ID: 1101328814

View in Genome Browser
Species Human (GRCh38)
Location 12:103740710-103740732
Sequence ACAGATCCCCAGGTGCTGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101328803_1101328814 27 Left 1101328803 12:103740660-103740682 CCCTTCAAGAGGAACCTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 159
Right 1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG 0: 1
1: 0
2: 3
3: 18
4: 187
1101328805_1101328814 26 Left 1101328805 12:103740661-103740683 CCTTCAAGAGGAACCTGGAAGGC 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG 0: 1
1: 0
2: 3
3: 18
4: 187
1101328809_1101328814 13 Left 1101328809 12:103740674-103740696 CCTGGAAGGCTGCCGGGAGCGGT 0: 1
1: 0
2: 0
3: 12
4: 233
Right 1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG 0: 1
1: 0
2: 3
3: 18
4: 187
1101328811_1101328814 1 Left 1101328811 12:103740686-103740708 CCGGGAGCGGTGCAGCCTGGTGA 0: 1
1: 0
2: 1
3: 32
4: 474
Right 1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG 0: 1
1: 0
2: 3
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101328814 Original CRISPR ACAGATCCCCAGGTGCTGCA AGG Exonic
900417916 1:2543503-2543525 ACACATTCCCAGGGGCTCCAGGG - Intergenic
902833877 1:19034587-19034609 ACAGAGCTCCAGGTTCTGCGGGG + Intergenic
903215069 1:21839256-21839278 AGAGGTCTCCAGGCGCTGCAGGG - Intronic
905370670 1:37481122-37481144 GCAGCTCCCCAGGTGGGGCATGG + Intronic
905371930 1:37486975-37486997 ACATATCTCTAGGAGCTGCAGGG + Intergenic
905695424 1:39970028-39970050 ACTGAGCCCCAGGTGCTACTGGG + Intergenic
906695550 1:47820997-47821019 ACAGATGCCCAGAGGATGCAAGG - Intronic
913094797 1:115506233-115506255 ACAGGTGCCCAGGTGGTGCAGGG + Intergenic
913452794 1:119003501-119003523 GCAGTGCCCCAGTTGCTGCAGGG - Intergenic
916560500 1:165930755-165930777 ACTGTTCACCAGGGGCTGCAGGG - Intergenic
917458144 1:175203523-175203545 ACAGGACCCCAGGTTCAGCACGG - Intergenic
920432365 1:205927229-205927251 ATAGATCCCCAGGACCAGCATGG + Exonic
922473199 1:225889046-225889068 GCAGAGCCACAGGGGCTGCATGG + Exonic
922979369 1:229812651-229812673 TCAAATCCCCAGTTGCTGCAGGG + Intergenic
924615600 1:245609299-245609321 AATGATGCCCAGGTTCTGCATGG - Exonic
1063347394 10:5324820-5324842 ACAGAGGCACAGGTGCTCCAGGG + Intergenic
1064159973 10:12936989-12937011 ACAGGTCCCCTTGTGCTGCCAGG - Intronic
1065721974 10:28636086-28636108 CCACAGCCCCCGGTGCTGCAAGG - Intergenic
1070207793 10:74281239-74281261 ACAGATACCCATGTGCTTTATGG + Intronic
1070685124 10:78474959-78474981 ACAGATGCCCCAGTGCAGCATGG - Intergenic
1070848550 10:79543667-79543689 ACTGATCCCCATCTGTTGCAGGG - Intergenic
1070925237 10:80216518-80216540 ACTGATCCCCAACTGTTGCAGGG + Intergenic
1074219264 10:111420406-111420428 ACAGAACACCAGGGGATGCAGGG - Intergenic
1075548293 10:123372866-123372888 ACAGACCCCCAGGCCCTACAGGG + Intergenic
1076131753 10:128018336-128018358 CCAGACCCCCAGGGGCTGGATGG + Intronic
1076349877 10:129808435-129808457 GCAGAGCCCCGGGTGCTGCATGG - Intergenic
1077515915 11:3002086-3002108 GCGGAGCCCCAGGTGCTGCTCGG - Intronic
1078342066 11:10504723-10504745 ACAGATCCCCAGTGCCTGGAAGG - Intronic
1079037903 11:17036778-17036800 AGAGATACCCAGGTACTACATGG + Intergenic
1079729324 11:23920710-23920732 AGAGATACCCAGGTCCTACATGG - Intergenic
1081794814 11:45811901-45811923 GCAGATCCCCAGGGGCTGCTGGG + Exonic
1084008302 11:66334597-66334619 CCCGAGCCCCAGGAGCTGCAGGG - Exonic
1084175248 11:67419433-67419455 ACACCACCCCAGGTACTGCAGGG - Intronic
1084203492 11:67577399-67577421 CCTGATCCCCTGGGGCTGCATGG - Intergenic
1085919201 11:80931597-80931619 ACAGACCCACAAGTGCTGAAGGG + Intergenic
1086890041 11:92246718-92246740 ACACAGCCCCTGGTGCTGCCTGG - Intergenic
1089309289 11:117547338-117547360 ACAGAACCCCAGTAGCTGCACGG + Intronic
1092240296 12:6831880-6831902 GCTGGTCCCCAGGTGCTCCATGG - Exonic
1092902747 12:13075314-13075336 ACAAAGCCCCATCTGCTGCAAGG + Intronic
1097711853 12:62925802-62925824 ACAGCTCCCCAAGGTCTGCAAGG + Intronic
1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG + Exonic
1102573709 12:113843155-113843177 ACTGTTCCCAAGGTGCTGCCTGG + Intronic
1102682322 12:114698999-114699021 ACCCAGCCCCAGGTGCTGCCAGG - Intergenic
1103859387 12:124000114-124000136 TCAGTTCCTCAGGGGCTGCATGG - Intronic
1103862844 12:124028018-124028040 GCAGCACCCAAGGTGCTGCAGGG + Intronic
1104084079 12:125458501-125458523 TCAGCTCCCCAGGACCTGCAAGG - Intronic
1104286688 12:127430741-127430763 TCAGCTCCCCAGGACCTGCAAGG + Intergenic
1104579852 12:130003196-130003218 ACCGAGCTCCAGGTGCTGCTTGG + Intergenic
1113707601 13:112444540-112444562 ACAGATCCCGTGGTGAGGCACGG - Intergenic
1113855840 13:113445051-113445073 CCAGAAACCCAGGTGCTGCAGGG + Intronic
1114430245 14:22654599-22654621 GCAGATCCCCAGAAGCAGCAGGG + Intergenic
1114854941 14:26427320-26427342 ACAGATCCCCACCTCCTACATGG - Intergenic
1118344821 14:64930299-64930321 ACAGATCTCCTCGTGCTGCCAGG - Intronic
1121410021 14:93743369-93743391 ACTGTTCCCCAGGAGCTGAAAGG + Intronic
1121719527 14:96099493-96099515 ACAGAGCCCCAGTTGCTGCAGGG + Intergenic
1202946302 14_KI270726v1_random:29955-29977 TCAGTTCCCCAGGTGTTCCATGG + Intergenic
1124642210 15:31402667-31402689 ACAGAGCCCCAGGTGGAGCCTGG + Intronic
1125762953 15:42110493-42110515 ACAGGTTCCCAGGTGATCCATGG - Intergenic
1125809895 15:42529406-42529428 ACAGCTTCCCAGGTGATGCTGGG + Intronic
1129696420 15:77742976-77742998 ACAGAACCCACGGTGGTGCACGG + Intronic
1129852763 15:78803853-78803875 ACAAAACCACAGGTGCTGCTGGG + Intronic
1130949149 15:88571780-88571802 GCCAAGCCCCAGGTGCTGCAAGG + Intergenic
1131232097 15:90666810-90666832 GCAGATTCCCAGGAGCTGCCTGG - Intergenic
1131848014 15:96508795-96508817 TCAGATTCCCAGGTGATACAGGG - Intergenic
1132643505 16:988492-988514 CCCCCTCCCCAGGTGCTGCACGG + Intergenic
1136156130 16:28383443-28383465 ACAGATGCCCAGCTGCACCATGG + Exonic
1136206956 16:28731845-28731867 ACAGATGCCCAGCTGCACCATGG - Exonic
1136254511 16:29029308-29029330 CCTGATCCCAAGGTGTTGCAGGG - Intergenic
1141143134 16:81510234-81510256 ACAGCTGCCCAGGAGCTCCACGG + Intronic
1141868860 16:86770607-86770629 ATAGAACCCCAGGTGCTGTCAGG + Intergenic
1142496813 17:310399-310421 ACAGAGCCTCAGGTGCTCCTGGG - Intronic
1142678506 17:1531100-1531122 TCAGGACCCCAGGTGCTGCTAGG + Intronic
1142713140 17:1734160-1734182 ACAGCTCACCACGTGCTGCGGGG - Exonic
