ID: 1101330205

View in Genome Browser
Species Human (GRCh38)
Location 12:103751344-103751366
Sequence GGCTGTGACCCCCTAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101330203_1101330205 -3 Left 1101330203 12:103751324-103751346 CCATGAGGAAGACACATGAAGGC 0: 1
1: 0
2: 3
3: 32
4: 211
Right 1101330205 12:103751344-103751366 GGCTGTGACCCCCTAGTGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101330205 Original CRISPR GGCTGTGACCCCCTAGTGGC AGG Intronic
902591246 1:17476273-17476295 GCCTATGACCCCCGAGTGGAGGG - Intergenic
903178170 1:21592728-21592750 GGCTGTGCCCACCTAGGAGCTGG - Intergenic
904217167 1:28930597-28930619 GCCTCAGACCCCCTAGTAGCTGG + Intronic
907220932 1:52906518-52906540 GCCTGTGACCTCCGAGTGGCAGG - Exonic
908880354 1:68724806-68724828 GCCTGTGCCTCCCAAGTGGCTGG - Intergenic
918304681 1:183235161-183235183 TGCTTTGTCCCCCTAGTGGTGGG + Intronic
920929861 1:210377094-210377116 GGCTGTGGCCCCCAACAGGCTGG + Intronic
923079412 1:230639779-230639801 GGCAGTAACCCTCTAATGGCTGG + Intergenic
924528285 1:244871246-244871268 GCCTGAGTCCCCCTAGTAGCTGG - Intergenic
1064030773 10:11881226-11881248 GGCTGTGACCTCCTGGAGGTGGG + Intergenic
1065319062 10:24492165-24492187 GTCTGTGCCCCCCATGTGGCAGG + Intronic
1065905094 10:30243535-30243557 GGGTGTGACCCACCAGTGCCTGG + Intergenic
1072190827 10:93074947-93074969 GGCTGCGAACCCCAACTGGCGGG + Exonic
1073346437 10:102786472-102786494 GACTGAGACCCTCTAGGGGCAGG - Intronic
1074458181 10:113613594-113613616 GGTTGTGACCCTCTGGAGGCTGG - Intronic
1074553815 10:114469988-114470010 AGCTGAGACCCCCTAGAGACAGG - Intronic
1076049180 10:127319011-127319033 TGCTCTGACACCCTAATGGCAGG + Intronic
1076132227 10:128021322-128021344 GACTGTGACCTCCTGGGGGCAGG + Intronic
1077243298 11:1523252-1523274 GGCTGTGAACCGCTCCTGGCCGG + Intergenic
1077467286 11:2739399-2739421 GGCTGTGACATCCAAATGGCTGG - Intronic
1078011975 11:7579362-7579384 GACTGTGATGCCCTAGGGGCTGG - Intronic
1078860180 11:15239624-15239646 GGCTGTGAGCCCCTGGGGTCAGG - Intronic
1079156377 11:17951844-17951866 GGCTCTGACCCCTGAGTGGCGGG - Intronic
1079172815 11:18112563-18112585 GGCTGTGAGCCCCTGAGGGCAGG - Intergenic
1081669754 11:44936484-44936506 GGCTGTGAATTCCTAGAGGCTGG + Intronic
1085079795 11:73624751-73624773 GGCTGTGACCCACCAGTGTGAGG - Intergenic
1091032935 11:132207399-132207421 AGATGGGACCCCCTAGTTGCAGG + Intronic
1094396926 12:30016955-30016977 TGCTGTGACCCCCTAATTGCAGG - Intergenic
1099077672 12:78131038-78131060 GGGTTTGACCCCTTAGTGTCTGG - Intronic
1101330205 12:103751344-103751366 GGCTGTGACCCCCTAGTGGCAGG + Intronic
1106144606 13:27039959-27039981 GGCTGGGACCCCCGGGTGGACGG - Intergenic
1108731863 13:53243474-53243496 GGCTGTCACCCCCAAGTTGAGGG + Intergenic
1112015546 13:95328422-95328444 GGCTGAGACTCCCAAGTAGCTGG - Intergenic
1112349719 13:98622808-98622830 GGCTGTGACCCTCAGCTGGCTGG + Intergenic
