ID: 1101348827

View in Genome Browser
Species Human (GRCh38)
Location 12:103909025-103909047
Sequence TAGGCCATCTGGTAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101348827_1101348836 18 Left 1101348827 12:103909025-103909047 CCCTCACCCTACCAGATGGCCTA No data
Right 1101348836 12:103909066-103909088 TTTTCCTCCACAGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101348827 Original CRISPR TAGGCCATCTGGTAGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr