ID: 1101330187

View in Genome Browser
Species Human (GRCh38)
Location 12:103751216-103751238
Sequence GACTTCCTGGAGGCTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101330181_1101330187 17 Left 1101330181 12:103751176-103751198 CCAGGGTTGGGTTTGTTTGACAG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1101330187 12:103751216-103751238 GACTTCCTGGAGGCTTGAATTGG 0: 1
1: 0
2: 2
3: 8
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101330187 Original CRISPR GACTTCCTGGAGGCTTGAAT TGG Intronic
901165915 1:7221455-7221477 GACTTCCTGGAGGCCTTCAAAGG - Intronic
901686979 1:10948457-10948479 GACTTCCTGGAGACTTGGCGGGG + Exonic
901837547 1:11934279-11934301 GACTTCCTTGGGGCTTGACCTGG + Intronic
902839993 1:19068498-19068520 GACTTCCTGGAGGAAAGAGTGGG - Intergenic
903558598 1:24211151-24211173 GACTTCCTGGAGAAGTGATTTGG - Intergenic
903910615 1:26722099-26722121 GCCTTCCTGGAGGTTTGATCAGG + Intronic
904162639 1:28532688-28532710 CACTTCCCAGAGGCTTGGATGGG + Intronic
904588975 1:31597544-31597566 CTCTTCCTGGAGTCTTGAGTTGG - Intergenic
906196122 1:43931835-43931857 GGCTGCCTGGAGTCTTGGATTGG - Intergenic
908945081 1:69486033-69486055 CACTTGCTGGAGGCTTGATATGG + Intergenic
914449896 1:147781896-147781918 GACTTCCCTGAGGGTAGAATGGG + Intergenic
915611609 1:156998029-156998051 AAGTTCCTGGAGGGTTGACTGGG - Intronic
917496577 1:175545975-175545997 GGCTTCCTGGAGAGTGGAATTGG + Intronic
917638811 1:176962232-176962254 GACTTCTTGGACACTGGAATGGG + Intronic
918085072 1:181238199-181238221 GACTTGCTGGTGGCTTGCATTGG + Intergenic
919820982 1:201471842-201471864 GTCTTCCTGGAGGCCTGAATGGG + Intergenic
920257026 1:204662371-204662393 GAATTACTGGAGGATTAAATGGG - Intronic
924371008 1:243349710-243349732 GACTTACTAGTGGCTTGGATGGG + Intronic
1065986985 10:30964278-30964300 GATTTAATGGAAGCTTGAATAGG - Intronic
1066826356 10:39584696-39584718 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1066868635 10:40463410-40463432 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1066922184 10:41518862-41518884 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1067166456 10:43869610-43869632 TACTTCCTGGCCCCTTGAATTGG - Intergenic
1067411543 10:46069105-46069127 GCCTTCCTGGAGGGGTGAAGTGG + Intergenic
1072035884 10:91562414-91562436 AACTTCCTAGAGACTTGAAGGGG - Intergenic
1072570976 10:96657236-96657258 GACTTCCTGCAGGGATGAAGAGG + Intronic
1072809303 10:98446809-98446831 CACTTCCGGGAGGGTTGAAGGGG + Exonic
1073028030 10:100502607-100502629 GAGTTCCTGGGGGGTGGAATAGG + Intronic
1074081394 10:110170609-110170631 GACACCCTGGAGGCAGGAATGGG + Intergenic
1075317946 10:121467190-121467212 ACCTTCCTGGAGGCTAGAACAGG - Intergenic
1076234821 10:128855471-128855493 GACTTTATGGTGGCTGGAATTGG + Intergenic