1113489651 13:110681008-110681030 TGCGGTCACCCCCTAGTGGAAGG - Intronic
1113739760 13:112703238-112703260 GGCTGTGTCCTCCCAGAGGCGGG + Intronic
1118286670 14:64480754-64480776 GCCTCTGCCCCCCTAGTAGCTGG + Exonic
1121414188 14:93767689-93767711 GGGTGTGGCCCCATAATGGCAGG - Intronic
1122153173 14:99735455-99735477 GGCTGTGTCCCCCTCTTGGTTGG - Intergenic
1122609024 14:102968875-102968897 TGCTGTGACCCCCTAGAACCTGG - Intronic
1125501046 15:40240474-40240496 GGCTGTGTGCCCACAGTGGCAGG + Intronic
1125734191 15:41912110-41912132 GGCTGTGAAGGCCTAGTGTCGGG - Intronic
1125901623 15:43353558-43353580 GGCTGGCAGCCCCTAGGGGCTGG + Exonic
1129855549 15:78822163-78822185 GCCTCAGACCCCCTAGTAGCTGG + Intronic
1130021434 15:80234996-80235018 GACTCTGCCCCCCTGGTGGCTGG + Intergenic
1130205277 15:81869808-81869830 GGCTGTGTCCCTCTAGTGAAAGG + Intergenic
1130418377 15:83715557-83715579 GGCTTTGAGCCCCTAGGGGCAGG + Intronic
1132426217 15:101719638-101719660 GGCCAAGACCCCATAGTGGCTGG - Intronic
1132994704 16:2817085-2817107 GGCTTTCAGCCCCTAGGGGCGGG - Intergenic
1133981227 16:10634672-10634694 GACTGTGACATCCTTGTGGCTGG + Intronic
1135607648 16:23837140-23837162 GGCTGCGACCACCAGGTGGCGGG - Intronic
1137930560 16:52583478-52583500 GACTGTGATTCCATAGTGGCTGG + Intergenic
1138345616 16:56318326-56318348 GGCTGGGCCCCCCCAGCGGCTGG + Intronic
1141346556 16:83251836-83251858 GGCTGGGTCCACCTAGAGGCAGG + Intronic
1142693070 17:1618592-1618614 GGCTGTGAGCCCCGAAGGGCAGG + Intronic
1144661692 17:17074900-17074922 GGCTGTTACCACCTTTTGGCAGG + Intronic
1147154923 17:38539635-38539657 GGCTGTGACTCCCTGGGGGAAGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1149828812 17:59853381-59853403 AGCGGTGGCCTCCTAGTGGCCGG + Intergenic
1152738890 17:82010638-82010660 GGCTTTGACTCCCCCGTGGCAGG - Intronic
1155316493 18:24577127-24577149 GCCTCAGCCCCCCTAGTGGCTGG + Intergenic
1157599485 18:48885380-48885402 GGCTGAGAGCCCCTACTGGAAGG - Intergenic
1160551084 18:79694161-79694183 GGCTGTGAGCACCTAGGGGCGGG + Intronic
1161034874 19:2079036-2079058 AGGTGTGAGCCACTAGTGGCAGG + Intronic
1163288111 19:16361901-16361923 CGCTGTCAGCCCCGAGTGGCTGG + Exonic
1163632704 19:18425367-18425389 TGCTCTGACCCCTAAGTGGCTGG + Intronic
1163747679 19:19057829-19057851 GGCTGGGACCCAGAAGTGGCTGG - Exonic
1164726278 19:30467992-30468014 GGGTGTGACCCCACAGTGCCTGG + Intronic
1164947043 19:32304467-32304489 AGCTGTGACCCCATGGTGGAGGG + Intergenic
1167246813 19:48377977-48377999 GCCTCTGACTCCCAAGTGGCTGG - Intergenic
1168128085 19:54298311-54298333 GCCTGTGACCACCTGGTGTCAGG - Intergenic
1168132657 19:54331354-54331376 GCCTGTGACCCTCTGGTGTCAGG - Intergenic
925109722 2:1323500-1323522 GGCTGAGACCCCCTGTAGGCTGG + Intronic
925109741 2:1323587-1323609 GGCTGAGACCCCCTGTAGGCTGG + Intronic
925258281 2:2507932-2507954 GGCTCTGAACACCCAGTGGCTGG - Intergenic
