ID: 1101331009

View in Genome Browser
Species Human (GRCh38)
Location 12:103757972-103757994
Sequence CCTTTCCTCAGTGAATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101331009_1101331013 7 Left 1101331009 12:103757972-103757994 CCATAGGATTCACTGAGGAAAGG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1101331009_1101331011 1 Left 1101331009 12:103757972-103757994 CCATAGGATTCACTGAGGAAAGG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1101331011 12:103757996-103758018 AAAGTCCTCAAACTCTCCCACGG 0: 1
1: 0
2: 1
3: 22
4: 170
1101331009_1101331016 25 Left 1101331009 12:103757972-103757994 CCATAGGATTCACTGAGGAAAGG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1101331016 12:103758020-103758042 GCAGGCAGAAGACACAGCAAAGG 0: 1
1: 0
2: 6
3: 70
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101331009 Original CRISPR CCTTTCCTCAGTGAATCCTA TGG (reversed) Intronic
903868852 1:26418065-26418087 CATTTCCTAAGTGACCCCTAAGG + Intronic
913054162 1:115142057-115142079 CCTTAGCTCAGTGACTCCTCTGG + Intergenic
914424056 1:147558391-147558413 CCTTTCCTCAGAGAAAACTCTGG + Intronic
915010457 1:152680782-152680804 CCTTGCTCCAGGGAATCCTAAGG + Intergenic
915578856 1:156801244-156801266 CCTTTCTTCAATGAAGGCTAGGG - Intergenic
917146630 1:171899415-171899437 CCTTTCCTCCATGCTTCCTATGG + Intronic
919143368 1:193601804-193601826 TCTTTTCTCAGTGACTCCTGAGG + Intergenic
919892859 1:201988655-201988677 CCATTCCTCACTGCATCCCATGG - Intronic
920762471 1:208798669-208798691 CCTTTCCTACCTGAACCCTATGG - Intergenic
920770553 1:208880960-208880982 CCTTTCCTCAGTTGCTCATAGGG - Intergenic
920928461 1:210365030-210365052 CATTTCCTCCGTAAATTCTAGGG - Intronic
921000795 1:211040769-211040791 CGTTTTTTCAGTGATTCCTAAGG - Intronic
921224998 1:213010167-213010189 CCTATCTTCAGTGAATGATAGGG - Intronic
921306518 1:213802676-213802698 CTTTTCCTCAGAAGATCCTAAGG + Intergenic
1065279973 10:24126646-24126668 CATGTCCTAAGTGAATCCTTAGG + Intronic
1065294558 10:24262050-24262072 CTTTTCCTCCCTGAATCCTTGGG - Intronic
1066371843 10:34824328-34824350 CCTTTCTTCCCTGCATCCTAAGG + Intergenic
1069837252 10:71317330-71317352 GCTGCCCTCACTGAATCCTACGG + Intergenic
1070653931 10:78257991-78258013 CCTTACCTCAGTGATTTCTGAGG + Intergenic
1072765673 10:98093387-98093409 CCTTTGCTCAGAGAAACATATGG + Intergenic
1074543635 10:114385953-114385975 CATTGTCTCAGTGAATCCTCAGG - Intronic
1075795884 10:125119080-125119102 CCTTTCCACAGGGTATCCCAAGG + Intronic
1076676239 10:132149105-132149127 ACATCCCTCAGTGAATCCCAGGG - Intronic
1077890629 11:6415657-6415679 CCTTTCCTCTGTGAATCAGGAGG - Intronic
1078660413 11:13281207-13281229 CCTCTCCTAAGTCAAGCCTAAGG - Intronic
1079630492 11:22668104-22668126 CCTTGCCTCTGTGAATCTCAGGG - Intronic
1080792359 11:35533218-35533240 CCTTTCCTCAGAGGCTCCCATGG - Intergenic
1082980507 11:59116458-59116480 CCTTTCCACAGAGCATTCTAGGG + Intronic
1085630255 11:78109474-78109496 CCTTCCCTCAGTGACTCCCTTGG - Exonic
1086663413 11:89450398-89450420 GCTTTGCTTAGTGAATCTTAGGG + Intronic
1088587033 11:111368374-111368396 CAGGTCCTGAGTGAATCCTAAGG + Intronic
1088653179 11:111976525-111976547 CTTTTCCTCAGTGAGTCCCTGGG + Intronic