1077308872 11:1879784-1879806 GAGTTTCTTCAGGCTTGAATGGG + Intronic
1077799114 11:5520880-5520902 AACTTCCTGGAGGCCTCCATGGG + Intronic
1077946441 11:6905036-6905058 GCCATTCTCGAGGCTTGAATAGG + Intergenic
1078151227 11:8761146-8761168 CACTTCCTGAAAGCCTGAATTGG + Intronic
1081751747 11:45516111-45516133 GGCTTCCTGGAGGCAGGCATGGG - Intergenic
1082163523 11:48912277-48912299 GACTTCTTGGAGGCCTTCATTGG - Intergenic
1083939864 11:65890058-65890080 GACCTCCTTGAGGATGGAATCGG + Intergenic
1084666277 11:70578019-70578041 CACATTCTGGAGGCTGGAATGGG - Intronic
1087388758 11:97507986-97508008 TCCTTCATGGAGGCTTGATTAGG - Intergenic
1087999500 11:104859213-104859235 GAGTTGCTGGAGGCTTAGATTGG + Intergenic
1089109592 11:116044740-116044762 TACTTCCTGGAGGCAGGAAGAGG + Intergenic
1090596837 11:128329429-128329451 CAATTCCTGGAGCCTTGAAAAGG - Intergenic
1093210454 12:16301917-16301939 GACTTCCTGTAGCCTTGACTTGG - Intergenic
1094883585 12:34834241-34834263 GACTTCTTTGAGGCTTTCATTGG - Intergenic
1095029554 12:37252029-37252051 GACTTCTTTGAGGCTTTCATTGG - Intergenic
1095029872 12:37258911-37258933 GACTTCTTTGAGGCTTTCATTGG - Intergenic
1095030023 12:37261282-37261304 GACTTCTTTGAGGCTTTCATTGG - Intergenic
1095474596 12:42572863-42572885 TACTTCCTGGTGGTTAGAATAGG - Intronic
1100113301 12:91271823-91271845 GACTTCCTGGAAGCTTATATGGG + Intergenic
1101330187 12:103751216-103751238 GACTTCCTGGAGGCTTGAATTGG + Intronic
1101780750 12:107832786-107832808 GGCTGCCTTGAGGGTTGAATGGG - Intergenic
1102015277 12:109644280-109644302 GACTTTGTGGGGGTTTGAATAGG - Intergenic
1104756153 12:131270519-131270541 GACATCTTGGAGGCCTGAGTGGG - Intergenic
1104777626 12:131400506-131400528 GACATCTTGGAGGCCTGAGTGGG + Intergenic
1107651284 13:42547694-42547716 GACTGCCTGGAAGCCTGCATTGG - Intergenic
1108631875 13:52292257-52292279 AACTTCCTGAAGGCTTCAGTAGG - Intergenic
1109872214 13:68347196-68347218 GACTTACTGGAGACTTGAAGAGG - Intergenic
1112146598 13:96707063-96707085 TGCATCCTGGAGGCTTGGATTGG + Intronic
1113867542 13:113537087-113537109 AACGACCTGGAGGCTTTAATAGG - Intronic
1122367345 14:101201928-101201950 GGCTTTCTGGAGGCTGGAAGGGG + Intergenic
1122548447 14:102537698-102537720 GACCTCCTGGAGGCTGGATAAGG - Intergenic
1202901200 14_GL000194v1_random:40911-40933 TACTTGGTGGAGGCTTTAATTGG + Intergenic
1124136675 15:27041793-27041815 GTCTTCCTGGAGGCTTAGAGAGG - Intronic
1125475384 15:40044738-40044760 GAGTTCCTGGAGCCCTGAGTTGG - Intergenic
1126490829 15:49233765-49233787 GTCTTCCTGGAGGCTCAAAGAGG - Intronic
1127850543 15:62908269-62908291 GACTTCTTGCAGACTTGAAGAGG + Intergenic
1128087139 15:64894212-64894234 GACTTACAGGAGGCTGGAAACGG + Intronic