926096875 2:10087073-10087095 GGCTGTATCCCCCTAGAGGAAGG + Intergenic
927869277 2:26613456-26613478 GGCTGTGCCCTCTGAGTGGCAGG - Intronic
928003586 2:27542960-27542982 AGCTGGGACTCCCTAGTAGCTGG - Intronic
930469084 2:51791204-51791226 GCCTGAGACTCCCTAGTAGCTGG + Intergenic
930742575 2:54847020-54847042 GCCTGTGCCCCCCAAGTAGCTGG + Intronic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
942722305 2:178966329-178966351 GTCTGTCACCCCCTACTGGGAGG - Intronic
946420174 2:219560549-219560571 GCCTCTGGCCCCCTGGTGGCTGG + Intronic
947483633 2:230526144-230526166 GTCCGTGAGCCCCTACTGGCAGG - Intronic
948118280 2:235510061-235510083 AGCTGGGACCCTCTAGTTGCAGG + Intronic
1170694698 20:18647789-18647811 AGCTGTGACCCTCTTGTAGCAGG + Intronic
1174132194 20:48353098-48353120 GGCTGTGACCCAGAAGTGTCGGG - Intergenic
1174393961 20:50234541-50234563 GGCTGTGACCCCGTGGTGGTGGG + Intergenic
1174611436 20:51801470-51801492 GGGTGCGAGCCCCCAGTGGCCGG - Intronic
1174903072 20:54521362-54521384 GGCTGGGACCCCCTTGTGGTTGG - Intronic
1175071445 20:56337185-56337207 GTCTGTCAGCCCCTACTGGCAGG - Intergenic
1175250949 20:57609961-57609983 GGCTCCGTCCCCCTAGTGGAGGG - Intronic
1175312364 20:58020607-58020629 GGCGGTGACCCCCCAGTCCCTGG + Intergenic
1175479886 20:59303229-59303251 GGCTGTGTCCACCTAGAGGATGG + Intronic
1176126118 20:63475645-63475667 GGCTGTGACCGCCTACTGCCCGG + Intergenic
1178943377 21:36926026-36926048 GCCTGTCACCCACTGGTGGCGGG + Intronic
1180335565 22:11574257-11574279 GGCCGTGAGCCCCTAGTGCAGGG - Intergenic
1180997369 22:19972160-19972182 GGCTCTGACCCACAAGTGGAGGG - Intronic
1183027836 22:35079522-35079544 GGCTGTGAGCCCCTGGAGGGTGG - Intronic
1184219840 22:43092755-43092777 GCCTCAGCCCCCCTAGTGGCTGG - Intergenic
1184281358 22:43439441-43439463 GGCTGTGAGCTCCCTGTGGCTGG - Intronic
949207173 3:1454138-1454160 AGATGGGACCCTCTAGTGGCAGG - Intergenic
949922682 3:9015235-9015257 GGCTGGGACACCCTCTTGGCTGG + Intronic
950169819 3:10830712-10830734 GGTGGTGACCCCATAGTGGGAGG + Intronic
954378873 3:50209102-50209124 GACTGTGGCCCCCCAGGGGCAGG - Intronic
954485800 3:50850243-50850265 GCCTCAGCCCCCCTAGTGGCTGG - Intronic
955349746 3:58184650-58184672 GGCTGTGAGGCCCTAGGGGATGG - Intergenic
958882557 3:99689334-99689356 AGCTGTGAGCCCTTAGTGGCAGG + Intronic
961832849 3:129633124-129633146 TGCTGTGACCCACTTGTGGCGGG + Intergenic
968427453 4:533275-533297 GGCTGTGCTCCCCCAGTGGCTGG + Intronic
968627011 4:1630275-1630297 GGCTCTGACCCCCTGGTCACGGG - Intronic
968946777 4:3669056-3669078 GACTGTGAGGCCCTAGTGGCTGG + Intergenic
977946528 4:102920139-102920161 GTCTGTCAGCCCCTACTGGCAGG - Intronic
986771684 5:10979452-10979474 GTCTGTGACCCCCTGGTGAATGG - Intronic
992253254 5:74896514-74896536 GGCTCTGACTCCCAAGTAGCTGG - Intergenic
995093849 5:108212742-108212764 GTCTGTCAGCCCCTAGTGGGAGG + Intronic
995108275 5:108399490-108399512 GTCTGTCAGCCCCTAGTGGGAGG - Intergenic
