ID: 1101343300

View in Genome Browser
Species Human (GRCh38)
Location 12:103862052-103862074
Sequence GGAAATGGATGAACAGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101343296_1101343300 6 Left 1101343296 12:103862023-103862045 CCATCAGCATTTCTTAACTAAAT No data
Right 1101343300 12:103862052-103862074 GGAAATGGATGAACAGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101343300 Original CRISPR GGAAATGGATGAACAGGTAT AGG Intergenic
No off target data available for this crispr