ID: 1101338540

View in Genome Browser
Species Human (GRCh38)
Location 12:103819662-103819684
Sequence GGGATAAGCAGACGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101338540_1101338546 13 Left 1101338540 12:103819662-103819684 CCAGCTTTTCGTCTGCTTATCCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1101338546 12:103819698-103819720 AAATGTGGTGAACAACCTATAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1101338540_1101338547 22 Left 1101338540 12:103819662-103819684 CCAGCTTTTCGTCTGCTTATCCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1101338547 12:103819707-103819729 GAACAACCTATAGGAAAAACTGG 0: 1
1: 0
2: 1
3: 17
4: 234
1101338540_1101338545 -2 Left 1101338540 12:103819662-103819684 CCAGCTTTTCGTCTGCTTATCCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1101338545 12:103819683-103819705 CCACAGAGCACTGGGAAATGTGG 0: 1
1: 0
2: 3
3: 31
4: 316
1101338540_1101338542 -10 Left 1101338540 12:103819662-103819684 CCAGCTTTTCGTCTGCTTATCCC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1101338542 12:103819675-103819697 TGCTTATCCCACAGAGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101338540 Original CRISPR GGGATAAGCAGACGAAAAGC TGG (reversed) Intronic
900767011 1:4512558-4512580 GGGAGAGGGAGACGAAAAGAGGG + Intergenic
900947456 1:5839097-5839119 GGCAGAAGCAGAAGAACAGCAGG + Intergenic
901563027 1:10088290-10088312 GGGATAAGAAAACCAACAGCCGG - Intronic
902224590 1:14988636-14988658 GGGATAATCAGAAGCACAGCTGG - Intronic
903387250 1:22935496-22935518 GGCATAAGCAAAAGAAGAGCAGG + Intergenic
904484947 1:30818566-30818588 GTGCTAAGGAGAAGAAAAGCAGG + Intergenic
904892528 1:33789866-33789888 GGGTCAAACAGAGGAAAAGCAGG - Intronic
905176128 1:36136543-36136565 GGGATAAGCAGAAAGAAAACAGG + Intergenic
908498702 1:64721587-64721609 GGGATGAGAAGAAGAAGAGCGGG - Intergenic
909682141 1:78303700-78303722 TGGAAAAGCAGACAAAAAGTTGG - Intergenic
910806752 1:91195818-91195840 CAGATAAGCACACGAGAAGCAGG + Intergenic
914930780 1:151930918-151930940 GGGAGAACCTGACCAAAAGCGGG - Intergenic
915137991 1:153747244-153747266 GGGAAAAACAGATGAAGAGCAGG - Intronic
919551115 1:198988971-198988993 GGGATAAGCAGAGTATCAGCTGG + Intergenic
920670779 1:208002391-208002413 GGGATAGGCAGCCTAAGAGCGGG - Intergenic
921334777 1:214075340-214075362 GGGATGAGCAGAGGAAAGGTGGG - Intergenic
921965076 1:221079560-221079582 GTGAGAAGGAGACAAAAAGCAGG - Intergenic
923548579 1:234943026-234943048 GGCATAAGCAAAAGAACAGCAGG + Intergenic
1066958218 10:42193215-42193237 AGGAAATGCAGACCAAAAGCAGG - Intergenic
1075838116 10:125473707-125473729 GGGAAAAGCAGACCAAAAGAAGG - Intergenic
1080428596 11:32178381-32178403 TGGAAAAGCAGAGGAAAAGTAGG - Intergenic
1081406624 11:42706036-42706058 GGGATAAGTGAACAAAAAGCAGG + Intergenic
1082798662 11:57397368-57397390 AGGATAAGCAGAGGAGAAGTGGG + Intronic
