ID: 1101336685

View in Genome Browser
Species Human (GRCh38)
Location 12:103802918-103802940
Sequence CCATCCAGGCATTCAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101336679_1101336685 2 Left 1101336679 12:103802893-103802915 CCTTTATTCTGTAGAGAGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 134
Right 1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 200
1101336676_1101336685 26 Left 1101336676 12:103802869-103802891 CCTAAGCCTAAGCATATGGCTTA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 200
1101336677_1101336685 20 Left 1101336677 12:103802875-103802897 CCTAAGCATATGGCTTAGCCTTT 0: 1
1: 0
2: 1
3: 10
4: 158
Right 1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101336685 Original CRISPR CCATCCAGGCATTCAGAGGA GGG Intronic
902193490 1:14780464-14780486 CCATCCAGGCAGTGAGTGGGAGG - Intronic
903572024 1:24313099-24313121 CCATCCATGCCTTCAAAGAAGGG + Intergenic
905014102 1:34765294-34765316 ACATCCAGGCATCCAGAAAAAGG + Intronic
906611332 1:47205739-47205761 CCCTCCAGCGATTCAGAGGAAGG + Intergenic
907139136 1:52169022-52169044 CAATCTGGGAATTCAGAGGAAGG - Intronic
909680351 1:78284956-78284978 CCAGCCTGGCATCCTGAGGAAGG - Intergenic
910294893 1:85634653-85634675 GCATCCAGTCTTTCAGATGATGG - Intergenic
910433340 1:87180096-87180118 CCCTCCAGGTCTTCAGAGAATGG + Intergenic
911044405 1:93616868-93616890 CCTTCCAGGCAGCCAGAGAAGGG - Intronic
911330600 1:96521647-96521669 CTATCCAGTCATTAATAGGATGG + Intergenic
912039427 1:105368925-105368947 CCAGCCAGGCAGCTAGAGGAGGG - Intergenic
915757132 1:158273139-158273161 TCATCCAGCCAATAAGAGGAAGG - Intergenic
916025613 1:160830867-160830889 CAGTCCAGGCTTTCAGAGGAGGG + Intronic
918363257 1:183780516-183780538 CCATCCAAGCATTCAGTGCTGGG - Intronic
918525958 1:185465338-185465360 CCATGGAGGCATTCAGAGACTGG + Intergenic
919833290 1:201556803-201556825 CCACACAGGCATTTGGAGGATGG - Intergenic
920259205 1:204677565-204677587 CCACCCAGGCAGTGAAAGGAAGG + Intronic
920304325 1:205009003-205009025 CCATCCAGGCTTCCTGAGGGTGG - Intronic
920967669 1:210714699-210714721 CCATCCCTGCCTTCAAAGGAAGG + Intronic
923685315 1:236149354-236149376 CCAGCCAGGCGTGCAGAGGCAGG + Intronic
923786397 1:237072373-237072395 GCTTCCAGGCATTGAGCGGATGG + Intronic
1070272900 10:74975422-74975444 CCATGAATGCATTCACAGGAAGG + Exonic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1071829734 10:89359763-89359785 AGATCCAGGCCTTCAGTGGATGG - Intronic
1073556386 10:104456219-104456241 CCATACAGGGATATAGAGGATGG + Intergenic
1075581254 10:123620208-123620230 CCTTCCTGGCTTTCTGAGGAAGG - Intergenic
1076569779 10:131425080-131425102 ATCTCCAGGGATTCAGAGGAGGG - Intergenic
1076577070 10:131476345-131476367 CCACCCAGGCCCTCAGGGGACGG - Intergenic
1077211898 11:1375057-1375079 CCTTCCAGGGACTCAGAGGTGGG - Intergenic
1078509281 11:11973596-11973618 GAATGCAGTCATTCAGAGGATGG + Intronic
1079545512 11:21627882-21627904 CTATCAAGGCATTCTGAGGAGGG + Intergenic
1079716767 11:23757086-23757108 CCATTCTGGGATCCAGAGGACGG - Intergenic
1083199406 11:61110962-61110984 CCAGACAGGCACCCAGAGGAAGG + Intronic
1083326290 11:61874611-61874633 GCATGCAGGCACTCAGAGAAGGG - Intronic
1085621328 11:78040050-78040072 CCATCCAGGCACACAGAGTGTGG + Intronic
1085888727 11:80552272-80552294 CCATTCAGGCTTTCAATGGATGG - Intergenic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1088900001 11:114108668-114108690 CCATCGCTGCATTCAGAGGCGGG - Intronic
1089502579 11:118940997-118941019 CCCTCCAGGCCTTCGGAGGAAGG - Intronic
1090612264 11:128481975-128481997 CCACTCATCCATTCAGAGGAGGG + Intronic
1090650302 11:128800326-128800348 CCACCCAGTCATTGAGAGCAAGG + Intronic
1094212668 12:27908931-27908953 CAATTCAGGCTTTCAGAGTAGGG + Intergenic
1095509168 12:42930480-42930502 CCACCCAGCCATTGAGAGAATGG + Intergenic
1098715169 12:73821237-73821259 CCATTCTGGGATCCAGAGGATGG + Intergenic
1099855912 12:88166390-88166412 ACAACCAAGCATTCACAGGAAGG - Exonic
1100800163 12:98222596-98222618 CCATGAAGGCATTTAGAGGAAGG - Intergenic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1101338501 12:103819185-103819207 ACATCCAGGCTTTCAGGTGATGG - Intronic
1101769263 12:107733418-107733440 ACATCCAGCCATTCAGACAAAGG - Exonic
1102812640 12:115837755-115837777 CCCTCCAGCAATTCAGGGGACGG - Intergenic
1103285775 12:119800169-119800191 ACAGCCAGGCATTCAGAGCTTGG + Intronic
1103842257 12:123874627-123874649 CCATCCATCCATTCAATGGATGG + Intronic
1106550007 13:30762877-30762899 CCATGGAGGCAGTCAGAGGAGGG + Intronic
1108493651 13:51004485-51004507 CCATCCAGTCCTTCACATGATGG - Intergenic
1111571657 13:90095697-90095719 TCATCCAGGAACTCAGAGGGAGG - Intergenic
1112109948 13:96285430-96285452 CCATTTAGCCATTGAGAGGATGG + Intronic
1112345568 13:98586340-98586362 CCATCTAGGGATTCAAAGAAGGG + Intergenic
1112915066 13:104538179-104538201 CCATCCATGCAGTCAGAAGTTGG - Intergenic
1113081287 13:106523069-106523091 CCTTCCTGGGCTTCAGAGGAGGG + Intronic
1118061635 14:62145060-62145082 GCATCCAGCACTTCAGAGGAAGG - Intergenic
1119474693 14:74920284-74920306 CCATCCATTTTTTCAGAGGAGGG + Intronic
1119855696 14:77898962-77898984 CCCTCCTGGAATTCAGAGGAGGG + Intronic
1120974541 14:90237100-90237122 CCCCCCAGGCAGTCAGGGGAGGG + Intergenic
1120995923 14:90418822-90418844 CCTTCCATGGTTTCAGAGGAAGG - Intergenic
1122159889 14:99775322-99775344 GCACTGAGGCATTCAGAGGAGGG + Intronic
1122832727 14:104408879-104408901 CCATTGAGGCATTGAGAGGCAGG - Intergenic
1122838213 14:104441683-104441705 CCACCCAGGCATCCAGCAGACGG - Intergenic
1122920588 14:104878329-104878351 CCATCGAGGCAGGCAGAGGAGGG - Intronic
1124001965 15:25767478-25767500 CTATGCAGCCAGTCAGAGGAGGG - Intronic
1125062215 15:35437969-35437991 CCTCCCAGGGACTCAGAGGAAGG - Intronic
1127699599 15:61485362-61485384 CCATTCAGTCTTTCAGATGAGGG + Intergenic
1129193996 15:73953491-73953513 CCAGCCAGACCTGCAGAGGAAGG - Intergenic
1129379621 15:75156838-75156860 CCTTCCAGACATGCAGAGAATGG - Intergenic
1129675196 15:77629535-77629557 CCACACAGGCACTCAGAGAAGGG - Intronic
1129930381 15:79405599-79405621 GCTTCCAGGCATTCAGTGGTCGG - Intronic
1130337908 15:82973367-82973389 CAATCCAGGCTTACAGATGACGG - Intronic
1131259761 15:90882257-90882279 CCATCCAGGCAGTCGGGGGCTGG + Exonic
1131332915 15:91518702-91518724 TCATCCATGCACCCAGAGGAAGG + Intergenic
1134802395 16:17097349-17097371 CCATCAAGGCATTCAGATAAAGG - Intergenic
1136171715 16:28494045-28494067 CCATCAAGGAAGTCACAGGAAGG + Intronic
1136450525 16:30352064-30352086 CCTTCCAGGAATTCAGAGTCTGG - Exonic
1137908497 16:52351220-52351242 CTAACAAAGCATTCAGAGGAGGG - Intergenic
1140545596 16:75805829-75805851 ACATCCAGGTATTGGGAGGATGG + Intergenic
1143892459 17:10113066-10113088 CCATGCAGGCAGTGAGTGGATGG - Intronic
1144764604 17:17725595-17725617 CCATCGGGGGATGCAGAGGAAGG + Intronic
1145279913 17:21459590-21459612 CCATCCAGGCATGGAGAGCTAGG - Intergenic
1145792114 17:27633850-27633872 CTGTCCTGCCATTCAGAGGAGGG + Intronic
1145807018 17:27741754-27741776 CCATCCTGCCGTTCAGAGGAGGG + Intergenic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1147371604 17:39996573-39996595 CCAGGCAGGGATTCAGAGGGCGG + Intronic
1148717954 17:49729219-49729241 CCTCTCAGGGATTCAGAGGAAGG + Intronic
1148725797 17:49789048-49789070 CGATCCAGGCAAGCAGAGGGCGG - Intronic
1149506347 17:57197102-57197124 CCATCCAGTTATTGAGAGCAAGG + Intergenic
1149552401 17:57549957-57549979 GCATCCAAGCATTTGGAGGAGGG + Intronic
1153363867 18:4231340-4231362 CCACCCAGGCTTCCAGAGCAGGG - Intronic
1153914001 18:9729658-9729680 CCAGCTAGGCATTTAGAGGGGGG - Intronic
1155748756 18:29393609-29393631 GCACCCTGGCATGCAGAGGAAGG + Intergenic
1156083825 18:33375460-33375482 CCATCCTGGCATTGAGAGTAAGG + Intronic
1156603858 18:38642505-38642527 CAACCCACCCATTCAGAGGAGGG + Intergenic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1163406994 19:17128982-17129004 CCATGCAGGCACTGAGATGAAGG - Intronic
1163538252 19:17890840-17890862 AAATCCAGGCATTCAGTGAAGGG - Intronic
1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG + Intergenic
1165354659 19:35296062-35296084 CCATCCAGGCCTGCTGGGGAAGG - Intronic
1165383925 19:35499510-35499532 CCAACCAGGCATCCACAGGCCGG + Intronic
1165659769 19:37567065-37567087 CCATGCAGGTATCTAGAGGAAGG - Intronic
1167255443 19:48425100-48425122 CCATCCCTGCCTTCTGAGGAAGG - Intronic
926721647 2:15965672-15965694 CCATCCAGCCCTTCAGAGCTGGG + Intergenic
926906349 2:17809165-17809187 CAAACCAGGCACTCAGTGGAAGG - Intergenic
927012552 2:18920600-18920622 CCATCAAGGCACTCTGAGGAAGG + Intergenic
927019374 2:19000962-19000984 ACATCCAGGGCTTCAAAGGAGGG + Intergenic
927436274 2:23069189-23069211 GCATTGAGGCTTTCAGAGGATGG - Intergenic
927864857 2:26581819-26581841 TCATCCAGGCAGTCAGAAGAGGG + Intronic
928339935 2:30434101-30434123 GAATGCAGGCATTCAAAGGAAGG - Intergenic
928976885 2:37096921-37096943 CCATCCAAGCATGAAGAGGAGGG + Exonic
929050303 2:37830829-37830851 CCACACAGGCACTCAGAGGCAGG + Intergenic
929403147 2:41609172-41609194 CTATCCAGGCATTCAAACCAGGG + Intergenic
931538096 2:63300533-63300555 CCATCAGGGCAGTCAGAGGCTGG - Intronic
932197699 2:69798442-69798464 CCAGTCAGGCAATCAGAGGCTGG + Intronic
932791473 2:74657555-74657577 CCATCCAGTCAATCTGAGAAAGG - Exonic
935343564 2:102081987-102082009 CCCTCCAGGTATTCTGAGGCAGG - Intronic
935504191 2:103879541-103879563 CCATACAGCCATACAGAGGCTGG - Intergenic
936507386 2:113118204-113118226 CCATGCAGGCACTCTGAGGCAGG + Intronic
937814485 2:126236438-126236460 TCATCCATGCCTACAGAGGAAGG - Intergenic
939197569 2:138991428-138991450 CCTTCCAGGCACTCAGAGAAAGG - Intergenic
940476905 2:154174187-154174209 CCATCCAGCCAATCAGTGAAGGG - Intronic
940588457 2:155687058-155687080 CCATCTTGGCTTTCACAGGATGG + Intergenic
945205455 2:207326895-207326917 GGATCAAGGCATTCAGAGCAAGG - Intergenic
1169260628 20:4135747-4135769 CCTTCCAGTGACTCAGAGGATGG + Intronic
1169352513 20:4880724-4880746 GCACCCAGGCATGCAGAGGTGGG - Intronic
1170304105 20:14918413-14918435 CCATCCAGGCAACCGGAGGAGGG + Intronic
1170882221 20:20306729-20306751 CTTTCCAGGCAGGCAGAGGAAGG + Intronic
1172056212 20:32155846-32155868 ACGTCCAGGCTTACAGAGGAGGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173856548 20:46253786-46253808 CCCTGCAGGGATGCAGAGGAGGG + Intronic
1174845686 20:53940985-53941007 CCTTCCAGGCACTCTGAGAAGGG + Intronic
1181306665 22:21920987-21921009 TCATTCAGACATTCAGAGAATGG - Exonic
1183718494 22:39548361-39548383 CCATCCACGGATTCAGATGAGGG - Intergenic
1183954571 22:41371713-41371735 CCATCCAGTTCTTCAAAGGAAGG - Intronic
1184389169 22:44192991-44193013 CCAGCCAAGCCTTCAGAGGATGG - Intronic
1185095349 22:48803367-48803389 CCCTCCAGGCATCCAAAGGCTGG + Intronic
1185197727 22:49482884-49482906 GAATCCAGGCATCCAGAGGGGGG - Intronic
951372673 3:21870262-21870284 ACATCCAGGCATTCAAGGCAGGG + Intronic
954953932 3:54501951-54501973 CCATCCAGGCAAGAAGAGAATGG - Intronic
956030406 3:65030974-65030996 CCTTCAAGGCATTCAAAAGATGG + Intergenic
