ID: 1101330949

View in Genome Browser
Species Human (GRCh38)
Location 12:103757558-103757580
Sequence CTGTCTGAAGTGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101330940_1101330949 -9 Left 1101330940 12:103757544-103757566 CCAGGGTCCCCCTTCTGTCTGAA 0: 1
1: 2
2: 3
3: 83
4: 809
Right 1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 313
1101330938_1101330949 -7 Left 1101330938 12:103757542-103757564 CCCCAGGGTCCCCCTTCTGTCTG 0: 1
1: 0
2: 3
3: 31
4: 328
Right 1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 313
1101330929_1101330949 27 Left 1101330929 12:103757508-103757530 CCTATGGAAAAAGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 216
Right 1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 313
1101330939_1101330949 -8 Left 1101330939 12:103757543-103757565 CCCAGGGTCCCCCTTCTGTCTGA 0: 1
1: 2
2: 3
3: 85
4: 760
Right 1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG 0: 1
1: 0
2: 2
3: 32
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101330949 Original CRISPR CTGTCTGAAGTGATGGGGGA AGG Intronic
901330831 1:8407069-8407091 CTGTCTGCAGTGTTTGGGGCAGG + Intronic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902158682 1:14511379-14511401 CTCCCTGAAGTGATTGGGGCTGG - Intergenic
902378485 1:16041626-16041648 CTGTCTTCAGTGAGAGGGGAAGG - Intergenic
902780006 1:18698926-18698948 GTGTCTGCTGAGATGGGGGAGGG - Intronic
902960366 1:19958941-19958963 CAGTCTGAATTGATGAGGAAGGG - Intergenic
905342291 1:37287568-37287590 CTGACTTAATTGATCGGGGATGG + Intergenic
907138782 1:52164914-52164936 CTGTCAGAAGCTATGGGGAAGGG + Intronic
907284371 1:53370628-53370650 CTGTCTGAGGTGATGAGAGAGGG - Intergenic
907750729 1:57260774-57260796 TTGCATGCAGTGATGGGGGAAGG - Intronic
912813757 1:112812817-112812839 TTGACTGAAGTAATGGGGGGGGG - Intergenic
912948274 1:114102817-114102839 CAGTCTGAGCTGATGAGGGAAGG + Intronic
913217330 1:116631433-116631455 CTGGCAGAAGTGATGGGAAAGGG + Intronic
913219918 1:116651039-116651061 CTGTCTGAAGGGTTGTGGGCTGG - Intronic
915945093 1:160143958-160143980 CTATCTGATGGGATGGGGGAAGG + Intergenic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917641156 1:176984318-176984340 CAATTTTAAGTGATGGGGGATGG + Intronic
918038757 1:180899415-180899437 CTGTCTGCAGTGTCGGGGGTGGG - Intergenic
918097497 1:181347130-181347152 TTCTTCGAAGTGATGGGGGATGG - Intergenic
919754138 1:201056229-201056251 CTGTCTGATGTGCTAGGGGAGGG - Intronic
922026768 1:221757073-221757095 GTGTTTGTGGTGATGGGGGAGGG - Intergenic
922613466 1:226946420-226946442 CTGGCTGAAGCGTTGGGGCACGG + Intronic
922653061 1:227357591-227357613 CTGTCGGAAGTGTTGGCCGAAGG - Intergenic
922868304 1:228879838-228879860 GTGTCTGAATTAATGGGGGTGGG - Intergenic
922960773 1:229644095-229644117 CTGTCAGAACTGAAGGGGGTAGG - Intronic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923903074 1:238350550-238350572 CTGACTGAAGGGATTGGGGAAGG - Intergenic
924006054 1:239612749-239612771 CCTTCTGAAGTGAGGTGGGATGG + Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063887134 10:10590747-10590769 CTGACTTAACTGATGAGGGAGGG - Intergenic
1064110995 10:12538818-12538840 TTATCTGAAGTGGTGGGGGAGGG + Intronic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1069184079 10:65400478-65400500 GTGTCTGGAGTGGTGGGGGAAGG - Intergenic
