ID: 1101349433

View in Genome Browser
Species Human (GRCh38)
Location 12:103915083-103915105
Sequence TTTTCAATCATTAAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101349430_1101349433 26 Left 1101349430 12:103915034-103915056 CCTTTATGTTGATAATGGACTTA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1101349433 12:103915083-103915105 TTTTCAATCATTAAAGTGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101349433 Original CRISPR TTTTCAATCATTAAAGTGGC TGG Intergenic
902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG + Intronic
906032645 1:42733648-42733670 TTCTCATTCATTAGAGGGGCAGG + Exonic
906932979 1:50187797-50187819 TTTTCAACAATTAATGAGGCTGG + Intronic
907210589 1:52818174-52818196 TTTTCAAAAATTATAGGGGCCGG + Intronic
907966835 1:59339899-59339921 TTTTCAATCTTTAAAGACCCTGG + Intronic
908263054 1:62353543-62353565 TTTTCAAGCAGGAAAGTGGAAGG + Intergenic
908689409 1:66761044-66761066 TTTTCAAAAATGAAAGAGGCAGG - Intronic
909436816 1:75651742-75651764 TTTATAATCAGTAATGTGGCTGG - Intergenic
912162593 1:107004048-107004070 TGTAAAATCATTAAAGAGGCTGG + Intergenic
912398896 1:109372077-109372099 TTTTCTCCCATTGAAGTGGCAGG - Intronic
913295703 1:117317728-117317750 TTTTAAATGGTTAAAATGGCTGG + Intergenic
913720818 1:121592540-121592562 TATTCAGTCTTTAAAGTGGAGGG + Intergenic
914666462 1:149836987-149837009 TTTTTAAGCATGAAAGTGACAGG + Intergenic
914669305 1:149856811-149856833 TTTTTAAGCATGAAAGTGACAGG - Intronic
915627934 1:157127426-157127448 CTTTCAAACATTAAGGAGGCTGG + Intronic
918189661 1:182162004-182162026 TTTTCAGTCATAAAAGAGTCAGG + Intergenic
918394737 1:184102012-184102034 ATTTCAAGAATCAAAGTGGCTGG + Intergenic
920549125 1:206843710-206843732 TTTTAAATGATTATAGAGGCAGG - Intergenic
1063183825 10:3632264-3632286 TGTGCATTTATTAAAGTGGCGGG + Intergenic
1063306638 10:4908894-4908916 ATTTCAAATATTAAAGAGGCAGG + Intergenic
1066453446 10:35551771-35551793 TTTTAAATCATTAAAATGATTGG - Intronic
1068960120 10:62859121-62859143 TTTACAATCCTTGGAGTGGCTGG + Intronic
1069202511 10:65638966-65638988 TTTTAAATAAATAAAATGGCTGG + Intergenic
1069314025 10:67075459-67075481 TTTTCCATCTTAATAGTGGCAGG - Intronic
1070212539 10:74340815-74340837 TTTTGAAAGATTAAAATGGCTGG + Intronic
1072891057 10:99325128-99325150 TTGTTAATCATCAAAGTGCCAGG - Intergenic
1073320528 10:102613607-102613629 TTATTTATCATTCAAGTGGCAGG - Intronic
1073343735 10:102766126-102766148 TTTTTAATCTTTATAGAGGCAGG - Intronic
1073595599 10:104796752-104796774 TTTTGTATCATTCAAGAGGCAGG + Intronic
1080342742 11:31286097-31286119 TTCTCAAACTTTAGAGTGGCTGG + Intronic
1080981990 11:37418894-37418916 TTTTTAACCATTTAAGAGGCAGG + Intergenic