956754541 3:72372243-72372265 ACACCCAGGCAGTCAGAGGTAGG + Exonic
956845830 3:73181831-73181853 CCATCCAAGCATGAAGAGGAGGG - Intergenic
957814397 3:85274469-85274491 CCATTCATTCATTAAGAGGAAGG + Intronic
958982982 3:100746387-100746409 ACATACAGCCATTCAGTGGAGGG + Intronic
959903117 3:111681988-111682010 CAAACCAGGCCTGCAGAGGAGGG + Intronic
961210179 3:125119515-125119537 CCATCTGGGTAATCAGAGGATGG + Intronic
961480766 3:127178426-127178448 CTATCCATGCACTCAAAGGATGG - Intergenic
962175337 3:133147945-133147967 TTATCACGGCATTCAGAGGAGGG - Intronic
965548099 3:169935758-169935780 CCTTCCTGGCTTTCAGAGAAAGG + Intronic
968219917 3:196929266-196929288 CCATCCTAGCATCCAGAGGCTGG + Intronic
968656194 4:1779482-1779504 CCATCCAGGTGGTCAGGGGATGG - Intergenic
969363961 4:6683108-6683130 GGCTCCAGGCATTCAGAGGTGGG + Intergenic
973742072 4:53927677-53927699 CCATTCTGGCTTTCAGAGGCTGG + Intronic
974971811 4:68839569-68839591 CTAACAAGGCATTCATAGGAAGG + Intergenic
978069510 4:104449832-104449854 CCATCCAGAGATTCTCAGGAGGG - Intergenic
979345683 4:119584221-119584243 CCATCCCCGCTTTCAGATGATGG - Intronic
980642238 4:135595950-135595972 CCATCAAGGCAGTTAGAGGCTGG - Intergenic
980728565 4:136797800-136797822 CCATTCAGGAAGTCAAAGGATGG - Intergenic
981348894 4:143705319-143705341 ACAGCAAGGCATTCAGAAGAGGG + Intergenic
984420792 4:179518277-179518299 TCATTCACACATTCAGAGGATGG - Intergenic
985370197 4:189278770-189278792 CCAACTAGGAATTCACAGGAAGG - Intergenic
985695255 5:1336503-1336525 CCTTGCAGGCATTCAGGAGATGG - Intronic
986064069 5:4218807-4218829 CCCTCCAGCCCTTCACAGGAGGG + Intergenic
986482870 5:8206182-8206204 CGATGCTGGCATTCAGAGAAAGG - Intergenic
986785580 5:11111375-11111397 CCAGCCAGGGAGTCAGAGGTGGG - Intronic
986965642 5:13267522-13267544 CCATTCTGGCATCTAGAGGAAGG + Intergenic
994443124 5:99836023-99836045 CCATTCTGGGATCCAGAGGACGG - Intergenic
995687131 5:114783230-114783252 CCATACTGGGATGCAGAGGATGG - Intergenic
998592294 5:143490348-143490370 CCATCCAGGAGCTCACAGGATGG + Intergenic
999239501 5:150119320-150119342 GGATCCAGCCATTCAAAGGATGG - Intronic
1006061422 6:31423045-31423067 CCAGTCAGGCATTCGGAGGCTGG + Intergenic
1006854932 6:37126093-37126115 CCACCCAGCTACTCAGAGGAGGG - Intergenic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1017294708 6:152780179-152780201 CCATCCAGGCTTTCAAACAATGG - Intergenic
1017950007 6:159128444-159128466 TCTCCCAGGCCTTCAGAGGAGGG - Intergenic
1023188505 7:37555274-37555296 CCATCCTGGCATCTAAAGGATGG + Intergenic
1024146699 7:46523919-46523941 CCATCAAAGCACTCAGAGAAGGG + Intergenic
1024423503 7:49198275-49198297 CCATCCAGAGAGTCAGTGGAAGG - Intergenic
1024684068 7:51725993-51726015 CCAACCAGGCCTTCAGCTGAAGG - Intergenic
1026450728 7:70526840-70526862 CCATTCAGAGATTCAGAGGCTGG - Intronic
1029976976 7:104843992-104844014 CCAACCAGGGACTCAGAGCATGG + Intronic
1033036573 7:137881031-137881053 ATTTCTAGGCATTCAGAGGAGGG + Intronic
1033129346 7:138732440-138732462 CCATCTTGGCATCCAGTGGAGGG - Intronic
1033151775 7:138920937-138920959 CCATCCAGTCACTTAGAAGATGG - Intronic
1033251218 7:139761522-139761544 CCATACAGGAAATCAGAGGATGG + Intronic
1036418541 8:8573724-8573746 CCATCAAGGCCTTCATAGGGCGG - Intergenic
1036699024 8:10999032-10999054 TCTTCCAAGCATTGAGAGGAGGG - Intronic
1037005979 8:13780258-13780280 CCATCCAGGAACTCACATGATGG + Intergenic
1038492875 8:27982673-27982695 CCGCCCAGGCATGCAGAGAAGGG + Intronic
1038547433 8:28436227-28436249 CCATCTAGGAATTCTGGGGAAGG + Intronic
1039414126 8:37379110-37379132 CAGTCCAGGCCTTCAGGGGAAGG - Intergenic
1041487795 8:58398013-58398035 TCATCCACACATTCAGAGCAGGG - Intergenic
1042331206 8:67582558-67582580 CCCTCCAGGCATTCATAACAGGG - Intronic
1043438615 8:80257544-80257566 CCCTCCAGGCACTGAGAGGGTGG + Intergenic
1043758012 8:84028891-84028913 CCATCCAGTCATTTTGAGCAGGG - Intergenic
1045006039 8:97917636-97917658 GCAACCAGGCATTCAAAGCAGGG + Intronic
1046788206 8:118291282-118291304 CCATCCAGGCCTGCAGGAGAGGG + Intronic
1047598918 8:126407179-126407201 CCCTGCAGGAATGCAGAGGAAGG + Intergenic
1048883850 8:138892715-138892737 CCATTCAGGGACCCAGAGGAGGG + Intronic
1049956745 9:700123-700145 TCATTCAGGCATTCAAATGATGG - Intronic
1050083241 9:1937796-1937818 CCATTCAGGCCTTCAACGGATGG - Intergenic
1051356478 9:16243900-16243922 CCAACCAGGAAATCAGTGGAGGG - Intronic
1052059695 9:23945400-23945422 CCACCCAGGTACTCAGAGAAAGG + Intergenic
1053160930 9:35813008-35813030 CCATCCAAGCATCCAGAGTCTGG + Exonic
1053426011 9:38010638-38010660 CTCTCCAGGAGTTCAGAGGAGGG - Intronic
1056782884 9:89564553-89564575 ACAGCCAGCCATTCAGAAGACGG + Intergenic
1056956308 9:91084385-91084407 CCATTCAGACAGTCAGGGGAAGG + Intergenic
1057249066 9:93485050-93485072 TCACCATGGCATTCAGAGGAAGG - Intronic
1059636843 9:116179647-116179669 ACCATCAGGCATTCAGAGGAAGG - Intronic
1060681565 9:125569491-125569513 CCTCCCAGGTATTCAGAGAAAGG - Intronic
1062403674 9:136383411-136383433 CCAGCCAGCCATGGAGAGGAGGG - Exonic
1188512416 X:30950587-30950609 CCCACCAGGCATTCGTAGGAAGG + Intronic
1188690149 X:33119493-33119515 CGATCAAGGCAGTTAGAGGATGG + Intronic
1190411890 X:50144625-50144647 CCAGACATGCCTTCAGAGGATGG + Intergenic
1191255207 X:58276702-58276724 GCGTCCAGGCTTTCAGGGGAAGG - Intergenic
1191256108 X:58280296-58280318 ACATCCAGGCTTTCAGGGGGAGG - Intergenic
1193707831 X:84844623-84844645 CCATCAAGGCAGCCAGAGGGAGG - Intergenic
1195852606 X:109299202-109299224 CCAACAAAACATTCAGAGGAAGG + Intergenic