1091201510 11:133784300-133784322 CCTTCCCTCAGGCAATGCTAGGG - Intergenic
1091516174 12:1184691-1184713 CCTTTCCTCAATAAATTCTGAGG - Intronic
1091846783 12:3662379-3662401 CCTTTCCTCAGTGTGACCTTGGG + Intronic
1093159100 12:15724080-15724102 CTTTGGGTCAGTGAATCCTAAGG + Intronic
1095434998 12:42177454-42177476 CCTTTCCTCAGTGCATGCACAGG + Intronic
1097388061 12:58974454-58974476 CCTTTTCACAGTGATTTCTAAGG + Intergenic
1099748452 12:86738035-86738057 CCTTTTCAAAGTGAATGCTAGGG + Intronic
1101331009 12:103757972-103757994 CCTTTCCTCAGTGAATCCTATGG - Intronic
1105341477 13:19530115-19530137 ACTTTCCTCAGTATATCCCAAGG - Intronic
1105587966 13:21762078-21762100 CCTTTCCTCACTGAATGCACTGG + Intergenic
1106416582 13:29550894-29550916 CATTTGCTCACTGAATCCTTGGG + Intronic
1110310490 13:74043686-74043708 GCTTTCCTCAAGGAATTCTAAGG - Intronic
1111567313 13:90032824-90032846 CTTTGGCTCAGGGAATCCTAAGG - Intergenic
1113298323 13:108986980-108987002 CCTCTCCTCATTTAATCCTAGGG - Intronic
1114604388 14:23984963-23984985 CCTTTACTCAGTAAATACGAAGG - Intronic
1115450248 14:33539518-33539540 TCTTTCGTCAGTGGATCCCAAGG - Intronic
1117515195 14:56493648-56493670 ACTTTCCTCTGTGAATAATAGGG - Intronic
1119344263 14:73909349-73909371 CCTTTCCTTTGTGAAGCCCAAGG + Exonic
1119465589 14:74855645-74855667 CCTTTCCACAGTTAGTACTAGGG - Intronic
1120850064 14:89161940-89161962 CCTTCACTCAGTGAACCCAATGG + Exonic
1121318237 14:92974836-92974858 CCTTTCCTCAGTGAACCGGACGG - Intronic
1125437281 15:39660089-39660111 TCTTTCCTCTCTCAATCCTAGGG - Intronic
1125837008 15:42761063-42761085 TCTTTCCCCAGTGAATGCTGTGG - Intronic
1126739607 15:51764414-51764436 CCTTTCCTTTGTGAATTCAACGG - Intronic
1126926394 15:53592245-53592267 CCTTTCCTAAGTGACTTCTGTGG + Intronic
1131217666 15:90552711-90552733 CCTTAGCTCAGTTTATCCTATGG - Intronic
1134467491 16:14492297-14492319 CCTTTCCTGAGTGCATCTCATGG - Intronic
1142383658 16:89748549-89748571 CCTTTCCTCAGTAATTCACACGG + Intronic
1142558342 17:794759-794781 CCTTTCTTCAGTGAATACAGGGG + Intergenic
1142782013 17:2188591-2188613 CTTTTCCTCACTGAAGACTAGGG + Intronic
1144155062 17:12492129-12492151 TCTTTCCTCTGTGAATCCCCAGG - Intergenic
1145362737 17:22225712-22225734 CCTTTGCTCTGTGAAGCCTGTGG + Intergenic
1146979380 17:37145577-37145599 GCTTTCTTCAGTGAAACTTAGGG + Intronic
1157377793 18:47182249-47182271 CCTTTCCTGTGTGCAGCCTAGGG + Intergenic
1158096315 18:53775677-53775699 CCTTTCCCCAGTGCATGTTATGG + Intergenic
1158665835 18:59431785-59431807 CCTTTGGTCAATGAATCCAATGG + Exonic
1159486806 18:69071640-69071662 CATTTCCTCAGTGAGACCTCTGG + Intergenic
1167001340 19:46747025-46747047 CCTATCCTCATTGATTACTATGG + Intronic
1167833424 19:52046392-52046414 CGGTTCCTCAGAGACTCCTATGG - Intronic
1168563546 19:57403801-57403823 CTTTTGCTCAGGGAATCCCAAGG - Intronic
925465870 2:4106920-4106942 CACTTCCTCAGGGAATCCTCTGG + Intergenic
925628137 2:5862546-5862568 CCTTTGCTCAGGGAGTCCCAAGG - Intergenic
928193081 2:29192028-29192050 CCTTTCCTCATCGCCTCCTAGGG + Intergenic
929396166 2:41525163-41525185 CCTTTCCCCATTGTCTCCTAGGG - Intergenic
931227178 2:60341571-60341593 CTTTTCCACAGTTAATCCTGTGG - Intergenic
931577313 2:63732024-63732046 TCTTTCCTCATTTATTCCTAGGG - Intronic
932345016 2:70989519-70989541 CTCTTCCTCAGTGAGTCCTTTGG - Intronic
938192630 2:129297510-129297532 TCATGCCTCAGTCAATCCTAAGG + Intergenic
938373740 2:130790600-130790622 GCTGTCCTCAGAGAAACCTAGGG - Intergenic
940642663 2:156362914-156362936 CCTTGCCCTGGTGAATCCTATGG - Intergenic
940738408 2:157479788-157479810 CAATTCCTCGGTGAGTCCTAGGG + Intronic
1169825506 20:9764334-9764356 CCCTTTCTCAGTGTATCGTATGG + Intronic
1175534317 20:59697097-59697119 CCTTACCTCATAGAGTCCTAGGG - Intronic
1176968271 21:15236292-15236314 CCTTTCCTCAGGGAATAGGATGG + Intergenic
1179258228 21:39736235-39736257 CCTTTCCTCAGGGATTCCCAGGG + Intergenic
1179513281 21:41889218-41889240 CCTTTCCTCCGGGAACCCTCTGG + Exonic
1180062887 21:45394594-45394616 CGTTCCCTCAGTGAAGCCCAAGG - Intergenic
1182086435 22:27564193-27564215 GCTGTCTTCAGTGATTCCTAGGG + Intergenic
949339699 3:3015992-3016014 CTTTTGCTCAGTGAGTCATAAGG + Intronic
950105055 3:10383282-10383304 CCTTTCCTGGCTGAATCCTGTGG - Intronic
950918642 3:16670355-16670377 CCTATCCTCAGTAAATTCCAAGG - Intergenic
951680933 3:25294053-25294075 ATTTTCCTCGGTGAATCCTTCGG - Intronic
952563194 3:34620426-34620448 CCTGTCCTCAGTGATGCTTAAGG + Intergenic
952622869 3:35367462-35367484 CCGTTCCTGAATGACTCCTAAGG + Intergenic
953643805 3:44734541-44734563 TCTCTCCTCTGTGAATCCTCTGG - Exonic
954424452 3:50436016-50436038 CCTTTCCTCAGTGATCCTCAGGG - Intronic
957036450 3:75297865-75297887 CCTTTACTGAGTGACTACTATGG + Intergenic
957200473 3:77128289-77128311 CCTTTCCTCATTGCTTTCTAGGG + Intronic
957474444 3:80705435-80705457 CCCGTGCTCTGTGAATCCTAGGG - Intergenic
958846095 3:99266667-99266689 TCTTTCCTCAGTGATTTTTAAGG - Intergenic
959150550 3:102602123-102602145 TCTTCTCTCAGTGATTCCTAGGG - Intergenic
959269426 3:104187877-104187899 CCTTTCCTCAGTATATACTGAGG + Intergenic
962358620 3:134716408-134716430 CCCTTCCCCAGTGAATCCCCTGG + Intronic
962516736 3:136159321-136159343 CCTTTCCCCATTGAATCATCTGG - Intronic
962975217 3:140440243-140440265 CATATCCTCAGTGAAGCCTCAGG - Intronic
964062810 3:152544693-152544715 CCTTTCCTCAGTGTATATTTTGG - Intergenic
964310520 3:155386941-155386963 CCTTTTCCCAGTGAAACCGATGG - Intronic
964864192 3:161236812-161236834 CCTTTCCTCAGTGAATGCCTTGG + Intronic
965098840 3:164271486-164271508 CCTTTCCTCAGTGCATGCTATGG - Intergenic
966155362 3:176910421-176910443 CATTTCCACAGTGAATTGTAAGG + Intergenic
966650618 3:182296660-182296682 CCTTTCCTCTGAGAAGCTTAAGG - Intergenic
969413639 4:7044872-7044894 CCTTTCCTGAGTGAGTCTCAGGG + Intronic
974463723 4:62225561-62225583 CCTGTTCTCAGTGATTCCTGTGG - Intergenic
977623474 4:99163981-99164003 CCTATCATCCCTGAATCCTAGGG + Intergenic
981845027 4:149157472-149157494 CCTTTCCTCAGTGACTGCCAAGG - Intergenic
985090984 4:186362443-186362465 CCTTTCCTCAGTGCATGCATGGG - Intergenic
988842419 5:35095948-35095970 TCTTTCCTCAGTGGAACCTTTGG - Intronic
989493988 5:42090156-42090178 CCCTTCCTCAGTGACTCAGATGG + Intergenic
990673422 5:58158043-58158065 CCTTAACTAAGTGAATCCTTGGG + Intergenic
996060736 5:119030379-119030401 CCTTTCTTCACTGAATGCTCTGG - Intergenic