1081417523 11:42833777-42833799 TTTTCAAGAATGAAATTGGCTGG - Intergenic
1083086302 11:60150264-60150286 TTTTCAATCATAAATGTGTGTGG + Intergenic
1084807510 11:71589181-71589203 TTTTCAACCCTTCAAGTGCCTGG + Intronic
1085357403 11:75851247-75851269 TTTCAAATCATTAAAGAGTCTGG + Intronic
1086342797 11:85864224-85864246 TTTGTAATTATTTAAGTGGCTGG - Intronic
1086722901 11:90144187-90144209 TCTTCATTCATTAAAGTTGGGGG - Intronic
1087477310 11:98652257-98652279 TTTTCTAGGATTAAAGTGGAAGG + Intergenic
1090544682 11:127751032-127751054 TTTTCCATTTTTAAGGTGGCAGG + Intergenic
1091296092 11:134474944-134474966 TTGTCAATCAGTGAAGGGGCTGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095649808 12:44594054-44594076 TTCTCACTCATTTATGTGGCGGG + Intronic
1097009366 12:55941289-55941311 TTGTCAATCCTAAGAGTGGCGGG + Exonic
1097198358 12:57257290-57257312 TTTTCCCTCATTAATGTTGCTGG + Intronic
1098075912 12:66730872-66730894 GTTTCAGGCATTAAAGTGACAGG - Intronic
1099321814 12:81160569-81160591 TTTTTAATCATTAAAATGAGAGG + Intronic
1099321838 12:81161107-81161129 TATTCAAGCATTTAAGTGACTGG - Intronic
1100414786 12:94360406-94360428 TTTTAATTCATTAAAGTTTCAGG + Intronic
1101349433 12:103915083-103915105 TTTTCAATCATTAAAGTGGCTGG + Intergenic
1102525200 12:113507642-113507664 TTTTCTATCTGTAAAGTGGGAGG + Intergenic
1103353022 12:120298610-120298632 TTTTAAATAATTAAAGTGGCAGG + Intergenic
1104099571 12:125593703-125593725 TTTTCAAGCATCAAAGCTGCAGG - Intronic
1105561149 13:21492043-21492065 ATTTCAATCATTAAACTGTGAGG + Intergenic
1106110729 13:26774292-26774314 TTTTCCATCATTAATGTCCCAGG - Intergenic
1107711954 13:43159281-43159303 TTTTCATTCTTTAGAGTGGGAGG + Intergenic
1108437447 13:50414627-50414649 TATACAATCATTTATGTGGCAGG + Intronic
1109013002 13:56974548-56974570 TTCTCAATCATTAAACTGGTTGG + Intergenic
1109406773 13:61910608-61910630 TTTTCAATCAGATAAGTGACTGG - Intergenic
1110875115 13:80500056-80500078 TTTTCAATCACTCAAATGTCAGG - Intergenic
1110889926 13:80686440-80686462 TTTTCAAGAATTATAGTGGATGG + Intergenic
1112746448 13:102532658-102532680 TTCTCAATAATTACAATGGCAGG - Intergenic
1112770454 13:102789532-102789554 TTTGCAATCAATAAAGTAGCAGG - Intronic
1113943630 13:114031955-114031977 TTTTTAATCATTTAGGTGGGTGG - Intronic
1114047428 14:18888388-18888410 CTGTCAGTCATTAAAGTGCCTGG - Intergenic
1114116786 14:19631013-19631035 CTGTCAGTCATTAAAGTGCCTGG + Intergenic
1114737727 14:25059806-25059828 TTTTCAAGCAGAAGAGTGGCAGG + Intergenic
1115614513 14:35081328-35081350 TTTTAAATTATTAAAGTATCTGG + Exonic
1117221328 14:53609570-53609592 TTTTTTATCATTCAAGTTGCTGG - Intergenic
1118337811 14:64868999-64869021 TTTCAAATCATTAAAGATGCAGG + Intronic
1118506253 14:66415359-66415381 TTTTGAATCATGAAAGTGGTTGG - Intergenic
1118531801 14:66714673-66714695 GTTTTAATCATAAAAGTTGCTGG + Intronic
1119477022 14:74936369-74936391 TTTTTAAACAATAACGTGGCCGG - Intergenic
1121229844 14:92349138-92349160 TCTTCAATAATAAAAGTGACTGG + Intronic
1121660200 14:95629372-95629394 TTTTCAATCAGGACATTGGCAGG - Intergenic
1124721699 15:32116306-32116328 TTTCCATGCTTTAAAGTGGCTGG + Intronic
1126323581 15:47450656-47450678 GTTTCAATTATAAAAGTGGAAGG + Intronic
1126646742 15:50882458-50882480 TTTTCAACCTTTTCAGTGGCAGG + Intergenic
1129162584 15:73754839-73754861 TTTTCAAAAGTTTAAGTGGCGGG + Intergenic
1129819627 15:78589530-78589552 TTTTCAATCATTAGAATCTCAGG + Intronic
1130360561 15:83180930-83180952 TTTTCAAATATTAAATTGCCGGG - Intronic
1132085603 15:98906054-98906076 TTTACAATCATTGAAGAGGCTGG - Intronic
1132315473 15:100887152-100887174 TTTTCAATCACTTGAATGGCTGG - Intronic
1132348726 15:101123991-101124013 TTTTCAAAAATTTAAGTGGCAGG - Intergenic
1133603716 16:7365643-7365665 TTTGCAAACATTAAGATGGCAGG + Intronic
1133677591 16:8089605-8089627 TTTTCACTCTTTTAAGTGGTAGG + Intergenic
1134144414 16:11748751-11748773 TTTTTAATCATTAAACAGGCTGG + Intergenic
1135141170 16:19923375-19923397 TTTTCGATCCCTAAAGAGGCAGG + Intergenic
1136662879 16:31780610-31780632 CTTTTAGTCATTCAAGTGGCTGG - Intronic
1137909682 16:52364046-52364068 TTTTTGTTCATTAAAGAGGCAGG + Intergenic
1138396678 16:56709850-56709872 TTGTAAATGATTAAAGCGGCAGG - Intronic
1138704510 16:58900864-58900886 TTTTCAATATTTAAAGTGTATGG - Intergenic
1140092134 16:71846974-71846996 TTTTCAGTTATTAAAGCTGCTGG + Intronic
1141419165 16:83900643-83900665 TTTTCGTTCATTAAAAGGGCAGG - Intronic
1143036206 17:4000625-4000647 TTTTAAAACAGTAAATTGGCCGG + Intergenic
1143427184 17:6849293-6849315 GTTTCAAGCATAAAAGTGGGTGG - Intergenic
1144602156 17:16626245-16626267 TTTAAAATCATAAAATTGGCTGG - Intronic
1147200948 17:38800566-38800588 GTTTCAAGCATTACAGTGCCTGG + Exonic
1150200304 17:63349286-63349308 TATTCATTCATTAAAATGTCTGG + Intronic
1151568696 17:74915320-74915342 TTTTCCATCTGTAAAGTGGAGGG + Intergenic
1153856299 18:9150947-9150969 TTTTTAATCACAAAATTGGCTGG - Intronic
1155672978 18:28394791-28394813 TTTTCAATAATTGAAGTGTTTGG + Intergenic
1156015365 18:32541154-32541176 TTAGCAATCATAAAAGTGACAGG + Intergenic
1156098486 18:33564985-33565007 TTTTCAAAGATTAAAGTAACAGG + Intergenic
1156719535 18:40052867-40052889 TTTTAAAACATCAAACTGGCTGG - Intergenic
1157672550 18:49542490-49542512 TTTTGCATCATTGAACTGGCTGG + Intergenic
1158647786 18:59263360-59263382 TTTCCAATCCTAACAGTGGCTGG - Intergenic
1158660946 18:59386965-59386987 TTTCCAATGATTAAAGTAGTGGG + Intergenic
1163470856 19:17496282-17496304 TTCTCCATCTGTAAAGTGGCGGG + Intronic
1164376078 19:27689605-27689627 TTCTCTATCATTAGAGTGCCTGG + Intergenic
1164383316 19:27753422-27753444 TTCTCTATCATTAGAATGGCTGG + Intergenic
1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG + Intergenic
1166379177 19:42346194-42346216 TTTAAAATCAATAAAGAGGCCGG - Intronic
1168226068 19:54996202-54996224 GTTTCAAAAAATAAAGTGGCAGG + Intronic
927341281 2:21985975-21985997 TTTTCAAGCAGAAATGTGGCTGG - Intergenic
927816544 2:26222490-26222512 ATTTCAATGATCAAAGTGGATGG + Intronic
928014869 2:27646478-27646500 TTTTAATTCAGTAAAGTAGCAGG - Intronic
934973379 2:98781675-98781697 TTTTAAAAAATTAAAGTGGGGGG + Intergenic
935514027 2:104012090-104012112 TTTTCAATAGATACAGTGGCTGG - Intergenic
935547327 2:104414872-104414894 TTGTGAATAATTAAAGTCGCAGG - Intergenic
936712681 2:115150500-115150522 TTTTCAATAATTATAATGGGTGG - Intronic
937379596 2:121364613-121364635 ATTTTAATCAGTCAAGTGGCAGG - Intronic
937555821 2:123154138-123154160 TTTTAAAACTTTTAAGTGGCAGG - Intergenic
939901372 2:147854435-147854457 TTTTCAAAGCTTAAAGTAGCTGG - Intronic
940574708 2:155487475-155487497 TTTTCAATCAGTAAAATGAGAGG + Intergenic
943800751 2:192054800-192054822 TTTTAAAGTGTTAAAGTGGCAGG - Intronic
943919449 2:193684697-193684719 TTTTCAATCTCTAAATTTGCAGG + Intergenic
945454839 2:210038473-210038495 TTTAAAATCATTAATGTTGCAGG + Intronic
946210063 2:218140287-218140309 TTTTTAATCATTAAAATGAAGGG + Intergenic
947282399 2:228469903-228469925 ATTTGAATCATTCAAGTTGCTGG - Intergenic
1170748150 20:19119118-19119140 TTTTCAATCATTAAAAAGTCAGG - Intergenic
1172589525 20:36107531-36107553 TTTTAAATCATAAAGGCGGCTGG + Intronic
1172926679 20:38543517-38543539 TTTTCAATCATTCAAGCAGCAGG - Intronic
1173450509 20:43159437-43159459 TTTTCCATCTATAAAATGGCAGG + Intronic
1174993447 20:55539481-55539503 GTTCCAAACATTAAAGGGGCAGG - Intergenic
1179172426 21:38982909-38982931 TTTAAAATTATTAAAGTTGCCGG - Intergenic
1180465961 22:15611043-15611065 CTGTCAGTCATTAAAGTGCCTGG - Intergenic
1183969292 22:41464308-41464330 TTATCAATTATGAAAGTTGCAGG + Intronic
1184489781 22:44801834-44801856 TTTTCTATCTGTAAAGTGGGGGG + Intronic
949113013 3:285972-285994 TGTTCAATCTTGAAAGTGACAGG - Intronic
950987215 3:17386868-17386890 TTTTTAATCTTGAAAGTGGTTGG - Intronic
951310868 3:21124899-21124921 GTTTCAAGCATAAAACTGGCCGG + Intergenic
952094529 3:29933360-29933382 TTTTAAATAAGCAAAGTGGCTGG + Intronic
953101715 3:39836261-39836283 TTGTCAATCATTAAAAAGTCAGG - Intronic
953194429 3:40718934-40718956 TTTTCAATTATGAAACTGACAGG - Intergenic
953775186 3:45810740-45810762 TTTTAAACCATTAAAGAGGTAGG - Intergenic
957380291 3:79419203-79419225 TTTCCATTTATTACAGTGGCTGG - Intronic
957647720 3:82954498-82954520 TTTTCGATCATTAAAAAGTCAGG - Intergenic
959931607 3:111989470-111989492 TTTTCATTCAATTCAGTGGCAGG + Intronic
960299828 3:115988749-115988771 CTTTCAATTATCAACGTGGCTGG + Intronic
962051100 3:131816543-131816565 GTTTCAATCCTAAAAGTGGTGGG - Intronic
963094954 3:141526293-141526315 TGTTTAATCACTAAACTGGCAGG - Intronic
963198255 3:142558161-142558183 TTTTCAATAATTAAAAGAGCAGG - Intronic
963198969 3:142567414-142567436 TTTTCAATCAGTAAAATGATGGG - Intronic
963646376 3:147919474-147919496 TGTGCAATAATTAAAATGGCTGG + Intergenic
964315744 3:155442695-155442717 GGTTCAATCATTTAACTGGCCGG + Intronic
964968113 3:162524009-162524031 TTCTCAATGATTAAAGTGACAGG + Intergenic
965543101 3:169889912-169889934 TTTTTAATCTTAAAAGTTGCTGG + Intergenic
966707273 3:182930333-182930355 TATTCAATCATAAAAGTGAAGGG + Intergenic
966779489 3:183571632-183571654 ATTTAAAACATAAAAGTGGCTGG - Intergenic
968222034 3:196946858-196946880 ATTTCAAACATCACAGTGGCTGG + Exonic
968322011 3:197778014-197778036 ATTTCAATCATTAAGATGGCTGG - Intronic
968672975 4:1862365-1862387 TTTTTAATTATGAAAATGGCAGG - Intergenic
970292918 4:14595987-14596009 TTATCAAACATCAAAGTGTCAGG - Intergenic
971309341 4:25511622-25511644 TTTTAAAATAATAAAGTGGCCGG - Intergenic
971622020 4:28867422-28867444 TTTTTAATCATTACATTTGCTGG - Intergenic
971682470 4:29718156-29718178 TTTTCAAACATTAATGTGACTGG + Intergenic
972585371 4:40432793-40432815 TCTTCAATCATTTTAGGGGCTGG + Exonic
975985590 4:80198821-80198843 TTTTATATAATTAAAGTAGCAGG - Intronic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
978671454 4:111252004-111252026 TTTTCAATGATTATAGTGTCTGG + Intergenic
979921961 4:126508745-126508767 TTTTAAATCATAAAAGTCCCTGG + Intergenic
980694127 4:136334105-136334127 TTTTCTATCAATATAGTTGCAGG - Intergenic
981879017 4:149586050-149586072 TTTTTTATCATTGAAATGGCTGG + Intergenic
982610413 4:157567372-157567394 TTTTCAAACACTAATGTGCCAGG - Intergenic
983349167 4:166565263-166565285 TTTTCAAACACTAAAGTAACTGG - Intergenic
984079653 4:175231064-175231086 ATTTCAATCATTAAATTAGATGG + Intergenic
985033135 4:185812204-185812226 TTTTCCATAAGTAAAATGGCTGG + Intronic
986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG + Intergenic
989213272 5:38878708-38878730 ATTTCATTTATTGAAGTGGCAGG - Intronic
989486968 5:42001989-42002011 TTTTAAAAAATTAAGGTGGCTGG - Intergenic
992691106 5:79240603-79240625 TTTTCAAATATTGAAGTTGCCGG - Intronic
993566273 5:89479527-89479549 TTTTCCAACATTAAATTGGTGGG - Intergenic
993600302 5:89914934-89914956 TGTGCAATGTTTAAAGTGGCAGG - Intergenic
993776630 5:92007766-92007788 TTTTCAATCAATAGTGTGGTAGG - Intergenic
993954047 5:94210918-94210940 TTTAAAATAATTAAAGTGTCAGG - Intronic
994237153 5:97376101-97376123 TTGTAAATGATTAGAGTGGCAGG + Intergenic
994594176 5:101809404-101809426 TTTTAAATATTTAAAGTGTCAGG - Intergenic
995490671 5:112688430-112688452 TTTCCTTTCATTCAAGTGGCAGG - Intergenic
997098319 5:130939045-130939067 TTTGCCATCAATAGAGTGGCTGG + Intergenic
998722430 5:144968973-144968995 TTTTAAATCAGTAAAGTTGCAGG + Intergenic
999217561 5:149947914-149947936 TTTGCAATCATTAAAATGAATGG - Intergenic
1000879895 5:166685100-166685122 TTTTTAATCTTTAATATGGCCGG - Intergenic
1002319618 5:178367260-178367282 TTTTCTATCATTAAGCTGACGGG + Intronic
1003777515 6:9385387-9385409 TTTTCATTCATTCATGTGGCTGG + Intergenic
1004729199 6:18341233-18341255 TTGTCATTCCTTAAAGTGGGTGG + Intergenic
1008332207 6:50259111-50259133 TCTTCAATCTTTAAAGTTGCTGG + Intergenic
1008795173 6:55294262-55294284 TTTTAAAACATTAAAATGACAGG - Intergenic
1009473594 6:64059430-64059452 TTTTTAAACATCAAACTGGCTGG + Intronic
1011228650 6:85135508-85135530 TTCTCAATCATAAAAGATGCAGG - Intergenic
1012901243 6:105009092-105009114 TTCTCAATCATTAAAATCCCTGG - Intronic
1013423031 6:109983367-109983389 TTTTCAATGATTATGGAGGCTGG - Intergenic
1014095069 6:117450954-117450976 TTTTTAATCATGTAAGTGGCTGG - Intronic
1014282045 6:119452580-119452602 TTTTGAATAATTAAAGTGAGGGG + Intergenic
1015443631 6:133277427-133277449 TTTTAAAGCATTTAAGTGACAGG - Intronic
1015911701 6:138174980-138175002 TTTTGAATGATTTAAGTGACTGG + Intronic
1018359291 6:163050425-163050447 TTTTAAATCATCAATATGGCGGG - Intronic
1020741974 7:12031620-12031642 TATTTAATCATTAAAGTGAAGGG + Intergenic
1026283460 7:68942616-68942638 TTTGCAATCATAAATGTGGACGG + Intergenic
1026882094 7:73913462-73913484 TTTTTAATCATAAAAGGAGCTGG + Intergenic
1028950877 7:96633063-96633085 TTTTCAATAATAAAATTGCCTGG + Intronic
1028995554 7:97095984-97096006 TTTAAAATCATTAAACAGGCCGG - Intergenic
1029437334 7:100570524-100570546 AGTTCAAACATTAAAGGGGCAGG + Intergenic
1029952810 7:104604536-104604558 TTTTCAATCTTTACATAGGCAGG + Intronic
1030929138 7:115500526-115500548 TTGTCAATTATTAAAGTTGAAGG - Intergenic
1031020911 7:116626521-116626543 TTTGCATTCAGTAATGTGGCAGG + Intergenic
1031479353 7:122259187-122259209 CTTTCAAGCATTGGAGTGGCAGG - Intergenic
1032208100 7:129886979-129887001 GATTCAATCATTAACGTTGCTGG - Intronic
1034069353 7:148168034-148168056 TTCTCAATCATTAAAAAGTCAGG + Intronic
1036055671 8:5251229-5251251 GATTCAATCATTAAAGTGCATGG + Intergenic
1036481725 8:9146038-9146060 TTTTCAATTTTTATAGAGGCAGG + Intronic
1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG + Intronic
1038944931 8:32348412-32348434 TCTACAAACATTTAAGTGGCAGG + Intronic
1040474057 8:47761556-47761578 ATTTAAATCATTTTAGTGGCTGG - Intergenic
1040884947 8:52251511-52251533 TTTTAAATCATTGAAGTGATTGG + Intronic
1041331536 8:56731456-56731478 TTTTGAATCATTTAAAAGGCAGG - Intergenic
1042463522 8:69099312-69099334 TTTTAAATCATTATGGTGACTGG - Intergenic
1042655130 8:71087554-71087576 TTTTCAGTCATTGAAGTAGCTGG - Intergenic
1042738151 8:72012025-72012047 TTTAAAATCAATCAAGTGGCCGG - Intronic
1044091212 8:88004055-88004077 TTTTCATTCATAAAATTAGCTGG + Intergenic
1044277176 8:90315181-90315203 TCTTCCATGATTAAAGAGGCAGG + Intergenic
1047033572 8:120910786-120910808 TTTTCAATCATGAAAGGGAACGG + Intergenic
1050294738 9:4194358-4194380 TTTTAAAAAAATAAAGTGGCAGG - Intronic
1050368728 9:4898964-4898986 TCTTCTTTCATTAATGTGGCTGG + Intergenic
1051522041 9:18000273-18000295 TTTTTAATCATTAAAAAGTCAGG - Intergenic
1052479608 9:29007110-29007132 TTTTAAAATAATAAAGTGGCTGG - Intergenic
1053317975 9:37068792-37068814 TTTTAAATGATTAATGGGGCAGG + Intergenic
1055153573 9:73033698-73033720 TTTTTACTCAGCAAAGTGGCAGG + Intronic
1056023843 9:82470411-82470433 TTTTTAAACATTAAAGTGTAAGG + Intergenic
1059205584 9:112461373-112461395 TTAAAAATCATTAAAGGGGCCGG - Intronic
1059331889 9:113540841-113540863 TTTTGCATCAGTAAAGTGGATGG + Intronic
1186335705 X:8585017-8585039 TTTTTAAACTTTGAAGTGGCGGG - Intronic
1186852515 X:13594229-13594251 TGTTCAATGAATAAAGTGGTAGG - Intronic
1186954109 X:14661317-14661339 TTTTCCATCATTTAAGTTGTAGG + Intronic
1187403266 X:18981395-18981417 TTTTTAATCATTAAAATGTTGGG + Intronic
1190476884 X:50836965-50836987 GTTTCAATCAGTAAAGTGCAGGG - Intergenic
1191237081 X:58142804-58142826 GTTTCAACCATTAAAATGCCTGG - Intergenic
1191242427 X:58199958-58199980 TTCTCTATCATTAGAGTGCCTGG - Intergenic
1191247754 X:58241417-58241439 GTTTCAATCATTAGAATGCCTGG - Intergenic
1192662751 X:73059645-73059667 TTTTAAATCAGTAAAATGGGAGG + Intergenic
1192877193 X:75243594-75243616 TCTTAAATAATTAAACTGGCTGG + Intergenic
1193269747 X:79515390-79515412 TTTTCAAACCTTAAACTGGTTGG + Intergenic
1193427922 X:81362675-81362697 TTTTCAATCAACAAATTTGCAGG + Intergenic
1196007045 X:110847975-110847997 TTTTCAGTCATTCAGGTGGTGGG + Intergenic
1197847013 X:130813799-130813821 ATTTCAAGCATAAAAGTGGGCGG + Intronic
1198884130 X:141315112-141315134 TCTTTCATCATTAAAGTGCCTGG + Intergenic
1199569901 X:149256816-149256838 GTTACAATCAATAAAGTAGCTGG + Intergenic
1202347056 Y:23942622-23942644 TTTTAAATGATTAACCTGGCTGG + Intergenic
1202523715 Y:25727468-25727490 TTTTAAATGATTAACCTGGCTGG - Intergenic