997359923 5:133288534-133288556 GGTTTTGAGCCCCTCGTGGCTGG - Intronic
997531062 5:134581533-134581555 GGCTGGGCCTCCCTGGTGGCAGG + Exonic
1002174614 5:177394520-177394542 GGCTGTGAGCCCCTCAGGGCAGG - Intronic
1002420980 5:179148933-179148955 GGCTAGGACCCCCCAGGGGCCGG - Intronic
1003126187 6:3357792-3357814 GACTGTGAGCCCCTTGAGGCCGG - Intronic
1003907337 6:10714072-10714094 GGCTCAGCCCCCCTAGTAGCTGG - Intergenic
1005526875 6:26659776-26659798 GGTTGGAACGCCCTAGTGGCCGG - Intergenic
1005782028 6:29202142-29202164 GGCTGTGACACCCTTTTGGGTGG + Intergenic
1006388394 6:33744978-33745000 GGCTGTGGCACCCTGGTGGGTGG + Intronic
1007781155 6:44255579-44255601 GGCTGTGGCCCCATAGCTGCGGG + Exonic
1013207780 6:107959585-107959607 GGCTGTGGGACCCTAGAGGCTGG + Intergenic
1015097493 6:129432893-129432915 TACTATGACCCCCTAGTGGGAGG + Intronic
1019524283 7:1473814-1473836 GCCTGTGACGCCCCAGTGGTTGG - Intronic
1019544215 7:1565387-1565409 GGCTGTGAACCCGCAGGGGCAGG + Intergenic
1021052414 7:16004636-16004658 GGCTGGCCCACCCTAGTGGCTGG + Intergenic
1021360440 7:19706439-19706461 GGCTGTGGTCCCCTGGTGGAAGG + Intronic
1023601083 7:41882460-41882482 GGCTGTGAACTCATACTGGCCGG + Intergenic
1026480715 7:70776918-70776940 GGCTGTGACTCCCTTATGACTGG + Intronic
1026822313 7:73557731-73557753 GGCCGTGAGCCCCAAGGGGCGGG - Exonic
1026896023 7:74010521-74010543 AGCTGTGACCCCCTCCTCGCTGG + Intergenic
1031150044 7:118043091-118043113 GGCTGTGGCCCCGAAGTTGCAGG - Intergenic
1042432573 8:68726021-68726043 GGCTCTGGCTCCCTAGTGTCTGG + Intronic
1048112837 8:131487110-131487132 GGCTGTGCACTCCTAGCGGCAGG + Intergenic
1048137282 8:131758639-131758661 GCCTCAGACCCCCTAGTAGCTGG + Intergenic
1049463716 8:142741634-142741656 GGCTGTGCCACCCTCGTGGAAGG + Intronic
1049790368 8:144469634-144469656 GGCTGTCACCTCCTCCTGGCTGG - Exonic
1051608492 9:18939396-18939418 GGCTGTAACCTCCAAGGGGCAGG - Intronic
1052369273 9:27645670-27645692 GGCTCTGACTCCCTAGGGGGAGG + Intergenic
1055186457 9:73461480-73461502 GGCTGAGAGCCCCGAGTGCCTGG + Intergenic
1055501162 9:76903700-76903722 GCCTCTGCCCCCCTAGTAGCTGG + Intronic
1057721515 9:97535554-97535576 GGCTGTGAGCCCCTCTGGGCTGG + Intronic
1058499992 9:105603786-105603808 GGCTCAGACCCCCAAGTAGCTGG + Intronic
1060990821 9:127847850-127847872 TGCTGAGACCTCCTGGTGGCTGG - Intronic
1061138295 9:128749211-128749233 GCCTCAGCCCCCCTAGTGGCTGG - Intronic
1061550099 9:131329407-131329429 TGCTGTGACACCTTAGGGGCTGG + Intergenic
1187239586 X:17500500-17500522 GGCTGTGATCCCATTGTTGCTGG + Intronic
1190296318 X:49029879-49029901 GGCTGTGATCCCCAGGGGGCAGG + Exonic
1191139604 X:57103120-57103142 GGCTGTCACTCCCTGGTGCCGGG + Intergenic
1197701688 X:129604737-129604759 GGCTGTGACCCCAGAGAGGGAGG + Intergenic
1199088040 X:143651718-143651740 GGCTGTGTGATCCTAGTGGCTGG + Intergenic
1199225467 X:145367905-145367927 GCCTGAGCCCCCCTAGTAGCTGG + Intergenic