997816287 5:137021836-137021858 TCTTTTCTCAGTGAAACATATGG - Intronic
1000349956 5:160345351-160345373 CCTTGCCTCAGTGAGTGCTCAGG + Intronic
1000624786 5:163526701-163526723 CCTTTGCCCACTGGATCCTAAGG - Intergenic
1007383259 6:41504014-41504036 TCCTTCCTGAGTGAAACCTACGG + Intergenic
1010113450 6:72270838-72270860 CCTTTCCTCATTGCACCCCAAGG - Intronic
1015818790 6:137238038-137238060 TCTTTCCTCTCTGAATCTTAGGG + Intergenic
1016050068 6:139521634-139521656 TCTTTACTCACTGAAGCCTATGG - Intergenic
1016491349 6:144607555-144607577 CCTTTACCCAGTGAAACCTATGG - Intronic
1020972268 7:14959513-14959535 GTTGTCCTTAGTGAATCCTAGGG - Intronic
1021196919 7:17684091-17684113 GCTATCCCCAGGGAATCCTAAGG - Intergenic
1023196477 7:37645344-37645366 CCTTTCCTGAGTAGATACTAAGG + Intergenic
1029410380 7:100405956-100405978 CCTCTCCAAAGTGAATCCCATGG + Intronic
1031863192 7:127006879-127006901 CCTTTCCTCTTTGCCTCCTATGG + Intronic
1032536285 7:132667338-132667360 CCTTTTCTCTGTTAATGCTATGG - Intronic
1033676888 7:143550576-143550598 CCTTTCCTCAGTGTATGTTCTGG + Intergenic
1033694947 7:143778859-143778881 CCTTTCCTCAGTGTATGTTCTGG - Intergenic
1033952364 7:146800796-146800818 GTATTCCTCAGTAAATCCTATGG - Intronic
1034754165 7:153598909-153598931 GGTTTCCTCAGTGAATCACATGG + Intergenic
1035132401 7:156668369-156668391 CCTTTCCTGTGTGAATCTTATGG - Intronic
1035224023 7:157423910-157423932 CCCTTCCTCAGTGCAACCGAAGG - Intergenic
1040764578 8:50891779-50891801 CCTGACCTCAGTGTATACTAGGG + Intergenic
1042359827 8:67869923-67869945 CCTTTGCTCAGTGAATGGGAGGG + Intergenic
1042601820 8:70506369-70506391 CCCTTCCTCAGTGATGCCTCGGG + Intergenic
1046138601 8:110061885-110061907 CCCTTCTTCAGTGAATACTCAGG - Intergenic
1046853700 8:119005223-119005245 GGTTTGCTCAGTAAATCCTAGGG - Intronic
1047058318 8:121193103-121193125 GCTTTCATCAGTGAAACCAAAGG + Intergenic
1048432565 8:134383887-134383909 CCTTTCCTGATATAATCCTATGG - Intergenic
1048502560 8:134992073-134992095 CTCTTGCACAGTGAATCCTATGG + Intergenic
1048529447 8:135234203-135234225 CCAGTCCTCAATGAATCCTGAGG + Intergenic
1051710004 9:19921748-19921770 CATTTCCTCAGGGAACTCTACGG + Intergenic
1052593901 9:30534612-30534634 TCATTGCTCAGTGCATCCTAAGG + Intergenic
1055529727 9:77171872-77171894 CCTTTGCTCACTGAACCCTTGGG - Intergenic
1056174018 9:84016683-84016705 CCTTTCCACACTGAATGCTTTGG + Intergenic
1056460382 9:86804239-86804261 CCTCTCCTCTGGGAATCCTCTGG + Intergenic
1059664634 9:116434888-116434910 CCTTTCGTCACTAAATCTTATGG + Intronic
1060739080 9:126086078-126086100 CCCTCCCTCTGTGAATCCCATGG - Intergenic
1186222029 X:7359511-7359533 CTTTTACTGAGTGAATCTTAGGG + Intergenic
1187424226 X:19162666-19162688 ACTTTCCCCATTGAATTCTAAGG + Intergenic
1191857069 X:65635655-65635677 GCTATCTTCAGTGAATCCTCTGG - Intronic
1195565418 X:106334063-106334085 CCTTTGCTCAGTGACACCCATGG - Intergenic
1196348634 X:114699651-114699673 CTTTTCCTCAGAGAGTGCTATGG + Intronic
1196685181 X:118504628-118504650 CATTTCTTCTGTAAATCCTAAGG + Intronic
1197469495 X:126850083-126850105 GCATTGCTAAGTGAATCCTAAGG + Intergenic
1199367953 X:147009290-147009312 CTTTTCCTCAGTGAATGCTTTGG + Intergenic