ID: 1101340919

View in Genome Browser
Species Human (GRCh38)
Location 12:103841286-103841308
Sequence CCCTCCCGCCGCTGCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101340907_1101340919 26 Left 1101340907 12:103841237-103841259 CCTGCAGGAGGGCAGCTCCTGCG 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 303
1101340911_1101340919 9 Left 1101340911 12:103841254-103841276 CCTGCGTCGGAACACGTGGCGGC 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 303
1101340906_1101340919 27 Left 1101340906 12:103841236-103841258 CCCTGCAGGAGGGCAGCTCCTGC 0: 1
1: 0
2: 3
3: 32
4: 352
Right 1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101340919 Original CRISPR CCCTCCCGCCGCTGCGGGGC GGG Intergenic
900082613 1:869895-869917 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
900190013 1:1349293-1349315 CCCTCGCGCCGCTCCCGGGCCGG - Intronic
900403095 1:2480662-2480684 CCCCCTCGAGGCTGCGGGGCTGG - Intronic
900407400 1:2498655-2498677 CCCTCCCGCCTGTGTGGGGCTGG - Intronic
900427605 1:2587596-2587618 CCCTCCCTGCCCTGCGGGGGTGG + Intronic
900464496 1:2818451-2818473 CCCTGCAGCCCCTGCAGGGCAGG - Intergenic
900582507 1:3416036-3416058 TTCTCCCGCCCCTGCGAGGCAGG - Intronic
900630651 1:3633429-3633451 CCTTCCCGCCGCCCCGGGCCGGG - Exonic
900768155 1:4519347-4519369 CCCTCCCGCAGCTGTCGGGCTGG - Intergenic
901049582 1:6419610-6419632 TCATCCTGCCGCTGCTGGGCCGG - Exonic
901086114 1:6613458-6613480 CCCTCCCCCCGCGGCCGAGCCGG + Intronic
901405077 1:9039965-9039987 CCCTACAGACGCTGCGCGGCTGG - Exonic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901636827 1:10674414-10674436 CCCTCCCGCAGCAGCGGTGCCGG - Intronic
901805492 1:11736166-11736188 GCCCCCCGCGGCTGCGGCGCAGG + Exonic
902235679 1:15055914-15055936 CCCTCACACGGCTGCGGGGCAGG + Intronic
902707684 1:18217015-18217037 CCCTCCCCCTGCTGTGGGTCTGG - Intronic
903738276 1:25543917-25543939 CTTTCCCGGCCCTGCGGGGCAGG + Intronic
904470590 1:30733714-30733736 CCCTCCCGCCCCTCCCTGGCAGG - Exonic
904542065 1:31239811-31239833 CCCGCCAGCCGCCCCGGGGCAGG - Intergenic
904585237 1:31576443-31576465 CCCTTCCGCCACTGCTGGGGCGG + Intergenic
904618649 1:31763041-31763063 CCCTCCCGCAGCCCCAGGGCCGG - Intronic
904751267 1:32742381-32742403 CCCTCCCCTCACAGCGGGGCAGG - Intronic
904753217 1:32754013-32754035 CCCTCCCGGGGCTGCGGGCCCGG + Intronic
906151743 1:43591626-43591648 CCCTCCCTCGGCTGTGAGGCTGG + Intronic
906695271 1:47819241-47819263 CCCTCCAGTCGCTCCAGGGCGGG + Intronic
912270158 1:108200346-108200368 CCGTCCCGCCGCTGCTGGGGAGG + Exonic
917846733 1:179026135-179026157 CCCGCCCGCCGCGCCGGGGGCGG - Intronic
919297518 1:195721501-195721523 CCCGCCCGGCGGTGTGGGGCTGG - Intergenic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
923056083 1:230426458-230426480 CCCACCCTCCTCCGCGGGGCGGG + Intergenic
1062760079 10:11433-11455 CCCTCCCGCGGCTCCTGAGCCGG + Intergenic
1062768431 10:82204-82226 CCCTCCCCTCCCTGCTGGGCTGG - Intergenic
1065025320 10:21534895-21534917 CCCTCCCGCGGCCGCGGCACGGG - Intronic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1067362362 10:45594561-45594583 CCATCCCTGCGCTGCGGGCCCGG - Intronic
1069784950 10:70981769-70981791 CCCTCCCTCCGCTGAGGGGCTGG - Intergenic
1072656699 10:97334778-97334800 CCCTACCACCGCACCGGGGCGGG + Intergenic
1075132065 10:119748637-119748659 CCCTCCCGCAGCTGGTGGTCTGG + Intronic
1075714852 10:124550257-124550279 CCCCCAGGCAGCTGCGGGGCAGG + Intronic
1076373596 10:129969406-129969428 CCGTCGCCCCGCTGCGGGGCCGG - Intergenic
1076612804 10:131737005-131737027 CCCTCCCGAGGCTCGGGGGCCGG + Intergenic
1076788602 10:132764533-132764555 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788617 10:132764584-132764606 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788630 10:132764635-132764657 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788653 10:132764745-132764767 CCCTCCCACCGCAGCAGGACTGG - Intronic
1076788688 10:132764910-132764932 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788714 10:132765020-132765042 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076788738 10:132765130-132765152 CCCTCCCACCCCTGCAGGACTGG - Intronic
1076864409 10:133160042-133160064 CACCCCCGCTGCTGCCGGGCGGG - Intergenic
1078250688 11:9614189-9614211 CCCACGCGCCGCTCCTGGGCAGG + Intergenic
1080230916 11:30017091-30017113 GCCTCCCGGCGCGGCGGGGCGGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1083306473 11:61764575-61764597 CCCTCCTGCCTCAGTGGGGCTGG + Intronic
1083596262 11:63919430-63919452 CCGCCCCGGGGCTGCGGGGCGGG + Intergenic
1083886132 11:65574321-65574343 CCGTCCCGCCGGGGCGGGGCTGG + Intergenic
1083922269 11:65787299-65787321 CCGTCCCACCTTTGCGGGGCCGG - Exonic
1083922577 11:65788461-65788483 CCCTCCCCCCTCGGAGGGGCTGG - Intronic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1084028404 11:66466946-66466968 CCATCCCGCCGCAGCGGCCCGGG + Exonic
1084150497 11:67285862-67285884 CCCTCCTGCTGCAGAGGGGCAGG + Exonic
1084174672 11:67417131-67417153 CCCTCCCGCCCCTGCCATGCTGG - Intronic
1084409417 11:68997702-68997724 ACCTCCTTCCGCTGCAGGGCGGG - Intergenic
1084758383 11:71252739-71252761 CCCGCCCGCGGCTGCGGCTCGGG + Intergenic
1085312667 11:75525612-75525634 CCGTCCCGGCGCAGCGGGTCAGG + Exonic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1088875911 11:113936087-113936109 CCCTCCCATGGCTGCTGGGCCGG - Intronic
1089457667 11:118634833-118634855 CCCTCCCGCCGCTGCCGGGCCGG + Intronic
1089533899 11:119149332-119149354 CCCCCGGGCCGGTGCGGGGCCGG - Exonic
1090235951 11:125147207-125147229 CCCTCCCTCCCCTGCCAGGCAGG + Intergenic
1091113630 11:132994197-132994219 CGCACCAGCCGCTGCGGCGCGGG - Intronic
1091791324 12:3273777-3273799 CCCTCCTGCCTGTGCGGGGCAGG + Intronic
1092487426 12:8914613-8914635 CCCTCCCGCCGCTCCGGGTGCGG - Exonic
1093435307 12:19129629-19129651 CCCTGCCGGGGCGGCGGGGCGGG + Intergenic
1094807626 12:34107861-34107883 CCCTCCCGCGGCTCCGGAGCTGG + Intergenic
1096024812 12:48351102-48351124 CGCGCCCGCCGCTGTGGGGAGGG + Intronic
1096127519 12:49130819-49130841 CCTTCCCGCCGCTCCTGGGCGGG - Intronic
1096127706 12:49131554-49131576 CCCTCGCGCGGCCGCGGGGTGGG + Intergenic
1096255017 12:50057603-50057625 CCCTCCCGCCGCCTCCCGGCCGG + Exonic
1096789020 12:54033890-54033912 CCCTCCCTCCCCTGCGGAGCCGG + Intronic
