ID: 1101353651

View in Genome Browser
Species Human (GRCh38)
Location 12:103956729-103956751
Sequence CAGCCTGCCGACCATGCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101353651_1101353659 -6 Left 1101353651 12:103956729-103956751 CCGCGGGCATGGTCGGCAGGCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1101353659 12:103956746-103956768 AGGCTGGACGGGGAAGGAAGGGG 0: 1
1: 1
2: 7
3: 71
4: 690
1101353651_1101353658 -7 Left 1101353651 12:103956729-103956751 CCGCGGGCATGGTCGGCAGGCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1101353658 12:103956745-103956767 CAGGCTGGACGGGGAAGGAAGGG 0: 1
1: 0
2: 2
3: 49
4: 497
1101353651_1101353657 -8 Left 1101353651 12:103956729-103956751 CCGCGGGCATGGTCGGCAGGCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1101353657 12:103956744-103956766 GCAGGCTGGACGGGGAAGGAAGG 0: 1
1: 0
2: 1
3: 66
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101353651 Original CRISPR CAGCCTGCCGACCATGCCCG CGG (reversed) Exonic
900161964 1:1228116-1228138 CAGCCTGCGGAGGCTGCCCGTGG + Intronic
901787779 1:11636078-11636100 CAGCCTGCCAACCAGGCTGGAGG - Intergenic
902630658 1:17702615-17702637 CAGCCTGACCACCATGGCAGGGG - Intergenic
904587572 1:31588666-31588688 CAGCCTGGCGTCTGTGCCCGGGG - Intergenic
919814648 1:201429828-201429850 CAGCCTGCCGTCCTTCCCTGGGG + Intronic
1063565852 10:7171903-7171925 GTGCCCGCCGACCAAGCCCGAGG - Exonic
1076863981 10:133158526-133158548 GAGCCTGCGGCCCCTGCCCGAGG + Intergenic
1077106935 11:846234-846256 CAGCCTGGGTGCCATGCCCGTGG - Intronic
1077137420 11:1008016-1008038 GAACCTGCAGACCAAGCCCGTGG + Exonic
1077216560 11:1397567-1397589 CAGCCTGCAGCCCAGGCCCCTGG - Intronic
1078510313 11:11979906-11979928 CAGCCTGCCTTCCAGGCCCTGGG + Intronic
1083238746 11:61370152-61370174 CAGCCTGCCTACCCTACCCGAGG - Intergenic
1083578957 11:63813197-63813219 CAGTCTGCGGGCCAAGCCCGGGG - Intergenic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1085512147 11:77093820-77093842 CACCCTGCCCACTCTGCCCGAGG - Intronic
1089604795 11:119635637-119635659 CAACCTGCCGCTCCTGCCCGTGG + Intronic
1094841613 12:34344751-34344773 CACCCTGCCGTGCATGCGCGAGG - Intergenic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1105303118 13:19152555-19152577 CAGGCAGCCGGCCATGCCCATGG - Intergenic
1106168069 13:27266371-27266393 CACCCTGCCCTCCATACCCGTGG + Intergenic
1116836229 14:49770958-49770980 CAGCCTGCTGACCATGGCACAGG + Intronic
1117825380 14:59696577-59696599 CAGCCTGCCAGCCCTGCCCTTGG - Intronic
1121436663 14:93925124-93925146 AAGCCTCCCCACCAGGCCCGTGG - Exonic
1124564621 15:30801742-30801764 CAGCCTGCCCACCCCGCCTGAGG - Intergenic
1125836844 15:42759406-42759428 CAGCCTGCTGAGCCTGCCCCTGG + Intronic
1126348049 15:47717355-47717377 CCTCCTGCCGTCCGTGCCCGGGG + Intronic
1128217306 15:65943426-65943448 CAGCCTGCAGAACATGCACGTGG - Intronic
1129890211 15:79066831-79066853 CATCCTGCAGACCAGGCACGGGG + Intronic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132184691 15:99792736-99792758 CTGCCTGCCCACCCTGCCTGAGG - Intergenic
1132432292 15:101771918-101771940 CTGCCTGCCCACCCTGCCTGAGG + