ID: 1101331013

View in Genome Browser
Species Human (GRCh38)
Location 12:103758002-103758024
Sequence CTCAAACTCTCCCACGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101331009_1101331013 7 Left 1101331009 12:103757972-103757994 CCATAGGATTCACTGAGGAAAGG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101331013 Original CRISPR CTCAAACTCTCCCACGGCGC AGG Intronic
902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG + Intergenic
921079149 1:211725032-211725054 GTCCAAGTCTCCCACGGTGCTGG - Intergenic
921079167 1:211725096-211725118 GTCCAAGTCTCCCACGGTGCTGG - Intergenic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG + Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1083762424 11:64825949-64825971 CTCAGCCTCTCCCAAGTCGCTGG - Intronic
1084980548 11:72826415-72826437 CTCACAGTTTCCCACGGCCCAGG - Intronic
1090171506 11:124610205-124610227 CTCAGACTCTCCCAAGCCCCTGG + Intergenic
1093486000 12:19653137-19653159 CTCAAACTCTCACACAGTCCAGG - Intronic
1098105951 12:67069287-67069309 CTCAAACTCGCCGGCGGCTCCGG + Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1105381767 13:19893886-19893908 CTCAAGCTCTCCCAAGCAGCTGG + Intergenic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1136631858 16:31493549-31493571 CTCAACCTCTCCCACTGCCTAGG - Intronic
1137466068 16:48710952-48710974 CTCAAACCCTCCCAGGGGCCAGG + Intergenic
1138297383 16:55898738-55898760 CTCAGCCTCTCCCATGGTGCTGG - Intronic
1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG + Intergenic
1143401918 17:6651724-6651746 CTCAGGCGCTCCCACGGCCCGGG - Exonic
1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG + Intergenic
1148441731 17:47715029-47715051 CTCCAACACTCCCACGGTGCAGG + Intergenic
1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG + Intergenic
1163772127 19:19197575-19197597 CTCAATCTCTCCAAAGGCGGAGG - Exonic
1163800466 19:19361934-19361956 CTCAAACACTCGCACAGGGCCGG - Intergenic
1166519538 19:43471236-43471258 CTGAAACTCTCCCACACAGCTGG - Intergenic
933445250 2:82371597-82371619 TTCAAACTCTCACACGTTGCAGG - Intergenic
936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG + Intergenic
936191896 2:110340612-110340634 CTCACACTCTCCCATGGCTGGGG - Intergenic
938936078 2:136128664-136128686 CTCATACTCTCACATGGCCCGGG + Intergenic
940254442 2:151714135-151714157 CTCCAACTCTCCCAAAGCACAGG + Intronic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1180573249 22:16748998-16749020 CTCAAACTGTCCTCCTGCGCTGG + Intergenic
1183126325 22:35784879-35784901 CTCAAACCCTGCCACCGCCCTGG - Intronic
950703630 3:14766885-14766907 CTCAAAGCCTCCCACAGCTCTGG - Intronic
971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG + Intronic
976391451 4:84508930-84508952 ATCTAACTCTCCCATGGGGCTGG - Intergenic
1004038191 6:11945144-11945166 CTCAAACTCCCCCTGGGCTCAGG - Intergenic
1013836485 6:114341890-114341912 CTCAGTCTCTCCCAGAGCGCTGG - Intronic
1016735917 6:147479992-147480014 ATCAAACTCTCCCACATCACTGG + Intergenic
1024927492 7:54632849-54632871 GTCAAAGTCTCCCATGGTGCTGG + Intergenic
1025827108 7:65019435-65019457 CTCAAACTCTCCCAAGTAGGTGG - Intergenic
1026575256 7:71566281-71566303 CACAAACTCTCCCAAAGCGGTGG - Intronic
1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG + Intergenic
1030634806 7:111936733-111936755 ATCAAAATCTCCCACAGCGCAGG + Intronic
1032195451 7:129785946-129785968 CTCCGACCCTCCCAGGGCGCGGG + Intergenic
1033287305 7:140052977-140052999 CTGAAACTCTCACACGTTGCTGG + Intronic
1041468335 8:58180455-58180477 CTCAATCTCTCCTAGGGCCCAGG - Intronic
1044604176 8:94034457-94034479 CTCAAACTATCCCACTGTGACGG - Intergenic
1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG + Intronic
1198456762 X:136824849-136824871 CTCAATCTCTACCAGGGCCCAGG - Intergenic