1096840924 12:54378977-54378999 CCCGCCCGCCCCTGCGGGGCTGG - Intronic
1096946746 12:55415028-55415050 CCCTCCCGCCGCTCCGGGTGCGG + Intergenic
1097929698 12:65170052-65170074 TCCTCCCGCCGCCGCCGGCCTGG - Exonic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1101493870 12:105235853-105235875 CACTCCCGCGGCTGCCCGGCCGG + Intronic
1101641183 12:106586663-106586685 CCCTCCCACCGATGCGGCCCGGG - Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103928873 12:124438475-124438497 CCCTCCCCCCGCAGCAGGACTGG - Intronic
1104015621 12:124959931-124959953 CCCTCCCCCTGCTCCAGGGCAGG - Intronic
1104386273 12:128354274-128354296 CCCTCCCTCCACTGAGTGGCCGG - Intronic
1104736698 12:131139608-131139630 CCCTCCTGGTGCTGCGGGACCGG - Exonic
1105239949 13:18599730-18599752 CCCTCTGGCTGCTGGGGGGCCGG + Intergenic
1105801204 13:23904129-23904151 CCCTCTCGCCCGTGCGGGGTAGG + Intergenic
1106517014 13:30464933-30464955 CCCTCCCCCCGCCGCGGTGGGGG + Intronic
1106645168 13:31626123-31626145 CCCACCCTCCTCTGCAGGGCTGG - Intergenic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110790581 13:79582387-79582409 ACCTCCCTCCGCTGGGGGGTGGG + Intergenic
1112290791 13:98143042-98143064 GCCTCCCCCCGCCGAGGGGCCGG + Intronic
1113654015 13:112057060-112057082 CCCGCCCGGGGCTGCGGAGCTGG + Intergenic
1113910304 13:113838473-113838495 CCCTCCTCCTGCTCCGGGGCTGG - Intronic
1113910367 13:113838635-113838657 CCTTCCTCCTGCTGCGGGGCTGG - Intronic
1114031414 14:18583838-18583860 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
1118206370 14:63727628-63727650 CCCGCGCGCCGCGGCGAGGCCGG + Exonic
1119520150 14:75279133-75279155 GCTTCCCGTCGCCGCGGGGCCGG + Intronic
1121277209 14:92676585-92676607 CCCTCCCCCAGCTGCAGGGCGGG - Exonic
1122081882 14:99272483-99272505 CCCTCCCGCTGTTGCGCAGCCGG - Intergenic
1122992093 14:105241264-105241286 CCCTCGGGCCTCTGCGGAGCAGG - Exonic
1124426846 15:29570207-29570229 CCCTCCGGCCGCTGCGGGCTCGG + Intronic
1124696908 15:31870858-31870880 CGCCCCCGCCCCTCCGGGGCCGG + Intergenic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1128236432 15:66070685-66070707 CCTCCCCGCTGCTGCGGGGTGGG - Intronic
1130706671 15:86239466-86239488 CACTCCTGCAGCTGCAGGGCAGG + Intronic
1131107544 15:89745131-89745153 CCCTGCTGCCTCTGCTGGGCCGG - Intergenic
1132111573 15:99105585-99105607 CCCTCGAGGCGCTGCTGGGCCGG + Exonic
1132514162 16:358522-358544 CCACTCAGCCGCTGCGGGGCAGG + Intergenic
1132602884 16:781780-781802 CCGTCCTGCTGCTGCTGGGCAGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133032350 16:3017519-3017541 CCCTCCGACCGCTGCCGGCCGGG - Intronic
1133057005 16:3150372-3150394 GCCTCCCGCCGCTTTGGGTCAGG - Intergenic
1134644969 16:15858362-15858384 CGCTCCCGCCGCTCCCGGGGAGG - Intergenic
1136318363 16:29466895-29466917 CCCTCCAACCGCGGCGGGGTTGG - Exonic
1136421663 16:30138126-30138148 CCCTCCTGCCACTGCAGCGCAGG - Intergenic
1136432938 16:30206244-30206266 CCCTCCAACCGCGGCGGGGTTGG - Exonic
1136546534 16:30958019-30958041 CGCCGCCACCGCTGCGGGGCCGG + Intronic
1138619141 16:58197885-58197907 CCCGCCCGCCCCCGCGGGCCCGG - Exonic
1138619165 16:58197940-58197962 CCCGCCGGCCGCTCCAGGGCCGG - Intergenic
1141693389 16:85608709-85608731 CCCTCCCGGCCCTGCAAGGCAGG - Intergenic
1141750949 16:85957477-85957499 CCCACCCACCGCTGCTTGGCTGG + Intergenic
1141953682 16:87355743-87355765 TCCTCCCCACGCTGCCGGGCTGG - Intronic
1142163324 16:88570597-88570619 TCCTCCCGCCGCCGCCGGCCCGG - Intronic
1142377147 16:89712007-89712029 CCCTGGGGCCGCTGCGGGGAGGG - Intronic
1142413150 16:89926242-89926264 CCTCCTCGCGGCTGCGGGGCGGG + Intronic
1142474379 17:180779-180801 CCCTCCCGGAGCTCCGGCGCGGG - Intronic
1143121079 17:4607294-4607316 CCCTGTCGCGGCTGTGGGGCTGG + Intronic
1144338977 17:14297500-14297522 CTGTCCCGCAGCTGCGAGGCCGG + Intergenic
1145747890 17:27333293-27333315 CCCTTCTCCAGCTGCGGGGCGGG - Intergenic
1145991118 17:29080075-29080097 TCTTCCGGCCGCTGCGGGACCGG + Intronic
1146001288 17:29132072-29132094 CCCTCCCTCGGCTGCGTGGTTGG - Intronic
1146053126 17:29567936-29567958 CCAGCGCCCCGCTGCGGGGCGGG + Intronic
1146271374 17:31487969-31487991 GCCTCGCGCCGGGGCGGGGCGGG - Intronic
1147445782 17:40474536-40474558 CCCTCCCACCCCTGCCGGGCTGG + Intergenic
1148348722 17:46923077-46923099 CCCTCCCTCCCCTGCCGGCCAGG - Intergenic
1150390510 17:64787412-64787434 ACCTCCCGCCTGGGCGGGGCAGG + Intergenic
1150621657 17:66812312-66812334 CCCTGCTGCCTCTGTGGGGCCGG - Intergenic
1151724234 17:75875340-75875362 CCCTCCCAGGGCTGCTGGGCTGG - Intronic
1152427314 17:80225360-80225382 TCCTCCCGCAGCAGCGGAGCTGG + Intronic
1152640101 17:81445726-81445748 CCCTCCCACCCCTGCCCGGCAGG + Intronic
1152656026 17:81519577-81519599 CCCTCCTGGCGCTCCTGGGCAGG - Intronic
1152703847 17:81833048-81833070 CCCTCCTGCAGGTGCCGGGCGGG + Intronic
1152727108 17:81952857-81952879 CCCTCCCGTCTCTTCGGGACAGG - Exonic
1152786218 17:82249398-82249420 CCCTCCCAGCGCTCTGGGGCTGG - Intronic
1152867916 17:82735359-82735381 ACCTGCGTCCGCTGCGGGGCAGG + Intergenic
1152952987 18:11786-11808 CCCTCCCGCGGCTCCTGAGCCGG + Intergenic
1152961313 18:82029-82051 CCCTCCCCTCCCTGCAGGGCTGG - Intergenic
1153489284 18:5630600-5630622 TCCTCCCGCAGCTGCGGTGGCGG + Intronic
1153654916 18:7273715-7273737 CTCTCCCGCCACTGCTAGGCTGG - Intergenic
1154448883 18:14459044-14459066 CCCTCTGGCTGCTGGGGGGCCGG - Intergenic
1155654276 18:28176874-28176896 TCCCCGCGCCGCTGCGGGGCCGG - Intronic
1159369917 18:67516728-67516750 CCCTCCCCGGGCTGCGCGGCCGG - Exonic
1159609912 18:70513678-70513700 CCCACCCACCGCTGCACGGCCGG + Intergenic
1160083463 18:75753101-75753123 CACTCCAGCTGCTGCGGGGCAGG + Intergenic
1160779717 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG + Intronic
1161063705 19:2227536-2227558 CCCTGGGGCTGCTGCGGGGCGGG + Intronic
1161270095 19:3385029-3385051 CCCTCCCGCCTCTGCTCAGCAGG + Intronic
1161333708 19:3700071-3700093 ACCTCCCACCGCTCCCGGGCCGG - Intronic
1161538047 19:4831806-4831828 CTTTCCCGGTGCTGCGGGGCAGG - Intergenic
1161779264 19:6280091-6280113 CCCTCCGGCCGCAGCCCGGCAGG - Intergenic
1161808625 19:6459230-6459252 CGATCCCCCTGCTGCGGGGCAGG - Intronic
1161925129 19:7294129-7294151 CCCCCCGGCCGCTGCGGCCCGGG + Intergenic
1161959646 19:7516453-7516475 CCATCCCGCCGCTGGGGCCCGGG + Intronic
1162022578 19:7874423-7874445 CCCGCCCGCGGCCGAGGGGCGGG - Exonic
1162124217 19:8490561-8490583 ACCTCCCGGGGCTGCGGGGCCGG + Intronic
1162820986 19:13223567-13223589 CCCTCCGGCCACTGAGGGGATGG - Intronic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1163548389 19:17952175-17952197 CCCTCCCCGGGCGGCGGGGCGGG + Intronic
1163786410 19:19277159-19277181 ACCTCCCGCGGGTGCAGGGCTGG + Intronic
1165213858 19:34255075-34255097 CCATCCCGGGGCTGCCGGGCGGG + Intronic
1165718667 19:38063419-38063441 CCATCCTGCCGCTGGGGGCCGGG - Intronic
1166042763 19:40213478-40213500 CCATCACTCCGCTGCAGGGCTGG - Intronic
925389139 2:3483657-3483679 CCCTCCCTCCACTGCCGGGGGGG - Intronic
925449534 2:3956969-3956991 CCCTCCAGCTGCTGCAGAGCAGG + Intergenic
927918217 2:26950125-26950147 CCCTCCAGCTGCTGAGGCGCAGG + Exonic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
929791217 2:45024467-45024489 CCCTCCTGCCTCTCCGGAGCTGG + Intergenic
929857786 2:45650925-45650947 CCCGCCCGCCGCTGCGACCCCGG + Intergenic
929961547 2:46500227-46500249 TCCTCCCGCCGCCGCTGGGTCGG + Intronic
935046699 2:99489719-99489741 CGCTCTGGCCGCTGCCGGGCGGG + Intronic
937247272 2:120501819-120501841 CCCTCCCTCCGCTGTGGGCCTGG - Intergenic
938063551 2:128269504-128269526 CCCACCCTCCCCTGCGCGGCAGG + Intronic
938407358 2:131039936-131039958 GGTTCCCGCCGCTGCGGCGCAGG + Intronic
938496786 2:131801958-131801980 CCCTCCCGCGGCTCCGGAGCCGG - Intergenic
946747674 2:222861570-222861592 GCCTCCCGGCGCTGTGGGGCGGG + Intronic
947523367 2:230864864-230864886 CCCTCCCGCGGGGACGGGGCGGG + Intronic
947992306 2:234497160-234497182 CCCGCCCGCCGCCGGGGGTCAGG + Intergenic
948643019 2:239387349-239387371 CAGTCCCGCCGCTGCGTGCCTGG + Intronic
948846456 2:240685085-240685107 CCCTCCCGCTGCGGAAGGGCAGG - Intergenic
948847406 2:240689648-240689670 CCCTCCCGCTGCGGAAGGGCAGG + Intergenic
1169143268 20:3237926-3237948 TCCTCTCGCTGCAGCGGGGCAGG - Exonic
1170557953 20:17530889-17530911 CCGTCCCGGCGGCGCGGGGCTGG - Intronic
1171407022 20:24918345-24918367 CCCCACCGCCGCTGCGGAGCAGG + Intergenic
1173729081 20:45316466-45316488 CCCTCCCCCAGCTGAGCGGCGGG + Exonic
1175166767 20:57049382-57049404 ACCTCCCGCCGCTCGGAGGCAGG - Intergenic
1175399667 20:58693135-58693157 CACCCCCGCCGCCGCCGGGCCGG + Intronic
1175569700 20:60009550-60009572 CCCTCCTCCCTCTGCGGGGCAGG + Intronic
1175926548 20:62474242-62474264 CCCTCGCGCCGGCGCCGGGCCGG - Intronic
1175962099 20:62642437-62642459 CCCTCCCTCTGCGGCGGGGGCGG + Exonic
1176549147 21:8214011-8214033 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176557040 21:8258232-8258254 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176568079 21:8397049-8397071 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176575982 21:8441269-8441291 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1177187989 21:17819190-17819212 CCCTCGCGCTGCTGCGCGCCAGG - Intronic
1178334513 21:31731738-31731760 ACCTCGCGCCGCGGCGGAGCGGG + Exonic
1178948401 21:36966695-36966717 CCTTCCGGCCGGGGCGGGGCCGG - Intronic
1178992371 21:37366685-37366707 CCCGCCCGCCGGCTCGGGGCTGG + Intronic
1179448369 21:41449884-41449906 CCCTCCCTCCTCTGTGGAGCTGG + Intronic
1179908703 21:44436988-44437010 CCCCTGCGCCGCGGCGGGGCTGG - Intronic
1180455527 22:15510895-15510917 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
1180649958 22:17369510-17369532 CCATCCCGCGGCTGCGGCGGCGG - Exonic
1180699654 22:17774383-17774405 CCCTCCAGCCGCGGGGGCGCGGG + Intronic
1181167532 22:20991671-20991693 CCGTAGCGCCGCTGCGGGGGTGG - Exonic
1181966355 22:26658762-26658784 CCCTCCCGCCGCAGCAGGTGGGG - Intergenic
1183486232 22:38089064-38089086 CCCTCCTGCCGCCCCGGGGCGGG + Intronic
1183981753 22:41544534-41544556 CCACCCCGCCGAGGCGGGGCGGG + Intronic
1184892794 22:47389856-47389878 CCCTCCCGGAGCTGCTGGGAGGG - Intergenic
1185219553 22:49622601-49622623 CACTCCCACCTCTGTGGGGCAGG - Intronic
1203254032 22_KI270733v1_random:130327-130349 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203262088 22_KI270733v1_random:175406-175428 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
949414414 3:3799932-3799954 ACCTCCTGCCGCGGCGCGGCCGG - Intronic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
954202100 3:49029499-49029521 CGCCCCCGCCGCAGCGAGGCGGG - Intergenic
954334758 3:49909760-49909782 CCCTCCCCCAGCAGAGGGGCTGG - Intronic
954764002 3:52897665-52897687 CCCACCCGCCCCCGAGGGGCGGG + Intergenic
956479619 3:69660806-69660828 CCCCTCCGCAGCTGCCGGGCCGG - Intergenic
957079476 3:75623910-75623932 CACTCCCCGCGCTGCGGGGAGGG - Intergenic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
964014357 3:151928238-151928260 CCCGCCCGCTGCTCCGGGGGCGG - Intergenic
967786537 3:193503018-193503040 CCCTTCCACCGGGGCGGGGCAGG + Intronic
967809446 3:193744652-193744674 ACCTCCCGTCGCTGTGAGGCTGG + Intergenic
968434088 4:576133-576155 TCCTCCCGGCGCCGCGCGGCCGG + Intergenic
968609075 4:1548994-1549016 CCCTGCTGCGGCTCCGGGGCCGG + Intergenic
970601186 4:17642177-17642199 CCCACCGGGCGCTGCTGGGCAGG - Exonic
972686801 4:41360413-41360435 CCCGCCGGCTGCTGAGGGGCGGG - Intronic
973993635 4:56435704-56435726 CGGTCCCGCGGCTGAGGGGCGGG + Intergenic
978917779 4:114147495-114147517 CCCTCCCCTCCCTGCTGGGCTGG - Intergenic
979278194 4:118836198-118836220 GCCACCGGCCGCCGCGGGGCGGG + Intronic
981093483 4:140756350-140756372 TCCTCCCGCCGCCGTGGGCCGGG - Intergenic
981128563 4:141133185-141133207 CCCTCCAGCCCCGGCGGGGACGG + Intronic
982358096 4:154491063-154491085 CCCTCCTGCTGCTGCGCGGCCGG + Intronic
985525777 5:401002-401024 CCCTCCAGCCCGTGTGGGGCGGG + Intronic
985820369 5:2156052-2156074 CCCTCCAGCGGCTCCAGGGCAGG + Intergenic
987163236 5:15166878-15166900 CCCTCCCCCCGATGCAGGACAGG - Intergenic
991351121 5:65721866-65721888 GCCTCCCGCCGCTCCGGACCGGG - Intronic
993654644 5:90562554-90562576 CCCTCCCCGAGCTGCTGGGCAGG + Intronic
996082262 5:119268954-119268976 CTCTCCCGCCGCTGGGCTGCGGG + Intronic
997950968 5:138242216-138242238 CGCCCGCGCCGGTGCGGGGCTGG + Intergenic
998463409 5:142325381-142325403 CCTTCACGCCACTGCGGGCCTGG + Intronic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
1000120937 5:158197220-158197242 CCAGCCCGCTGCTGCTGGGCAGG + Intergenic
1002368168 5:178729421-178729443 CGTTCACGCCGCTGCGAGGCGGG + Intronic
1002385157 5:178860627-178860649 CGTTCACGCCGCTGCGAGGCGGG - Intronic
1002928805 6:1619880-1619902 GACTCCCGCCGCTTCGGGGGAGG - Intergenic
1002988612 6:2216837-2216859 CCCACCCGCCTCTCCTGGGCAGG + Intronic
1003058261 6:2841911-2841933 CCCGCCCGCGGCTGCTGGCCCGG - Exonic
1003425727 6:5997150-5997172 CCCGCCGCCCGCTGCGGGGAGGG - Intergenic
1004220606 6:13743313-13743335 CCCTCACACCCCGGCGGGGCCGG - Intergenic
1005098761 6:22146794-22146816 CCCTCGCCCAGCTGCGAGGCAGG - Intergenic
1006392168 6:33764865-33764887 CCCTCCCCCCACTGGGTGGCTGG + Intergenic
1006435012 6:34021558-34021580 CCCTCCCAGGGCTGCAGGGCAGG + Intronic
1007739138 6:44000509-44000531 CACTCCCGCCGCGGCAGGCCAGG + Intergenic
1009437724 6:63636471-63636493 CCCCGCCGCCGCTGAGGCGCGGG + Intronic
1012895398 6:104941021-104941043 CACTCGCGCGGCCGCGGGGCCGG - Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1015935642 6:138404223-138404245 CCCTGTCGCCGCGGAGGGGCGGG + Exonic
1016454549 6:144216804-144216826 CACTTCCCCAGCTGCGGGGCGGG + Intergenic
1017731812 6:157323637-157323659 CCCTCCTCCCGCGCCGGGGCCGG + Intergenic
1017941368 6:159056053-159056075 CCCTCCTGATGCTGTGGGGCTGG - Intergenic
1018400261 6:163414429-163414451 CCCTGCCTCCCCGGCGGGGCGGG - Intronic
1019437145 7:1028168-1028190 CCCACCTGTCGCCGCGGGGCGGG + Intronic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019681763 7:2354542-2354564 CCCGTCGGACGCTGCGGGGCGGG - Intronic
1019828111 7:3300887-3300909 CGCCCGCACCGCTGCGGGGCCGG + Intergenic
1020137293 7:5594323-5594345 ACCTCCTCCCGCTGCCGGGCGGG + Intronic
1021600242 7:22357062-22357084 CCCTGACGGCGCTGCGGCGCCGG + Intronic
1023881742 7:44324973-44324995 CCCTCCCGGCGCTCCAGGCCCGG + Intronic
1026017337 7:66681856-66681878 CCCTCCCGCTGCTGCGCATCGGG + Intronic
1027361795 7:77416578-77416600 GCCTCCCGCCCCGGCGGGCCTGG - Intergenic
1029614824 7:101649703-101649725 CCCTCCCGCAGCAGGGAGGCAGG + Intergenic
1030215991 7:107044596-107044618 CCCGCGCACCGCGGCGGGGCGGG + Intergenic
1031604227 7:123749029-123749051 CCCTCCCGCAGCGGCGGCGGCGG + Exonic
1032086180 7:128885019-128885041 CCTCCCTGCCGCTGCTGGGCCGG - Intronic
1032492434 7:132333569-132333591 CCCTCCAGCAGCTGAGGAGCAGG - Intronic
1033597785 7:142868962-142868984 CCCTCCCGCTGCTGAGGGGAAGG - Exonic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1035549070 8:506304-506326 CCCTCCCCCCGCTGCCGAGCTGG - Intronic
1037988054 8:23301982-23302004 CCCTCCTCCCCCTGCAGGGCTGG + Intronic
1040423485 8:47261204-47261226 CCGTACCGCCGCTGAGGGCCCGG - Intronic
1041369458 8:57143461-57143483 GCCCTCCGCCGCAGCGGGGCTGG + Intergenic
1041384060 8:57280036-57280058 CCCTCCTGCAGCTGAAGGGCCGG - Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1045096216 8:98800728-98800750 CCCTTCCGCAGCTGCTGGCCCGG - Intronic
1045509953 8:102806521-102806543 CCCTCCCGCGGCTGCCAGACCGG + Intergenic
1045638661 8:104223266-104223288 CCCTCCGGCCGCTGATTGGCGGG + Intronic
1045673921 8:104588418-104588440 CGCCCCCGCCGCTGCCGGGACGG - Intronic
1047262581 8:123275196-123275218 CGCTGGCCCCGCTGCGGGGCTGG - Intronic
1048214342 8:132481138-132481160 GCCTCCCGCCGCGACGGGGCGGG - Intergenic
1049353767 8:142177734-142177756 CCCTCCCTTCGCTGTGGGGTCGG + Intergenic
1049608456 8:143541032-143541054 CCCGCGCCCCACTGCGGGGCTGG - Intronic
1049621162 8:143598874-143598896 GCCGCCCGCTGCTGCGGGGCTGG + Exonic
1049689904 8:143953842-143953864 TCCTCCCCCGGCTGCGGCGCTGG - Intronic
1049696999 8:143989153-143989175 CCCTCCCGCCCTTGGAGGGCCGG - Intronic
1049769851 8:144374712-144374734 CCCGCCCGCCGCCTCAGGGCAGG - Intronic
1049847119 8:144808245-144808267 GCCTCTCGCCGCTGTGGAGCCGG - Exonic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1051170635 9:14315527-14315549 CGCGCCCGGGGCTGCGGGGCGGG + Intronic
1051665361 9:19463426-19463448 CCCTCCCTCCGAGGCGGGGAGGG + Intergenic
1052991792 9:34522944-34522966 CGCTCCCGCCGCGGCGCGACCGG + Exonic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1055739982 9:79377487-79377509 CCCTCCCCCAGCTGCAGGGCAGG + Intergenic
1057186927 9:93062258-93062280 CCCTCCCACGGCTCAGGGGCAGG - Intronic
1057744632 9:97741406-97741428 CCCGCCCGCCTCTGCCGGGCAGG + Intergenic
1059061460 9:111038400-111038422 CCCGCGCTCCGCAGCGGGGCTGG + Intronic
1060200941 9:121651564-121651586 CCCAGCCCCCGCCGCGGGGCCGG + Intronic
1060550973 9:124485310-124485332 CGCCCCCGCAGCTGCAGGGCTGG - Intronic
1060555377 9:124504981-124505003 CCAACCCGCCGCGCCGGGGCCGG + Intronic
1060849249 9:126860840-126860862 CCCTCTGGGCGCGGCGGGGCGGG + Intronic
1061203321 9:129149396-129149418 CCCTCCTGTCCCTGCTGGGCTGG + Intergenic
1061501944 9:131009113-131009135 CCCGCCTTCCCCTGCGGGGCGGG - Exonic
1061674538 9:132208345-132208367 TCCTCCCGGGGCTGCAGGGCTGG - Intronic
1061816831 9:133202358-133202380 ACTTCCCGCTGCTGCAGGGCAGG - Intergenic
1061839033 9:133347186-133347208 CCCTCCAGTCTCTGCGCGGCAGG + Exonic
1062052795 9:134456192-134456214 CCTTCCGGCCGCTGCGGCCCTGG - Intergenic
1062320924 9:135990247-135990269 CCCGCCCCCCGCTGTGGGCCTGG + Intergenic
1062401051 9:136372803-136372825 CCCTCCCAGGGTTGCGGGGCCGG - Intronic
1062414117 9:136439361-136439383 CCTTCCGGCGGCTGCGGGGCCGG + Exonic
1062696989 9:137880582-137880604 CCCTCCCACACCTGCGAGGCAGG - Intronic
1062736845 9:138142107-138142129 CCCTCCCCTCCCTGCTGGGCTGG + Intergenic
1203470433 Un_GL000220v1:113471-113493 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203478254 Un_GL000220v1:157443-157465 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1186274732 X:7927195-7927217 CCCTCCCGCGGCTTGGAGGCCGG + Intronic
1186512802 X:10143158-10143180 CCTTCCCAGCGCTGCTGGGCAGG + Exonic
1189988427 X:46573822-46573844 TCCTCCCGGCGCAGAGGGGCCGG + Exonic
1190542950 X:51496791-51496813 CCCTCCCTCCGCCGCCGGGTAGG + Intergenic
1192584144 X:72306731-72306753 CCCGCCCGCAGCTTCGGCGCCGG + Intronic
1193468991 X:81876565-81876587 GCCTACTGCCGCTGCGGGACAGG - Intergenic
1198005622 X:132489819-132489841 TCCGCGCGCCGCTGCGGGACGGG + Intronic
1198404685 X:136300521-136300543 CCCTGCCACTGCTGCTGGGCTGG + Intergenic
1199996770 X:153030790-153030812 CCCTGCCGTCTCTGGGGGGCTGG + Intergenic
1200107807 X:153724500-153724522 CCGGCCCTCCGCTCCGGGGCGGG - Intronic
1200216871 X:154371847-154371869 CCTTCCCGCCGCTGCCGGGCCGG - Intronic
1200218284 X:154378469-154378491 CCTTCCCGCCGCTGCTGGGGCGG + Intergenic
1200224759 X:154411447-154411469 ACTTCCCGCCGCCCCGGGGCTGG + Intronic