1085366353 11:75949249-75949271 GGGAGAAGCAGAAGGACAGCTGG - Intronic
1086406427 11:86503044-86503066 GGGAGAAGCAGAAGAAGAGGAGG - Intronic
1086755349 11:90554863-90554885 GGGAGAAGGAGAAGAAAAGAAGG - Intergenic
1087111398 11:94473162-94473184 GGGCTAAGCAGAATAAATGCAGG + Intronic
1087233174 11:95689235-95689257 TGGATAAGCAGATGGCAAGCAGG - Intergenic
1089258104 11:117204617-117204639 GGGCTAAGCAGGGGAGAAGCGGG + Exonic
1091970684 12:4784280-4784302 GGCATAAGCAAAAGAACAGCAGG - Intronic
1092556290 12:9565735-9565757 GGGAAAAGCAAATGAAAAGAAGG + Intergenic
1092761443 12:11814841-11814863 GGCAGAAGCAGGCGAAAAGAGGG - Intronic
1094515802 12:31124917-31124939 GGGAAAAGCAAATGAAAAGAAGG - Intergenic
1097889169 12:64759733-64759755 GGGAAGAGAAGATGAAAAGCAGG + Intergenic
1101273038 12:103168175-103168197 GGTGTAAGCAGAAGAAAAGTGGG - Exonic
1101338540 12:103819662-103819684 GGGATAAGCAGACGAAAAGCTGG - Intronic
1101872251 12:108575633-108575655 GGAATCTGCAGAAGAAAAGCTGG - Intergenic
1104521101 12:129476112-129476134 GGTATGAGCAGACAGAAAGCAGG - Intronic
1108004535 13:45933880-45933902 GGGATGAGCAGAGGAAGAGCTGG + Intergenic
1108534835 13:51364484-51364506 GGGGTAAGCAGTAGAAAAGAAGG - Intronic
1111140148 13:84106581-84106603 GAGATAAGAAGAGGAAAACCTGG + Intergenic
1112072857 13:95874110-95874132 GGAATAAGCAGACAAAAATAAGG - Intronic
1113191176 13:107748169-107748191 AGGATAAGAAAATGAAAAGCAGG + Intronic
1113513988 13:110876894-110876916 GGCATAAGCAAAAGAACAGCAGG - Intergenic
1113585190 13:111459925-111459947 GGGAGAAGGAGAGGAAAAGAGGG + Intergenic
1113585235 13:111460104-111460126 GGGAGAAGGAGAGGAAGAGCAGG + Intergenic
1113819786 13:113204737-113204759 GGGATGTGAAGAGGAAAAGCAGG + Intronic
1116801581 14:49449825-49449847 GGCATAAGCAAAAGAACAGCAGG - Intergenic
1118737657 14:68713647-68713669 GGGAGAAGCAGAGCAAAAGCTGG + Intronic
1118905544 14:70020760-70020782 GGGAAAATCAGAAGAAAGGCAGG + Intronic
1119879121 14:78086277-78086299 GGGTTGTGCAGATGAAAAGCTGG + Intergenic
1124040761 15:26100946-26100968 GGCATAAGCAAAAGAACAGCAGG + Intergenic
1124839266 15:33226637-33226659 GGCATAAGCAAAAGAACAGCAGG + Intergenic
1125525521 15:40371655-40371677 GCGTTAAGCAGACCAAAGGCTGG + Intergenic
1125719502 15:41838595-41838617 GGGCTGAGCAGAAGGAAAGCAGG - Intronic
1128095745 15:64953670-64953692 GGGAGAAGGAGAAGAAAAGAAGG - Intronic
1130434104 15:83879775-83879797 AGAATAAGCAGACAAAAATCAGG - Intronic
1133715260 16:8441309-8441331 GAGACAAGCAGACGAACAACAGG + Intergenic
1136065226 16:27754138-27754160 TGGAGAAGCAGAGGAAAAGGGGG - Intronic
1148287993 17:46413307-46413329 AAGACAAGCAGAAGAAAAGCTGG - Intergenic
1148310163 17:46630887-46630909 AAGACAAGCAGAAGAAAAGCTGG - Intronic
1149456963 17:56796018-56796040 GGGATAAGCAGAAGAAAGCTAGG + Intronic
1150458943 17:65330861-65330883 GGGATCAGCAGAGGCAAAGGTGG - Intergenic