1069275504 10:66586669-66586691 CTCTCTGCAGTGTTGGGTGAGGG + Intronic
1071481776 10:86070090-86070112 CTCTCAGAAGTGATGTGGAATGG + Intronic
1071578894 10:86752592-86752614 CAGCCTGAGGTAATGGGGGAAGG + Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1073232777 10:101986475-101986497 CTGTAGGTAATGATGGGGGAAGG - Intronic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073309343 10:102528648-102528670 CTGCCTGAAGTGTTGGGAGCCGG + Intronic
1073321841 10:102620408-102620430 GGGTCTGGACTGATGGGGGAAGG - Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1075240755 10:120776237-120776259 CTGCCTGGAGTGATGGAGGTAGG + Intergenic
1075798909 10:125140381-125140403 CTGACTGATGTGATGAGGGAAGG + Intronic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1077423059 11:2461937-2461959 CTGTCTGCTGTCCTGGGGGAAGG + Intronic
1078430088 11:11281769-11281791 CTGCCTGAAGGGATGTGGGAAGG + Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079763081 11:24355720-24355742 CTGTCTGAACTGGTGGGTGAGGG + Intergenic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1081855152 11:46298339-46298361 GGGTCAGAAGAGATGGGGGATGG - Intronic
1082785259 11:57313177-57313199 CTGGCTTCAGTGATGGGGGAGGG + Exonic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1084519361 11:69654215-69654237 TTGTCTGTCGTGATGGGGCAAGG + Exonic
1085120459 11:73964323-73964345 CTGTCAGCTGAGATGGGGGAGGG - Intronic
1085706586 11:78791886-78791908 CTTTCTGAATTAATGGAGGAGGG + Intronic
1086412320 11:86554985-86555007 CAGCCTGAGGGGATGGGGGAGGG + Intronic
1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG + Intronic
1087844009 11:102950762-102950784 CTGTCTGCACTCATGGGAGACGG - Intronic
1087980175 11:104602842-104602864 CTGTCTGAAATGATGAGCAAAGG - Intergenic
1088357350 11:108957823-108957845 CTGCCTGAAGTCATGGAGCAGGG + Intergenic
1088766286 11:112982559-112982581 CTGTGTGAGGTGATGGGAGGTGG + Intronic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089208957 11:116788049-116788071 CTGGCGGAAGTGACGGGAGAGGG - Exonic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090226742 11:125076354-125076376 ATGTCTAAAATGATGGGGGTAGG - Intronic
1090490663 11:127157754-127157776 CTGTCTGGAGTTGTGGGGAAGGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091658934 12:2367119-2367141 CTGACTGAAGGGATGGGGGCAGG + Intronic
1092068926 12:5616755-5616777 CTGTATAAGGTGATGGGTGAGGG - Intronic
1093027461 12:14258053-14258075 CTGTCTGCAATGTTGGGGGAGGG + Intergenic
1093722630 12:22462535-22462557 CTGTGTGTAGTGGTGTGGGAGGG + Intronic
1096102527 12:48978413-48978435 CTGGCTGAAGTGACGGGAGGAGG - Intergenic
1096847973 12:54418417-54418439 CGGTCTGAGTTGAGGGGGGAGGG + Intronic
1097062960 12:56299873-56299895 ATGTCTGAAATGAAAGGGGAAGG - Intronic
1097641604 12:62190416-62190438 CTTTCAGAATTGAAGGGGGAAGG + Intronic
1098282962 12:68879981-68880003 CAGAATGAGGTGATGGGGGAAGG + Intronic
1101059278 12:100954275-100954297 CAGGCTGAAGTGATGGGAGGTGG - Intronic
1101219334 12:102620502-102620524 GTCTTTGAAGTGAGGGGGGAAGG - Intergenic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1105844437 13:24282097-24282119 GTGGCTGAAGTGATGAGGGGAGG + Intronic
1106515483 13:30449648-30449670 CTTTCTGAAGTGATGGCAGATGG + Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1107989025 13:45801075-45801097 CTGGGTGAAGTGATGGGTGGCGG + Intronic