1143432219 17:6895492-6895514 AAAGAACTCCAGGTGCTGCTGGG + Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1143965714 17:10755426-10755448 AAAGCTCCCCAGGTGATTCATGG + Intergenic
1145828354 17:27894252-27894274 ACAGATTCCCAGGTGCCACCGGG - Intronic
1146645769 17:34576709-34576731 ACAGAACCCCACTTGCTGCCTGG + Exonic
1148213709 17:45823231-45823253 ACAGATTCCCAGGTCCTCCTTGG - Intronic
1151428210 17:74044999-74045021 ACAGATAGCCAGGGGCAGCAAGG - Intergenic
1152388215 17:79987704-79987726 GCAGAACCCTGGGTGCTGCAGGG + Intronic
1155089502 18:22492905-22492927 GCAGGTCCCCAGGTCCTGCTGGG + Intergenic
1156532548 18:37832224-37832246 TCAGATCTCCAGCTGCTGCTTGG + Intergenic
1156613036 18:38750173-38750195 ACAGAGCCCCATGAGCAGCATGG - Intergenic
1157523607 18:48362208-48362230 ACAGATGCCCAGCTGCAGGAAGG - Intronic
1157698754 18:49745952-49745974 ACAGAACACCAGGAGCTGAAGGG + Intergenic
1159611089 18:70526411-70526433 ACAGATCACCAGGTGCTTAATGG - Intergenic
1160309922 18:77779520-77779542 ACATATTCCAAGGTGCAGCATGG - Intergenic
1161745874 19:6059592-6059614 ACAGAGCACCAGCTGCTGCTCGG - Intronic
1162430881 19:10627710-10627732 TCTGCTCCCCAGGGGCTGCACGG + Exonic
1163122105 19:15224114-15224136 CCAGATCGCCAGGGGCTGCGAGG - Intergenic
1163132057 19:15280487-15280509 GCAGATGGCCAGGTGCTGCAGGG - Intronic
1163476229 19:17527467-17527489 ACCGAACCCCATCTGCTGCATGG - Intronic
1163492947 19:17627678-17627700 AGGGATCCCAAGGGGCTGCAGGG + Intronic
1163494729 19:17639642-17639664 GCAGATCCCCAGTTGCTTCGAGG - Intronic
1164611474 19:29635302-29635324 ACAGTTCCCCAGGACCTGAAGGG - Intergenic
1166919708 19:46221007-46221029 CCACAACCCCAGGTGCTGCTGGG - Intergenic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
928911207 2:36423334-36423356 ACAGGTCTCCAGGTCCAGCATGG - Intronic
929464861 2:42135262-42135284 ACTGTCCCCCAGGGGCTGCAGGG + Intergenic
932490065 2:72114736-72114758 GCAGAGCCGCAGGTGCTGCGTGG - Intergenic
934514444 2:94977412-94977434 ACAGAGCCCTAGGTGCTCCTGGG - Intergenic
935335380 2:102010642-102010664 AAAGTTCCCCAGGTGGTGCGTGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937036889 2:118789450-118789472 ACAGCACCCCGAGTGCTGCAGGG - Intergenic
937968956 2:127535414-127535436 GCATCTTCCCAGGTGCTGCATGG - Intergenic
938069590 2:128301294-128301316 AGAGATCCCCAGGGGCTGCATGG + Intronic
939982906 2:148802150-148802172 AGAGACCCCCAGGAGCTTCATGG - Intergenic
946074991 2:217066523-217066545 ACGGATCCCCAGGTGCCACAGGG - Intergenic
947522867 2:230862037-230862059 ACAAGTTCCCAGGTGCTGCTGGG + Intergenic
948084982 2:235239881-235239903 GCACAGCTCCAGGTGCTGCAGGG - Intergenic
1168800221 20:639979-640001 CCAGAGCCCCAGGTGATGCTTGG - Intergenic
1169609293 20:7361310-7361332 TCAGATCTGCAGGTGCTGTAAGG - Intergenic
1170981281 20:21215906-21215928 ACAGAGACGCAGGTGCTGAAAGG - Intronic
1173811262 20:45957308-45957330 ACAGGGCCCCAGATGCCGCAGGG + Intronic
1173895371 20:46546564-46546586 TCACATCCTCAGGTACTGCATGG - Intronic
1174385495 20:50186507-50186529 ATAGATCCCCAAGGGCTGCCAGG - Intergenic
1174475753 20:50794847-50794869 ACTGATGCCCAGGTGCTGCGGGG + Intergenic
