ID: 1101345778

View in Genome Browser
Species Human (GRCh38)
Location 12:103884976-103884998
Sequence ATGTGTATAAAGATGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101345778_1101345781 4 Left 1101345778 12:103884976-103884998 CCCAGCATCATCTTTATACACAT No data
Right 1101345781 12:103885003-103885025 GCACTCAATGATAGACTAAATGG No data
1101345778_1101345783 30 Left 1101345778 12:103884976-103884998 CCCAGCATCATCTTTATACACAT No data
Right 1101345783 12:103885029-103885051 ATGTTTATGTAGTGCTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101345778 Original CRISPR ATGTGTATAAAGATGATGCT GGG (reversed) Intergenic
No off target data available for this crispr