1128749785 15:70140694-70140716 GGCTGCCTGGAGCCTTGACTGGG - Intergenic
1129661250 15:77554279-77554301 GAACTCCTGGAGGCTGGAGTTGG - Intergenic
1129758344 15:78112060-78112082 GATTTCCTGGAGGCTGGGACAGG - Intronic
1130210922 15:81920509-81920531 GACTTCCAGGGGGATTGAAAAGG + Intergenic
1130838040 15:87671213-87671235 GACTTCCTGCAGGAGTGACTGGG - Intergenic
1132616811 16:845165-845187 GACGTGTTGGGGGCTTGAATCGG + Intergenic
1134193917 16:12143708-12143730 GACTTTTTGCAGGCTTGAAATGG - Intronic
1137742896 16:50798210-50798232 GACTACCTGGAGGAATGATTAGG + Exonic
1137750296 16:50856656-50856678 GACGTCCTGTGGGCTTGAGTGGG + Intergenic
1139231815 16:65290673-65290695 GGCTACCTGGAGGGTTGAACAGG + Intergenic
1139291652 16:65863995-65864017 GATTTTCTGGAGGCTTCAAAGGG + Intergenic
1141386024 16:83623243-83623265 GGCTTCCTGGAGTCTGTAATAGG - Intronic
1142772726 17:2111141-2111163 GTATTCCTGGTGGTTTGAATAGG - Intronic
1144419483 17:15083272-15083294 GACTTATTTGAGGCTTGGATTGG - Intergenic
1152202905 17:78957477-78957499 GACATCCAGGAGGCTTGCAATGG + Intergenic
1152284632 17:79404954-79404976 GATTTCCTGGAGTCTAGACTAGG - Intronic
1152293598 17:79454292-79454314 GACTCCCTGGAAGCTGGATTTGG - Intronic
1153489274 18:5630562-5630584 GAGCTCCTGGAGGCTGGAAGGGG + Intronic
1154055081 18:11005063-11005085 GACTTCTTGTTGGCTTGAAGTGG - Intronic
1155340434 18:24808789-24808811 GACTTCCTGCTGGCAAGAATTGG - Intergenic
1156318902 18:35999214-35999236 GACTTCATGGAGTGTTGACTGGG - Intronic
1157775601 18:50393451-50393473 AACTTCCTGGAAGCTGGATTTGG + Exonic
1161712588 19:5857694-5857716 GGCTTCCTGGAGGTTTGAGCTGG + Intergenic
1162876162 19:13622547-13622569 GACTTCCTGCAGCCTGGTATTGG + Intronic
1165911054 19:39227871-39227893 GTCTTGCTGGAGTTTTGAATAGG - Intergenic
1166319190 19:42006011-42006033 GACTTCCTGGAGGATGGGAAGGG - Intronic
1166563502 19:43748919-43748941 GACTTCCAGGAGGCTAGGAAGGG + Intronic
1167299682 19:48671574-48671596 GACTGCCTGGGGGCTGGGATAGG + Intronic
925507397 2:4583780-4583802 GGCTTCCTGGAGGCCTGTGTGGG + Intergenic
929846008 2:45528387-45528409 GACTTCATGGTAGTTTGAATGGG + Intronic
930685422 2:54302370-54302392 TACTTCCTGAGGGCTTGATTGGG + Intronic
935330515 2:101974160-101974182 GACTTCTAGGAGGGATGAATGGG + Intergenic
935593630 2:104863351-104863373 GAGTTGCTGGAGGCTGGAGTCGG + Intergenic
938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG + Intronic
938820654 2:134955421-134955443 AACTTTCTGAAGGCTTGAAGAGG + Exonic
939253128 2:139709080-139709102 GACTTCCTGGACTCCAGAATTGG - Intergenic
940440859 2:153714668-153714690 GAGCTCTTGGAAGCTTGAATAGG - Intergenic
943540240 2:189204733-189204755 GACTGCCTGGAGGATTGTAGTGG + Intergenic
946683904 2:222247166-222247188 TACTTCATTGAGGCCTGAATAGG - Intronic