1175367327 20:58465076-58465098 ACAGATCCCCGGGGGCTGTGGGG - Intronic
1175933069 20:62502519-62502541 ACAGAGCCCCAGGAGCTGTCAGG - Intergenic
1179469188 21:41599181-41599203 ACAGATCCCCAGATGGGGAAAGG + Intergenic
1180161109 21:45999101-45999123 GCAGATGCCCGGGTGGTGCACGG + Intronic
1180975979 22:19848730-19848752 ACACACCCCCAGGAGCTGCCTGG + Exonic
950187081 3:10951889-10951911 CCACATCCCCAAGGGCTGCAGGG - Intergenic
950297948 3:11848122-11848144 ACAGACCCCTAGCTCCTGCAGGG - Intergenic
950565554 3:13767787-13767809 ACTGATTCCCAGTTGCTGCTGGG + Intergenic
950649913 3:14401030-14401052 GCTGATCCCCAGGTGCTTCCTGG + Intergenic
952232096 3:31442834-31442856 AATGATGCCCAGGTGCTGGAAGG + Intergenic
952888142 3:38024413-38024435 CCGGATCCCCAGGCACTGCATGG + Exonic
953169969 3:40498064-40498086 CCAGATCCCTGGGTGCTGCTTGG + Intergenic
953385997 3:42505917-42505939 ACAGAGACCCTGGTGCTCCAGGG - Intronic
953702625 3:45208482-45208504 CCTGATCCCCAAGGGCTGCATGG - Intergenic
954338386 3:49933988-49934010 TCAGAACCTGAGGTGCTGCAAGG - Intergenic
956343015 3:68247545-68247567 ACTGAGGCCCGGGTGCTGCAGGG + Intronic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962716953 3:138134628-138134650 ACAGATCCCTAGAAGCTCCAAGG + Intergenic
966086910 3:176079403-176079425 ACAGCTCCCCTAGTCCTGCAAGG - Intergenic
968505841 4:971170-971192 ACAGGGCCCCTGGTGCAGCATGG - Intronic
968573647 4:1355059-1355081 ACAGCTTCCCAGGTCCTGCCCGG + Intronic
969796822 4:9533228-9533250 ACAGCGCCCCAGGGGATGCAAGG - Intergenic
973191463 4:47390586-47390608 AGAAATCCCCAGGGGCTGAAAGG + Intronic
973569834 4:52226747-52226769 ACAGGTCTGCAGGTGCTGCCTGG + Intergenic
975727431 4:77305721-77305743 ACTGATGCCCAGGTGCAGCTGGG - Intronic
982084327 4:151818268-151818290 CCAGCTCTCCTGGTGCTGCAGGG + Intergenic
982158140 4:152540925-152540947 ACAGACACCCAGGGCCTGCAAGG + Intergenic
984936758 4:184896878-184896900 AGAGGTCGCCAGGGGCTGCAGGG + Intergenic
985151608 4:186953051-186953073 AGAGATCCCCAAGTGCTCCAAGG - Intergenic
986030453 5:3888578-3888600 GCAGGTCCCCAGGTGCTCCTTGG + Intergenic
986977523 5:13410580-13410602 GCAGATACCCCGGTTCTGCAAGG - Intergenic
987618874 5:20312530-20312552 ATAAATCAGCAGGTGCTGCATGG - Intronic
988427122 5:31076644-31076666 ACAGATCCGCTGCTGCTGGAGGG + Intergenic
992701156 5:79343116-79343138 GCACTTCCCCAGGTGCTGCAGGG - Intergenic
995372569 5:111435575-111435597 CAAGATCCCCAGGTTCTGCTTGG + Intronic
995730051 5:115229257-115229279 CCAGATACCCAGGTCCTGCTTGG + Intronic
996017543 5:118557275-118557297 ACAAACCCCCAGGTGCTGAATGG - Intergenic
997980191 5:138464091-138464113 ACGGCTCCCCAGGGACTGCAGGG + Intergenic
998642918 5:144032385-144032407 ATGGAGCCCCAGGAGCTGCAAGG - Intergenic
998682371 5:144483718-144483740 ACTGATCCCAAGGAGCAGCAGGG - Exonic
999218822 5:149958337-149958359 ACACATCCCAAGGAGCTCCATGG - Intergenic
1000231799 5:159322582-159322604 ACAGATCACCAGATGGTACAGGG + Intronic
1003380253 6:5618534-5618556 ACAGATCCCAAGATGTTTCAGGG + Intronic
1006127100 6:31846062-31846084 ACAGAAACCCAGGAGCTGCTTGG + Intergenic
1006446028 6:34080179-34080201 GCAGATCCCCAGCTGCAGCGAGG - Intronic