1112647633 13:101353360-101353382 TTGTCTGAAGTGAAGCTGGAAGG - Intronic
1113427943 13:110225239-110225261 CTGTTCGAAGTGCTGGGGGGAGG - Intronic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1118751087 14:68808334-68808356 CTGTCTGGAGTGGTGGGGTGGGG - Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119960205 14:78847398-78847420 CTCTCTTAAGTGCTGGGGAAAGG - Intronic
1121698418 14:95932076-95932098 CTGTCTTCAGTATTGGGGGAGGG - Intergenic
1121786872 14:96668533-96668555 ATGAATGAACTGATGGGGGACGG - Intergenic
1122413655 14:101538389-101538411 CTTTCTCAACTCATGGGGGAGGG + Intergenic
1124610770 15:31206915-31206937 CGGTGTGAAGTGCTGGGGGTGGG - Intergenic
1125762156 15:42104071-42104093 GTGTGGGAAGTGATTGGGGAAGG + Intergenic
1125878278 15:43168665-43168687 CTGCCTGGAGAGTTGGGGGATGG + Intronic
1126994752 15:54428382-54428404 TTGTATGATGTGATTGGGGAAGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127739863 15:61892364-61892386 CTGTCTCCAGTGGTGGGGAAGGG - Intronic
1128033606 15:64503325-64503347 CCAGCTGAAGAGATGGGGGAGGG + Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1129760900 15:78128847-78128869 CTGGCTGTCGTGATGGAGGAGGG + Intronic
1130565235 15:84988508-84988530 CTGTCTGAAATGAGTTGGGAGGG + Intronic
1130628862 15:85545022-85545044 CTGTCTAGCGTGATGGGGAAAGG - Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131170437 15:90174530-90174552 GTGCCAGGAGTGATGGGGGAGGG - Intronic
1131341405 15:91605140-91605162 CTGTGGGGAGTGATGAGGGAAGG + Intergenic
1132879657 16:2156409-2156431 CTGTCTGTCTAGATGGGGGATGG - Intronic
1133320888 16:4913204-4913226 CTGTCTGTGGTTCTGGGGGACGG - Intronic
1133687809 16:8182831-8182853 GAGTCTGAAGTGAAGCGGGAGGG + Intergenic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1135281837 16:21159184-21159206 CTCTCTGCAGCGATGGGGAAGGG - Intronic
1135933307 16:26757770-26757792 CTGGCTTAGGTGATGGGGGTTGG + Intergenic
1136086410 16:27888268-27888290 CTTTCAGAAGTGATGGGAGATGG + Intronic
1136396406 16:29994889-29994911 CTATCCGAAGTGAAGGGAGAAGG - Intronic
1137485744 16:48889261-48889283 CTATTTGAAGTCCTGGGGGAAGG + Intergenic
1137673892 16:50294369-50294391 CTGTCTGCAGTGATAGGGCCTGG + Intronic
1138084263 16:54119438-54119460 CTGTCTGCAGAGTTGGGGGCAGG - Exonic
1138358534 16:56405988-56406010 CTGTCAGAAGGGAAGGGGAAGGG + Intronic
1139170477 16:64625391-64625413 GTATCTGCAGTGATGGGTGATGG + Intergenic
1139579246 16:67862502-67862524 TTGACTGAAGTGGTGGTGGAAGG - Intronic
1140522106 16:75590564-75590586 TTGCCTGATGTGGTGGGGGATGG - Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143870474 17:9954452-9954474 CAGTCTGCAGTGATGGGGGATGG + Intronic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1146018020 17:29249212-29249234 CTGTTGGATGTGATGGGGGTGGG - Intronic
1146162510 17:30567553-30567575 CTGTCTGGTCTGATGGGGGTGGG - Intergenic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147579505 17:41620334-41620356 CTGTCTGGTCTGATGGGGGTGGG - Intronic
1148483296 17:47974619-47974641 CTGAGTGGAGTGCTGGGGGAAGG + Intronic
1148605738 17:48927643-48927665 CTGTGGGAAATAATGGGGGAAGG - Exonic
1149272184 17:54991941-54991963 GTGTTTGCAGTGGTGGGGGAGGG - Intronic
1150003465 17:61455931-61455953 CTGTCTGAGGGGTTGGGTGAGGG + Intronic
1150946650 17:69753693-69753715 CTTTTTGAAGTGGTGGGGGTGGG + Intergenic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1151996424 17:77612134-77612156 CTGACTGAAGTCATCAGGGAAGG - Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1153994894 18:10432259-10432281 GTGTGTGAAGAGATGGGTGATGG - Intergenic
1156253462 18:35374122-35374144 CTGCCTGAATTGCTGGCGGAAGG + Exonic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1158254744 18:55533248-55533270 CTGCCTGTAATAATGGGGGAAGG - Intronic
1158332570 18:56378991-56379013 GGGGCTGAAGTGATGGGGGTAGG + Intergenic
1158494909 18:57946098-57946120 ATGTCTGTTGTGATGGGGAAGGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1161437586 19:4273034-4273056 CTGTCGGCAGGGATAGGGGAAGG - Intergenic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1162442614 19:10702152-10702174 CTGTCCGAGGTGACGGAGGAGGG + Exonic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162956359 19:14100794-14100816 CAGCCTGATGTGATGGGGGGTGG + Intronic
1163551948 19:17970208-17970230 CTGATTGATGTGATGGGTGAGGG + Intronic
1164606005 19:29598614-29598636 CTGTCTGAAGTGCTGGGACATGG - Intergenic
1164670019 19:30067141-30067163 CTGTGTGAAGCAAAGGGGGATGG + Intergenic
1166148461 19:40852975-40852997 GTGTCTGAAATCATGTGGGAGGG + Intronic
1166152602 19:40884760-40884782 GTGTCTGAAATCATGTGGGAGGG + Intronic
1166177575 19:41085873-41085895 GTGTCTGAAATCATGTGGGAGGG - Intergenic
1168515754 19:57009188-57009210 GTGTATGAAGTGATGGGTGGGGG - Intergenic
1168634341 19:57983677-57983699 CTAACTGAAGTGATCGAGGATGG + Intronic
926083466 2:10006766-10006788 CCGTCTGCAGTGACAGGGGAGGG - Intergenic
926314025 2:11696570-11696592 CGGTCAGAAGTGAGTGGGGATGG + Intronic
926990640 2:18676458-18676480 CTGTCTGCAGTGGTGGGTGAGGG + Intergenic
927241739 2:20925387-20925409 CTTCCTGGAGTGGTGGGGGATGG - Intergenic
928394886 2:30935934-30935956 ATTTCTGAAGTGAGGGAGGAGGG + Intronic
929467037 2:42154377-42154399 ATGTGAGAAGTGATTGGGGAAGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933349689 2:81137531-81137553 GTGTCTGCAGTGATGGATGAGGG - Intergenic
933847289 2:86336692-86336714 CTGTGTGAAGTCATTGGGGGTGG - Intronic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
938840487 2:135157509-135157531 CTGTCAGTTGTGGTGGGGGATGG + Intronic
940570519 2:155427206-155427228 ATGTGTGAAGTGATGGGGCTAGG + Intergenic
940577659 2:155531838-155531860 CTGAGTGAGGTGGTGGGGGATGG + Intergenic
940581356 2:155584518-155584540 CTGACTGAAGTGATCAGGCATGG - Intergenic
943586282 2:189744500-189744522 CTGCTTGAAGTGATGAGGGAAGG - Intronic
944645707 2:201779531-201779553 TTTTCTTAAGTGATGGGGAAGGG - Intronic
946407176 2:219497931-219497953 CTGGCTGGAGTGACGGGGGCGGG + Intronic
947023423 2:225709766-225709788 TTGTTTGAAGGGATGAGGGAAGG - Intergenic
948082458 2:235217720-235217742 AGGGCTGAAGTGGTGGGGGATGG - Intergenic
1169150579 20:3286379-3286401 CTCTCCGAAGTGATGGAAGATGG + Intronic
1169207742 20:3749622-3749644 CTGTCTGCAGGGTCGGGGGAGGG - Intronic
1169242436 20:3995370-3995392 CTTTCTGAAGTGACAGGGGCAGG + Intronic
1172390107 20:34560100-34560122 CTGGCTGGTGGGATGGGGGAGGG + Exonic
1172772016 20:37387389-37387411 AGGGCTGAAGTGATCGGGGAGGG + Intronic