947375780 2:229493662-229493684 GACTTCCTGAATGAATGAATGGG - Intronic
1170395084 20:15917043-15917065 TACATCCTGGAGGCTTGTCTCGG - Intronic
1171110386 20:22475594-22475616 GAGTTCCAGAAGTCTTGAATAGG - Intergenic
1171893181 20:30735680-30735702 TACTTGGTGGAGGCTTTAATTGG - Intergenic
1173479691 20:43389359-43389381 GACTTACTGGAGCCTTGGACGGG + Intergenic
1173671423 20:44801709-44801731 GACTTCCTAGAGGCTTTATGAGG + Intronic
1176620575 21:9055689-9055711 TACTTGGTGGAGGCTTTAATTGG + Intergenic
1179112751 21:38461455-38461477 GCCTTCCTGGAGGATGGTATGGG - Intronic
1179180839 21:39043611-39043633 GTCTCCATTGAGGCTTGAATGGG - Intergenic
1180683186 22:17643536-17643558 GACTCACTGGTGGCTTGAACAGG - Intronic
1184697535 22:46148506-46148528 GACTTCCTGGAGCTGGGAATGGG + Intergenic
949131929 3:513656-513678 GAAATGCTGGAGGCTTGAACAGG + Intergenic
952716125 3:36482757-36482779 GAGTTCCTGGAGTAGTGAATAGG + Intronic
954608852 3:51933720-51933742 GACTTCCTGGTGGCTGGGGTAGG - Exonic
958404905 3:93744080-93744102 GACTGCCTTGAGGCTTTCATTGG - Intergenic
959096672 3:101964127-101964149 CACTCACTGGAGGCTTGAAAAGG - Intergenic
959928054 3:111946885-111946907 GAGATGCTGGTGGCTTGAATTGG + Intronic
961638953 3:128352778-128352800 GAGTTGCTGGAGGTTTAAATGGG - Intronic
962267012 3:133951049-133951071 GACTTCCCAGAGGCTTTAAGAGG - Intronic
968138238 3:196234643-196234665 GTGTTCCTGGAGGTTTGAAGTGG - Exonic
968630739 4:1649715-1649737 GGTTACCTGGAGGCTTGACTGGG - Intronic
968950610 4:3689595-3689617 GACGTCCTGGAGGCTTGTCAGGG - Intergenic
972304495 4:37819164-37819186 GACTTCCTGGAGGACAGAAATGG - Intergenic
973822663 4:54676709-54676731 GAGATACTGGAGGCTTGAAAGGG - Intronic
977577644 4:98691818-98691840 GAATTCCTGGAGCCCTCAATGGG - Intergenic
981529109 4:145734889-145734911 GACTTCCCGGAGGCTAGAGCAGG + Intronic
983650738 4:170033947-170033969 GACTTCCTTGCTGCTTTAATAGG + Intergenic
984794560 4:183646503-183646525 AACTTCCTCGAGGCTGGAACTGG - Exonic
984812327 4:183806426-183806448 GGCTTCCTGGTGTCTTGAAGGGG + Intergenic
986709763 5:10480321-10480343 GACTTCCAGGAGGCTGGAGGGGG + Intergenic
987073529 5:14359683-14359705 GGGTCCCTGGAGGCTGGAATTGG + Intronic
988858633 5:35253646-35253668 AACTTCCTGGAGACTTAAAGGGG - Intergenic
989691151 5:44145748-44145770 AACTTCCTGGAGGAGGGAATGGG + Intergenic
1000867530 5:166533629-166533651 GGCTTCTTGGATGCTGGAATAGG - Intergenic
1001092777 5:168753698-168753720 GACATTCTGGAGCCTTGGATGGG - Intronic
1001276507 5:170355244-170355266 GAATTCCTGGAGGCCAGAAGTGG + Intronic
1003775233 6:9353040-9353062 CACTTCCTTGAGGCTTGATGTGG + Intergenic
1003893597 6:10585686-10585708 GGCTTCCTAGAGGCTGGACTGGG + Intronic
1004282667 6:14294233-14294255 GACTTCCTGGAGCCTGGAAGTGG + Intergenic