1007239126 6:40412498-40412520 CCAGAGCTCCAGGTCCTGCATGG - Intronic
1009672111 6:66768740-66768762 ACAGATCCCCAGCTATGGCAGGG + Intergenic
1010589863 6:77700076-77700098 TCAGATCTCCAGCTGCTGCTGGG + Intronic
1010652154 6:78467851-78467873 CCAGATCTCCAGCTGCTGCTGGG - Intergenic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1016750705 6:147628453-147628475 ACAGATCACCAGGAGCCACATGG + Intronic
1018029578 6:159831476-159831498 ACAGAGCTCCAGGTGCTGTCTGG + Intergenic
1020027050 7:4906609-4906631 ACAGAACATCAGGGGCTGCATGG + Exonic
1022407352 7:30103091-30103113 AGAGATTACCAGGTGCTGGAGGG + Intronic
1023982159 7:45076551-45076573 GCCGAGTCCCAGGTGCTGCAGGG - Intergenic
1024558843 7:50627114-50627136 ACAGGTCCCCACCAGCTGCAGGG + Intronic
1026963480 7:74424609-74424631 TCAGATCCCCAGGTGCCTTATGG + Intergenic
1027450547 7:78326502-78326524 ACAGATCCCCAGGACCTGAAAGG + Intronic
1031075610 7:117209285-117209307 ACAGCTGCTCAGGTGCTACAGGG - Intronic
1031862779 7:127000693-127000715 ACAGATTACCAGGGGCTGGAGGG + Intronic
1034030493 7:147757459-147757481 TCAGATCTACAGGTGCTTCATGG + Intronic
1036648487 8:10626512-10626534 ACAGGTCCACACGGGCTGCATGG + Intronic
1037288347 8:17324540-17324562 ACAGCTGCTCAGGTGCTGGATGG - Intronic
1039007892 8:33061025-33061047 ACAGATCCCTAGGTGCTCATGGG - Intergenic
1039610191 8:38913547-38913569 ACAGATTTGCAGGGGCTGCAAGG - Intronic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1043175209 8:77016556-77016578 ACACATCTCCAGGTGGTGCTAGG + Intergenic
1043757797 8:84025616-84025638 ACAAAACCCCTGGTGCTGAATGG - Intergenic
1045674356 8:104590499-104590521 AGAGAACCCCAGGTGCTGGCTGG + Intergenic
1048294742 8:133206052-133206074 ACAGCACCACAGGTGCGGCATGG + Intronic
1049546786 8:143235802-143235824 ACAGGTCCCAAGGGGCTCCATGG - Intergenic
1051361080 9:16282201-16282223 ACACACTCCCAGGTGCTGCTGGG - Intergenic
1056708092 9:88968806-88968828 ACTGAGCCCCGGGGGCTGCAGGG + Intergenic
1057568350 9:96184566-96184588 ACAAAGCCCCATGTGCTGCCTGG - Intergenic
1057863189 9:98658339-98658361 AAAGCTCCCCAGGTGCTCCATGG + Intronic
1058866628 9:109167103-109167125 CCAGACCCCCGGGTGCTGCCGGG + Exonic
1059435850 9:114275784-114275806 CCAGAGCTCCAGGCGCTGCAAGG - Intronic
1060724418 9:125997647-125997669 ACTGAGCCGCAGGTGCTGCTGGG - Intergenic
1060790598 9:126483086-126483108 ACAGAACCCCAGGGCCCGCATGG - Intronic
1061245273 9:129398392-129398414 AGAAATCCCCAGCTGCTGCTGGG - Intergenic
1062206550 9:135340854-135340876 ACAGCTGCACAGGGGCTGCACGG + Intergenic
1203778205 EBV:85774-85796 ACAGAGCCCGAGATGCCGCACGG + Intergenic
1186421787 X:9432593-9432615 ACAGTTTCTCAGGTGCTGCTAGG + Intergenic
1189186789 X:39061795-39061817 GCAGATTTCCAGGTGCTGCAGGG - Intergenic
1190456996 X:50636222-50636244 ACAACTTCCCAGGTGCTGCTGGG + Intronic
1192307041 X:69972337-69972359 ACAGAACCCCAAGGGCTCCAGGG - Intronic
1195655815 X:107330421-107330443 ACAGTTTCTGAGGTGCTGCAAGG + Intergenic
1199078355 X:143549435-143549457 ACAGAGGGCCAGGTGCTTCAGGG + Intergenic
1200002385 X:153068750-153068772 CCAGATCCCCAGGAGCAGCGTGG + Intergenic
1200005339 X:153081260-153081282 CCAGATCCCCAGGAGCAGCGTGG - Intergenic