1151422197 17:74005914-74005936 GGGACTAGCAGACCAAAGGCAGG - Intergenic
1152648163 17:81479814-81479836 TGGAGAAGCTGAAGAAAAGCAGG - Intergenic
1160218070 18:76951481-76951503 GGGAGCTGCAGAAGAAAAGCTGG - Intronic
1161181261 19:2884304-2884326 GGCATAAGCAAAGGAACAGCAGG - Intergenic
1164324476 19:24179785-24179807 GGGAGAAGAAGACGAGAAGGAGG + Intergenic
1165303003 19:34984003-34984025 TGGAAAAGCAGAAGAGAAGCAGG - Intergenic
1166396967 19:42448523-42448545 GGTATAAGCAAACAAAAAGAGGG + Intergenic
1167838478 19:52095024-52095046 GGGATCAGGAGAGGAAAAGACGG - Intronic
1167843201 19:52139146-52139168 GGGATCAGGAGAGGAAAAGAGGG - Intronic
1167846662 19:52170778-52170800 GGGATCAGGAGAGGAAAAGAAGG - Intronic
1168628317 19:57936295-57936317 GGCATAAGCAAAAGAACAGCAGG - Intergenic
1168684471 19:58339730-58339752 GGGCTAAGCAGCAGAAAAGCAGG - Exonic
928050311 2:27986916-27986938 GGGATGAGCAGAGGAAAAAAGGG + Intronic
928124337 2:28605468-28605490 AGGACCAGCAGACCAAAAGCTGG + Intronic
928435046 2:31249445-31249467 GGGAGAAGCAGAGGATCAGCCGG + Exonic
930746742 2:54892200-54892222 GGGATATGAAGATGAAAAGAGGG - Intronic
934306332 2:91825623-91825645 AGGAAATGCAGACCAAAAGCAGG - Intergenic
934326924 2:92027119-92027141 AGGAAATGCAGACCAAAAGCAGG + Intergenic
934465301 2:94257674-94257696 AGGAAATGCAGACCAAAAGCAGG + Intergenic
936878526 2:117221447-117221469 GGGATAAGGAGATGGAGAGCAGG + Intergenic
937530163 2:122818552-122818574 GTGATAAGCAGACAAAATCCAGG + Intergenic
942852384 2:180504192-180504214 GTGAGAATCAGAAGAAAAGCAGG - Intergenic
1169425757 20:5496343-5496365 GGCATAAGCAAAAGAACAGCAGG - Intergenic
1173282679 20:41643454-41643476 GTGATAAGGAGACCAGAAGCAGG - Intergenic
1173820392 20:46015849-46015871 GGGATAAGCAGAAAAAATGCAGG - Intronic
1174285115 20:49467338-49467360 GTGATAAGCAAAGGAAAGGCTGG + Intronic
1174806135 20:53605983-53606005 GGGATAAGAAGGGGAAAAACAGG + Intronic
1174996882 20:55579705-55579727 TGGATCAGCAGACTCAAAGCAGG + Intergenic
1176024642 20:62979522-62979544 GGCAAAAGCAGTCGAAAACCTGG + Intergenic
1178878875 21:36433015-36433037 AGAGTAAGCAGACAAAAAGCAGG - Intergenic
1179551836 21:42148372-42148394 GGGATAAGCAAAAGAACAGCAGG - Intergenic
1179822498 21:43944743-43944765 GGGGAAAGCAGAAGAAAAGAGGG + Intronic
1180029559 21:45196711-45196733 GAAATAAGCACATGAAAAGCTGG + Intronic
1180279235 22:10678330-10678352 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1180586450 22:16896865-16896887 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1183248432 22:36711416-36711438 GTGAGAAGCAGAAGCAAAGCAGG + Intergenic
1185015660 22:48341156-48341178 GGGAGAAGCAGAAGGAATGCAGG + Intergenic
1185286450 22:50002033-50002055 GGGAGAAGCAAAAGAACAGCAGG + Intronic
949316508 3:2762150-2762172 AGAATAAGCAGTAGAAAAGCGGG + Intronic
949849612 3:8409964-8409986 GGGATTGGCACACGAAAACCAGG + Intergenic
950236196 3:11322728-11322750 GGGATAAGGAGAGGAAAAAGAGG - Intronic
950390822 3:12695178-12695200 CAGTTAAGCAGAGGAAAAGCTGG + Intergenic
951125315 3:18976974-18976996 GGGAAAAACAGCAGAAAAGCTGG + Intergenic
952036126 3:29203722-29203744 TGGATGAGCAGAGGAGAAGCAGG + Intergenic
954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG + Exonic
954508831 3:51103924-51103946 GGGAGAAGCAGACAAAAAACAGG + Intronic
955318318 3:57957112-57957134 GGGAGAGGCAGAAGAAAAGAAGG - Intergenic
956124575 3:65999299-65999321 GGGATAAGGAGAGGAAAGACAGG + Intronic
958000886 3:87747504-87747526 GAGATAATCAAAAGAAAAGCAGG + Intergenic
958192512 3:90200779-90200801 GGCATAATCAAACGAGAAGCAGG + Intergenic
958415929 3:93872707-93872729 GGCATAATCAAATGAAAAGCAGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959578427 3:107960207-107960229 AAGAAAAGCAGACTAAAAGCAGG - Intergenic
959690557 3:109193057-109193079 GGCATAAGCAAAGGAACAGCAGG + Intergenic
963797802 3:149648602-149648624 GAGTTAAGCAGGCAAAAAGCAGG + Intronic
964458201 3:156892145-156892167 GGGATAAGAAGAAGAAAGGCAGG + Intronic
965824433 3:172716608-172716630 GGGTTGGGCAGAAGAAAAGCAGG + Intergenic
966241689 3:177761483-177761505 GGGATAGGCAGAACTAAAGCAGG + Intergenic
969510532 4:7614997-7615019 TGGATAAGCAGATGAACAGATGG - Intronic
970422202 4:15915819-15915841 GGCATAAGCAAAAGAACAGCAGG - Intergenic
975148105 4:70992635-70992657 GGCATAAGCAAAAGAACAGCAGG - Intronic
976326131 4:83773757-83773779 GGGAAAGGCAGGCCAAAAGCAGG - Intergenic
977352628 4:95907473-95907495 GAAATAAGCAGAAGACAAGCAGG - Intergenic
977367519 4:96089709-96089731 GGTATAAGCAAAAGAACAGCAGG - Intergenic
981363577 4:143875402-143875424 GGCATAAGCAAAGGAATAGCAGG + Intronic
981374321 4:143996197-143996219 GGCATAAGCAAAGGAATAGCAGG + Exonic
984520551 4:180796511-180796533 GAGACAAGCAGACGAATGGCAGG - Intergenic
985966302 5:3340990-3341012 AGGAAAAGCAGACGAACAACAGG - Intergenic
987310779 5:16679274-16679296 GGGAGAACCTGACGCAAAGCAGG + Intronic
994113079 5:96030509-96030531 GGGATAGGCTCATGAAAAGCTGG + Intergenic
995008485 5:107230427-107230449 GGGAAAAGCAGTGGAAAAGAGGG + Intergenic
997532553 5:134591231-134591253 GGCATAAGCAAAAGAACAGCAGG - Intergenic
1001284447 5:170412290-170412312 GGGAAAAGCAGGAGAAAAGATGG + Intronic
1005283666 6:24301796-24301818 GGGATAAGGAGGCGAGAAGCTGG + Exonic
1007284655 6:40738894-40738916 GGGATGAGCAGACAGAAAGTAGG + Intergenic
1008038642 6:46774039-46774061 GGGTTAAGCAGAAGAAGAGGAGG + Intergenic
1010640443 6:78319770-78319792 GGGATAAACAGAAGAGAAGGAGG - Intergenic
1013249966 6:108324340-108324362 GGGATCAGCAGTGGAAAAGGAGG + Intronic
1013603844 6:111730301-111730323 GGGATAACCGAACCAAAAGCAGG + Intronic
1014762711 6:125375211-125375233 GGAATAAACAGAGGAAAAGAAGG - Intergenic
1014986181 6:128013214-128013236 GGGATGAGCAAACAAAAATCTGG - Intronic
1017323820 6:153124023-153124045 GAGATAAGGGGAAGAAAAGCAGG - Intronic
1017947397 6:159106785-159106807 GGCATAAGCAAAGGAACAGCAGG + Intergenic
1018562253 6:165113586-165113608 GAGATAAAAAGAAGAAAAGCTGG - Intergenic
1018891231 6:167984549-167984571 GGCATAAGCAGAAGAACAGCAGG - Intergenic
1018900362 6:168048860-168048882 GTGAGAGGCAGACGAAAACCTGG - Intergenic
1021289516 7:18825355-18825377 GGGAAAAGTAGAGGAAAACCAGG + Intronic
1024380680 7:48692467-48692489 GGGAAAAGCAGAACAAAACCAGG - Intergenic
1033445548 7:141418619-141418641 GGGATAAGAAGAAGAAGAGAAGG - Intronic
1036643528 8:10598669-10598691 GGGTTAAGCAGTGGAAAAGTGGG - Intergenic
1037671318 8:21017545-21017567 AAGATAAGCAGAAGAAAAACTGG + Intergenic
1037818170 8:22122716-22122738 GGGACAATCAGACGGGAAGCTGG + Intronic
1038733056 8:30144744-30144766 GAGATAAGCAGAATAAAAACTGG + Intronic
1040719325 8:50298078-50298100 GGGATGAGCAGGTGTAAAGCTGG - Intronic
1045057764 8:98384067-98384089 GGCATAAGCAAAAGAACAGCAGG + Intergenic
1045117153 8:98995152-98995174 GAGAGAAGGAGAAGAAAAGCCGG - Intergenic
1053695365 9:40634458-40634480 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1053942360 9:43265499-43265521 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054306609 9:63433684-63433706 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054405351 9:64757673-64757695 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054438975 9:65243162-65243184 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054491431 9:65778780-65778802 AGGAAATGCAGACCAAAAGCAGG - Intergenic
1055460189 9:76512110-76512132 GGGAGAAGCAGGAGAAGAGCAGG + Intergenic
1055865135 9:80804055-80804077 GGCATCATCAGAAGAAAAGCTGG + Intergenic
1056239809 9:84633506-84633528 AGGAGAAGCAGAAGAAAACCAGG + Intergenic
1056470879 9:86903552-86903574 GGGATAAGCAGAAGAGAAGGAGG - Intergenic
1057253959 9:93527925-93527947 GGTAGAAGTAGAAGAAAAGCAGG - Intronic
1061236324 9:129344698-129344720 GGGAAATGCAGATGAAAACCCGG + Intergenic
1061280106 9:129593081-129593103 GGGTTAAGGAGACCCAAAGCAGG + Intergenic
1061796654 9:133089296-133089318 GGCATAAGCAAAGGAACAGCAGG + Intergenic
1202777809 9_KI270717v1_random:8074-8096 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1185774980 X:2794709-2794731 GTGACGAGCAGACGATAAGCTGG + Intronic
1187270018 X:17771578-17771600 GAGATAAGCAGACGTAGATCAGG - Intergenic
1187462313 X:19498646-19498668 TGGATAATGAGACGAAAAGGAGG + Intronic
1188817013 X:34727991-34728013 GGGATAAGTAAATGAAAAGTAGG + Intergenic
1188904616 X:35777552-35777574 GGCATAAGCAAAAGAACAGCAGG + Intergenic
1198000427 X:132429622-132429644 GGGATTAGCAAAGGAAAAGTTGG + Intronic
1198688086 X:139249001-139249023 GGGAAAAGAAGACAAAAAGCAGG + Intergenic
1199695752 X:150341760-150341782 GGGAGAAACAGACGGAAAGAGGG - Intergenic
1200097269 X:153670137-153670159 GGGAGAAGCAGAGGGAAAGGGGG + Intronic
1201193146 Y:11466352-11466374 AGGAAATGCAGACCAAAAGCAGG + Intergenic