1004640578 6:17511357-17511379 GACTTCCTTGAGGTTTAAACAGG + Intronic
1009254803 6:61373680-61373702 GACTTCTTTGAGGCTTTCATTGG + Intergenic
1009478629 6:64126927-64126949 GTCTTACTGGAGCCTAGAATAGG - Intronic
1010067894 6:71707615-71707637 GACTTCCTAGAACCTTTAATAGG + Intergenic
1010425044 6:75720252-75720274 GACTTCTTGGAGTCTTTAATAGG + Intergenic
1013833564 6:114303863-114303885 GTCTTCCTGAAGGCTTGATATGG - Intronic
1015888575 6:137946082-137946104 GTCTCCTTGGAGGCTTGAAGGGG + Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1017324866 6:153132205-153132227 GAGTTCCTGCAGGAGTGAATGGG + Intergenic
1023407804 7:39854545-39854567 AACTTCCTCGAGGCTGGAACTGG - Intergenic
1023702254 7:42904265-42904287 GAATGCCTGGAGGCTTGGCTTGG + Intergenic
1023901754 7:44486831-44486853 CACTTCCTGGTGGTGTGAATGGG - Intronic
1028097210 7:86775993-86776015 GACTTCCTGGAGGACTGTAGGGG + Intronic
1030023814 7:105302013-105302035 AACTTCCTCGAGGCTGGAACTGG + Intronic
1034630950 7:152530199-152530221 GAAATCATGGAGGCCTGAATGGG + Intergenic
1036760517 8:11505753-11505775 CACTCCCTGGAGGCCTCAATGGG - Intronic
1038322543 8:26540937-26540959 GACTTCCTGATGGCTTTATTGGG - Intronic
1042029707 8:64462673-64462695 GTCTGCCGGGAGGCTTGAAGAGG + Intergenic
1042111757 8:65388676-65388698 GACTTCAGGGAGGAATGAATAGG - Intergenic
1043986460 8:86698412-86698434 TACTTGGTGGAGGCTTTAATTGG + Intronic
1044538419 8:93383403-93383425 GACTTCCTGAAGCCTTTTATAGG - Intergenic
1047521348 8:125597552-125597574 GACTTTCTTGTGGCTAGAATTGG + Intergenic
1048511710 8:135068862-135068884 GTGTTCCTGGAGGGGTGAATTGG + Intergenic
1049016622 8:139924554-139924576 GGCTTCCTGGTGGCTGGAATAGG - Intronic
1049335223 8:142080721-142080743 GACTTCTCAGAGCCTTGAATCGG - Intergenic
1050650937 9:7776049-7776071 GACTTCCTGGATGCTTCAGGAGG - Intergenic
1051721191 9:20039325-20039347 GACGACCTGGAAGCTGGAATTGG + Intergenic
1051997549 9:23236153-23236175 TACTTTCTGGAATCTTGAATTGG - Intergenic
1053466518 9:38312476-38312498 GCCTGCCTTGAGGCTTGAAGAGG + Intergenic
1054355457 9:64057041-64057063 TACTTGCTGGAGGCTTTAATTGG + Intergenic
1061361174 9:130143263-130143285 GACTTCCTGGAGGCTGGCATTGG + Intergenic
1062593600 9:137287189-137287211 GAGTTTCTGGAGGCTGGAAAGGG + Intergenic
1203566325 Un_KI270744v1:93397-93419 TACTTGGTGGAGGCTTTAATTGG - Intergenic
1186713532 X:12226301-12226323 GACTTCTAGGAGGATAGAATGGG + Intronic
1187896165 X:23981573-23981595 GACTTCTGGGAGCCTTTAATAGG + Intergenic
1190756182 X:53404025-53404047 AACATCATGGAGGCTTGACTAGG - Intronic
1193987363 X:88260527-88260549 TACTTCATAGAGGCTTTAATTGG + Intergenic
1195770304 X:108343904-108343926 CACTTCCAGGATGCTTGATTGGG - Intronic
1196562318 X:117164905-117164927 TGCTTGCTAGAGGCTTGAATGGG + Intergenic