1172819742 20:37721028-37721050 CTAGCTGCAGTGAAGGGGGATGG + Intronic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1176175541 20:63721689-63721711 CTACCTGAAGTTGTGGGGGAGGG - Intronic
1178584613 21:33861643-33861665 CTGTCAGAAATGATGGCAGAAGG + Intronic
1178615195 21:34126940-34126962 CTGTGTGCAGTGGTGGGGGTTGG + Intronic
1179650182 21:42803375-42803397 TTGACTGAAGTAATGGGGGCTGG + Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1180821212 22:18829070-18829092 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1180924574 22:19544738-19544760 CAGACTGAAGTGACAGGGGATGG + Intergenic
1181191766 22:21146975-21146997 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1183194292 22:36342826-36342848 CTCTGTGAAGTGATGATGGAAGG + Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1203219488 22_KI270731v1_random:31881-31903 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1203271337 22_KI270734v1_random:54946-54968 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
949448146 3:4157311-4157333 CTATATGAAGTGAGGAGGGAAGG - Intronic
950285152 3:11738979-11739001 CTTTCAGGAGTGATGGGTGAAGG - Intergenic
950811868 3:15656954-15656976 CTGGCCGGAGTGGTGGGGGATGG + Intergenic
951031345 3:17885219-17885241 GTGTTTGTGGTGATGGGGGATGG - Intronic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
955015688 3:55066664-55066686 CTGTCTGTAGTGAGTGGGAAAGG + Intronic
955837083 3:63067880-63067902 CTTTCTGAAATCATAGGGGAGGG + Intergenic
955889098 3:63631709-63631731 CCATGTGAAGTGCTGGGGGAAGG - Intergenic
956181327 3:66520473-66520495 CTATCTGAATTGATGGTGGGTGG + Intergenic
956595753 3:70965305-70965327 CTGAATGAAGTGATGGGCGATGG - Intronic
957241343 3:77664848-77664870 GTAGCTGAAGTCATGGGGGAAGG - Intergenic
957639428 3:82832331-82832353 CTGTCAGCAGGGATCGGGGAGGG + Intergenic
959099000 3:101989157-101989179 TAGTTTGAAGTGATGGAGGAGGG + Intergenic
961209231 3:125112504-125112526 CTGCATGAGGTGCTGGGGGAAGG - Intronic
961389766 3:126545426-126545448 CTTTCTGCAGTTATGGGGTAGGG + Intronic
961634870 3:128327045-128327067 CTGTGTGTAGTGATGAGGCAAGG - Intronic
964902369 3:161675229-161675251 CTGTCTGATGTGATCAGTGAGGG + Intergenic
965211330 3:165793328-165793350 CTGTCTGAAGAGATGGTAGGAGG - Intronic
965659020 3:171021243-171021265 TTGTCAGAAGTGATGGGATAAGG + Intronic
965679945 3:171239904-171239926 TTGTCTGAAATCTTGGGGGAGGG + Intronic
967277618 3:187791913-187791935 CTATCTGAAGTGAGGGGAGGGGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971890099 4:32508611-32508633 GAGTCTGAAGGGAGGGGGGATGG + Intergenic
972018682 4:34280681-34280703 GTGTCTGCAGTGATGGATGAAGG + Intergenic
972155859 4:36160967-36160989 CTGTCTGAAGTGCTTGGTGGTGG + Intronic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
975118820 4:70706256-70706278 TTGCCTGAAGCGATGAGGGAAGG + Intronic
975678037 4:76847211-76847233 CTGTCTCAGCTGATGAGGGAAGG + Intergenic
976149594 4:82078671-82078693 CTGTCTCCAGTGATGAGGTAGGG + Intergenic
976682079 4:87768472-87768494 CTGTCTGATGTGAGGGGAAAGGG - Intergenic
977615898 4:99087377-99087399 CCGTCTGAACTGGCGGGGGAGGG + Intronic
982677630 4:158394299-158394321 GTGTTTGAAGTGAAGGAGGAAGG + Intronic
985870129 5:2547945-2547967 GTGGCTGAAGTGAAGGGAGAGGG - Intergenic
986539559 5:8829260-8829282 CTGTCTGCAGTGGTGGGCAAGGG - Intergenic
986604889 5:9512436-9512458 TTGTCTAAAGTGATGTGGGTAGG + Intronic
