X:150980411-150980433 CTGGGGGGATGGGGAGGAGCAGG + Intergenic
1200053606 X:153447117-153447139 CCTTGGGGAAGCAAAGGAGATGG + Intronic
1200145684 X:153925639-153925661 CTGAGGGGGAGCAGAGGCGAGGG - Intronic
1200300097 X:154965556-154965578 ATGGGAGGAAGGGGAGGAGAAGG - Intronic
1200965440 Y:9031859-9031881 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201862238 Y:18611582-18611604 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201863127 Y:18621406-18621428 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201870196 Y:18698972-18698994 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201871085 Y:18708798-18708820 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1202147664 Y:21816929-21816951 GTGAAGGGAAGCAGAGGAGACGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic