ID: 1101351330

View in Genome Browser
Species Human (GRCh38)
Location 12:103931905-103931927
Sequence ACACCGAGTAAGTTTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101351330 Original CRISPR ACACCGAGTAAGTTTAAAAA TGG Intronic
902179806 1:14679323-14679345 ACACCAAGTAAGTTTAGGATTGG + Intronic
905317866 1:37095023-37095045 ACACCGACTAAGATGAATAAGGG - Intergenic
908856259 1:68433204-68433226 ACAACGAGTGAGTGTATAAATGG + Intronic
915666246 1:157447824-157447846 ATACCATGTAAGCTTAAAAATGG - Intergenic
915786027 1:158613015-158613037 ACACTGAGTAGGATTAAAAAGGG - Intronic
918965174 1:191335869-191335891 ATAAAGAGTAAGTTTAAAAGAGG + Intergenic
920711284 1:208297324-208297346 ACAAAGAGAAAGTTTAAGAAAGG - Intergenic
922427236 1:225510126-225510148 ACACAATGTCAGTTTAAAAACGG + Intronic
924258779 1:242208857-242208879 ACACTGATGAAGTTTAAATAGGG + Intronic
1071799253 10:89041075-89041097 ACAACAAAAAAGTTTAAAAATGG - Intergenic
1073946378 10:108755405-108755427 ACACACAGTAAGTCTAAAAAGGG + Intergenic
1079397386 11:20076743-20076765 AAAAAGAGTAAGTTTAAGAATGG - Intronic
1080302816 11:30803336-30803358 ATCCAGAGTAAGTTTAGAAATGG + Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1081892373 11:46554220-46554242 ACACCTTGTAAGATTATAAATGG - Intronic
1082725396 11:56728662-56728684 ACAGCTACAAAGTTTAAAAAAGG + Intergenic
1087193342 11:95279789-95279811 ACACCGATAAAGTTTGTAAAGGG + Intergenic
1087397820 11:97624617-97624639 ACACAGAGTAATATTAAAAGGGG - Intergenic
1088289337 11:108219620-108219642 AAACCAAGTAAGTTTCAAATTGG + Intronic
1091251662 11:134149066-134149088 ACACGGAGTAAGTCTAACATGGG - Intronic
1092612236 12:10184787-10184809 ACAAAGAGTAACTTTGAAAATGG - Intronic
1094212888 12:27910833-27910855 ACACCTAGGAAGCTTAAGAAGGG - Intergenic
1097612648 12:61843484-61843506 ACACAGAGTAAGTTTTCAAAGGG + Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1100790469 12:98124767-98124789 ACAGCAAGTAGGTTTAAAAAGGG + Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1101573485 12:105976577-105976599 AGAACAAGTAAATTTAAAAAAGG + Intergenic
1105462457 13:20605298-20605320 AGAACCAGTAAGTATAAAAATGG - Intronic
1106478241 13:30116190-30116212 ACACAGAGTAAGTTACAAGAGGG - Intergenic
1107384892 13:39897633-39897655 AACCCTAGAAAGTTTAAAAACGG + Intergenic
1109377597 13:61518251-61518273 ACATCAAGTATGTTTCAAAAGGG - Intergenic
1109889260 13:68586437-68586459 TCTCCGAGTAAGTATAAGAATGG + Intergenic
1113094564 13:106650111-106650133 ACACTGAGTAAGTTGGATAAAGG - Intergenic
1119245377 14:73100924-73100946 GGACCGAGTAAGCTTAAAAATGG + Intronic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1126186902 15:45839553-45839575 ACAAAGAATAAGTTTTAAAATGG + Intergenic
1134025898 16:10953669-10953691 ACACAGCCTAATTTTAAAAATGG + Intronic
1143814810 17:9504065-9504087 ACACATACTAAGTTTTAAAAAGG + Intronic
1144799530 17:17915822-17915844 AAACCTACTCAGTTTAAAAATGG - Intronic
1149217001 17:54369390-54369412 ACACACACTCAGTTTAAAAAGGG + Intergenic
1150449902 17:65258079-65258101 ACACCTAGTAAGTATTAACATGG + Intergenic
1154098604 18:11446489-11446511 ACAGGGAGAAAATTTAAAAATGG - Intergenic
1156875782 18:42009365-42009387 ACACCAAATAATTTTTAAAAAGG - Intronic
1202672530 1_KI270710v1_random:4440-4462 ACACTGCGTAAGTATAAAACAGG - Intergenic
924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG + Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927161825 2:20270707-20270729 ATACCAAGTAATTTTTAAAAAGG + Intronic
930252440 2:49049975-49049997 ACACCTAGCAAGTTAAAAATAGG + Intronic
930812089 2:55553298-55553320 ACACCTTGTAAGTATAAGAATGG - Intronic
931522720 2:63117229-63117251 AGATAGATTAAGTTTAAAAAAGG - Intergenic
938622429 2:133070278-133070300 ACAAAGAGTAAATTAAAAAATGG + Intronic
939356189 2:141106039-141106061 ACACCAAGTAAGTTTCTAAATGG + Intronic
939432274 2:142126431-142126453 ACACAGAGAGAGATTAAAAACGG + Intronic
939916251 2:148047400-148047422 AGACAGAGGAAGTTTTAAAAAGG + Intronic
940069569 2:149670754-149670776 ACACAGAGTAACTTCAGAAAGGG + Intergenic
942369702 2:175270403-175270425 ATACAGGGTGAGTTTAAAAAAGG - Intergenic
943462408 2:188184923-188184945 ACACCAATTAAGTTAAAAACAGG - Intergenic
943587903 2:189762336-189762358 ACACCCAGAAAGTTTTAGAACGG - Intronic
1174313185 20:49675417-49675439 ACAGGGAGTAAGTTTATCAAGGG + Intronic
1178454843 21:32739580-32739602 AGACAGAGTAATCTTAAAAATGG + Intronic
949832872 3:8235097-8235119 ACAATAAATAAGTTTAAAAACGG + Intergenic
952263517 3:31763625-31763647 ACAGCAATTAAGTTTTAAAAGGG - Intronic
954556069 3:51518691-51518713 AAATCAAGTAATTTTAAAAAGGG - Intergenic
955647937 3:61160667-61160689 CCACAGTGTAACTTTAAAAAAGG - Intronic
959174381 3:102887510-102887532 ACACAGAATAACTTGAAAAATGG + Intergenic
961025680 3:123554174-123554196 AAACAATGTAAGTTTAAAAATGG + Intronic
963560551 3:146859433-146859455 AAACCAAGTTAGTTTACAAATGG - Intergenic
964632518 3:158827331-158827353 ATACTGAGTAAGTATTAAAAGGG + Exonic
965382232 3:168004197-168004219 GAACCGAGTAATTTCAAAAAAGG + Intergenic
970408948 4:15789432-15789454 GCACCGAGTACATTTAAAAGTGG + Intronic
971133713 4:23842282-23842304 ACACCCAGTAGGATAAAAAAAGG - Intronic
972507324 4:39732266-39732288 ATAGCTAGTAAGTTTTAAAAAGG + Intronic
975577140 4:75874671-75874693 ACACTGAGTCAGTTTGCAAAAGG + Intronic
977229215 4:94431865-94431887 TCACCTTGTAATTTTAAAAAGGG - Intergenic
977402811 4:96555297-96555319 ATACCTATTAAGTTTCAAAATGG + Intergenic
978167573 4:105627174-105627196 TCATCGAGTAATTTTCAAAAAGG + Intronic
978490016 4:109302458-109302480 ACACCGAGTAGGTAGAAATAAGG - Exonic
978574692 4:110177488-110177510 GCACTCAGTAAGTTTATAAAAGG - Intronic
981640897 4:146942681-146942703 AGCCCTAGTAAATTTAAAAAGGG + Intronic
986848451 5:11782361-11782383 AAACGTAGTAAGTTTACAAAAGG - Intronic
995412532 5:111874732-111874754 ACACCGAAAAAGCCTAAAAATGG - Intronic
996791871 5:127301803-127301825 ACACCAAGTAATGTTAAAATAGG + Intronic
1001184765 5:169559156-169559178 ACACCCACTAAAGTTAAAAAGGG - Intergenic
1001355181 5:171014428-171014450 ATAGCTAGTAAGTTCAAAAAGGG - Intronic
1003428794 6:6020088-6020110 ACACCTAGAAGGTTTAAAAGTGG + Intergenic
1004157462 6:13182839-13182861 ATACTGAGTATTTTTAAAAATGG + Intronic
1015297903 6:131619659-131619681 ACACAGAGTAAGTGAAAACAAGG + Intronic
1017363877 6:153609637-153609659 ACACCGAGTAAGTAGAAGGAAGG + Intergenic
1021104921 7:16626611-16626633 AATCCGAGTAAGTTTCTAAAGGG + Intronic
1021386884 7:20041849-20041871 ACACAGAATAAGATTAATAATGG - Intergenic
1022041462 7:26585830-26585852 ATACAGAGTAGGTTTCAAAATGG + Intergenic
1022197906 7:28086967-28086989 ACACATAGTAAGTTAAATAAAGG - Intronic
1027950794 7:84812398-84812420 CCACAGAGTAATTTAAAAAATGG - Intergenic
1028673725 7:93434608-93434630 ACACTTAGAAAATTTAAAAATGG + Intronic
1030992492 7:116317192-116317214 ACACAGTGAAAGTTTAAGAATGG + Intronic
1031091549 7:117361763-117361785 ATACCAACTAATTTTAAAAAAGG + Intergenic
1033681932 7:143603374-143603396 GCACTGAGAAAGGTTAAAAATGG + Intergenic
1033702958 7:143858539-143858561 GCACTGAGAAAGGTTAAAAATGG - Intronic
1034106348 7:148494097-148494119 ACACCGAGTAATTTATAAAGAGG + Intergenic
1034211441 7:149367064-149367086 TCACTGAGAAAGTTTAAAAGGGG - Intergenic
1034388117 7:150757830-150757852 AAACCTATTAATTTTAAAAAGGG + Intergenic
1038977113 8:32711966-32711988 ACACCCAGTAAGTTGGATAACGG + Intronic
1039081227 8:33735998-33736020 ACACAGAGTAAGTTCTAATAAGG - Intergenic
1045260279 8:100566894-100566916 AAACAGAGGAAGTTAAAAAAAGG + Intergenic
1045414988 8:101957216-101957238 ATAACAAGTAAGCTTAAAAAAGG + Intronic
1046274250 8:111936847-111936869 ACACAGAGTAAGTTAAACAATGG + Intergenic
1046287663 8:112115775-112115797 ATACTGAGGAAGTTTAAAATAGG + Intergenic
1047041218 8:120998220-120998242 ACACCTAGTGATTTTAAAACAGG - Intergenic
1050796778 9:9556283-9556305 ACACTGAGTAAGTTGAAGAAAGG + Intronic
1056022828 9:82458642-82458664 ATACCAAGAAAGTGTAAAAATGG + Intergenic
1056202152 9:84287204-84287226 ACACTGAGTAACTTTACAAGTGG + Intronic
1058684272 9:107466424-107466446 CCTCCGAGTAACCTTAAAAAGGG - Intergenic
1060064397 9:120490493-120490515 ATACCTGGTAACTTTAAAAATGG - Intronic
1060842929 9:126808941-126808963 ACAGTAAGTAACTTTAAAAATGG - Intronic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1198147673 X:133873639-133873661 AAACAGAGGAAGTTTGAAAAGGG + Intronic
1198847435 X:140927315-140927337 AAACCGAGTAAGTGAAAAATTGG + Intergenic
1200821971 Y:7595144-7595166 AAGCCAAGTAAGTTTACAAATGG + Intergenic
1201056656 Y:10000137-10000159 AAACCAAGTAAGTTTACAAATGG - Intergenic
1202238333 Y:22738872-22738894 AAGCCAAGTAAGTTTACAAATGG - Intergenic