988428875 5:31095586-31095608 TTGTCTGAAGTCATGGAGGGGGG - Intergenic
989506345 5:42230786-42230808 CTGACTGAAGTGTTCAGGGAGGG + Intergenic
992230739 5:74661052-74661074 CTGTCTGGAATGAAGGGTGAAGG - Intronic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
993003519 5:82406524-82406546 CTTTCTGAATTCAAGGGGGAAGG - Intergenic
993030740 5:82703019-82703041 ATGTCTGATGTGATGGAGGGAGG - Intergenic
994326893 5:98458426-98458448 CTGGCTGAAGTTCTGGGGTATGG - Intergenic
994683719 5:102923152-102923174 CTGTCTGAATTAAGGGGTGAGGG - Intronic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
996461714 5:123752459-123752481 TTCTCTGAAGTGGTGGGAGAAGG + Intergenic
997821765 5:137072418-137072440 CTGTCTGCAGTGATAAGGGCAGG - Intronic
998042506 5:138961030-138961052 CTATATGGAGGGATGGGGGAGGG + Intronic
1000303656 5:159976819-159976841 GTGTCAGAAGAGATGGAGGAGGG + Intergenic
1000632190 5:163603243-163603265 CTGTCTACAGTCAAGGGGGAAGG + Intergenic
1002213580 5:177612333-177612355 CTGTGTGGAGTGCTTGGGGAAGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003150466 6:3543535-3543557 CTCTCTGAGGTACTGGGGGATGG + Intergenic
1003460550 6:6324200-6324222 CTGTCTGAGGTCAAGAGGGAGGG + Intergenic
1005250148 6:23936184-23936206 CTTTTTGCAGTGATGGGAGAAGG + Intergenic
1005530736 6:26702879-26702901 CTCTCTGACCTGATGGGAGAAGG - Intergenic
1005540060 6:26798767-26798789 CTCTCTGACCTGATGGGAGAAGG + Intergenic
1007079108 6:39086219-39086241 CTGTCTGATGGGTTTGGGGAGGG - Exonic
1009010877 6:57840900-57840922 CTCTCTGACCTGATGGGAGAAGG + Intergenic
1009288595 6:61855107-61855129 CTGTCTCAATTTTTGGGGGAAGG + Intronic
1011860738 6:91753022-91753044 CTGTCTGAACTCAAGGGGGAAGG + Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1013896697 6:115097400-115097422 CTGTCTGGGGTGATGGGGGAAGG - Intergenic
1015688790 6:135896895-135896917 CACACTGAAGAGATGGGGGATGG - Intronic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1015798254 6:137034558-137034580 CTGTGAGGAGTGCTGGGGGAGGG - Intronic
1016272684 6:142306949-142306971 CTGTCTGAAGTGATAGAGTCTGG + Intronic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016958471 6:149649246-149649268 CTGCCTCAAGTGATGGCAGAGGG - Intergenic
1017368500 6:153674775-153674797 TTTTGTGAAGTGATGGAGGAGGG + Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1019286880 7:228091-228113 CCGTCAGAGCTGATGGGGGACGG + Exonic
1020475164 7:8585753-8585775 CTCTCTTAAGTGATTGGGCAGGG + Intronic
1020483958 7:8697507-8697529 CAGACTGAAGTGCTGGGGTAAGG + Intronic
1021386775 7:20040444-20040466 CTGCCTCAGGTGTTGGGGGAAGG - Intergenic
1022427029 7:30278754-30278776 CTGACTGAAGGGATGGGGATTGG - Intergenic
1023051013 7:36251183-36251205 TTGTCTGAAGTTATAGAGGAAGG - Intronic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1028446611 7:90931583-90931605 ATGGCTGATGTGATGGGGGAAGG + Intronic
1028884619 7:95917561-95917583 ATGACTGAAGGGATTGGGGATGG - Intronic
1028916644 7:96266745-96266767 ATGTCTGAAATCATGGGGCAGGG - Intronic
1029673044 7:102047223-102047245 CTCTGTTAAGTGATGGTGGATGG + Intronic
1029813586 7:103072834-103072856 GTATCTGAAGTGATGGGCCAAGG - Intronic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031552131 7:123128022-123128044 TTGTGTGAAGTGAGGGGGAAGGG - Intronic
1031785592 7:126027607-126027629 CTGTGTGAGGTGATTGGGTAAGG + Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034090173 7:148356748-148356770 CTGACTGAGGTGATGGCAGAAGG - Intronic
1034090177 7:148356773-148356795 CTGTCTTGAGTGATGGGGTAAGG - Intronic
1034503622 7:151468120-151468142 GTCACTGGAGTGATGGGGGAGGG - Intronic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1036188319 8:6645143-6645165 GTGGCTGATGTGGTGGGGGATGG - Intergenic
1037773168 8:21814976-21814998 CTGCCTTTTGTGATGGGGGAAGG - Intergenic
1041203596 8:55475421-55475443 CTATTTGGGGTGATGGGGGAAGG + Intronic
1042654972 8:71085857-71085879 ATGTCTGAAGACATGGGGGCAGG + Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1045139401 8:99263580-99263602 CTGGCTTTAGAGATGGGGGAAGG - Intronic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1046723777 8:117652736-117652758 GTGTGTGTAGTGGTGGGGGATGG - Intergenic
1047803217 8:128331347-128331369 CTGTGTGAAGTGCTGGGAGTTGG + Intergenic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1050476323 9:6045095-6045117 GTGTCTGCAGTGGTGGGTGAGGG + Intergenic
1051593130 9:18796593-18796615 CAGCCTGAAGTCATGGGGGCAGG - Intronic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1053179851 9:35959723-35959745 CTCTCTTCAGTCATGGGGGAGGG + Intergenic
1053183079 9:35991326-35991348 CTTCCTGCAGTGATGGTGGAGGG - Intergenic
1055563230 9:77542838-77542860 CAGGCTGAAGTAATGGGGGAAGG + Intronic
1055709574 9:79045394-79045416 CTGCCTGTAGAGATGGGGGTTGG - Intergenic
1055750617 9:79500869-79500891 CTGTCTAGAGTAATGGGAGATGG - Intergenic
1056104561 9:83334061-83334083 CTGTTTGAATTGATAGGAGATGG - Intronic
1060215816 9:121737718-121737740 CTGTTTGAAGTCCTGTGGGAGGG + Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060329983 9:122659378-122659400 CAGGTGGAAGTGATGGGGGAGGG - Intergenic
1061733188 9:132632718-132632740 CTACCTGAAGAGATGGGGGTAGG - Intronic
1061741632 9:132710846-132710868 CTGTCAGAAGGGAAGGGGAAGGG - Intergenic
1062231212 9:135482429-135482451 CTGGCTGAAGTGATGGGGATGGG - Intronic
1062628961 9:137455143-137455165 CTGGCAGACCTGATGGGGGAAGG - Intronic
1187197174 X:17098864-17098886 CTGGCTGAGGTGTTGGGGAAGGG - Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1189044699 X:37578132-37578154 CTAACTGAAGTGGTGAGGGAAGG + Intronic
1190551184 X:51582704-51582726 TTGACTGCAATGATGGGGGAGGG - Intergenic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1192358091 X:70422295-70422317 CTGTCTGGGGTGATGAGGGAAGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192750673 X:73987280-73987302 CTGTTGGCAGTGATGGGGAAAGG + Intergenic
1193524725 X:82575260-82575282 CTCTCAGAAGTGATGAGAGAAGG - Intergenic
1194556406 X:95366113-95366135 CTGTCTGGGGTGATGGGGTTAGG + Intergenic
1196368728 X:114951919-114951941 CACTCAGAGGTGATGGGGGAGGG - Intergenic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1196892983 X:120308615-120308637 CTGTCTAAAGTGGGGAGGGATGG - Intronic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1197701029 X:129599797-129599819 CAGTCTGAAAAAATGGGGGATGG - Intergenic
1197714640 X:129697573-129697595 TAGGCTGAAGAGATGGGGGAGGG + Intergenic
1197845486 X:130797604-130797626 TTGCCTGAGATGATGGGGGAAGG + Intronic
1198934696 X:141894621-141894643 GTGTCTGAAATGAGGTGGGAAGG - Intronic
1201957193 Y:19638446-19638468 CTGTCTGCAGTGGCGGGTGACGG + Intergenic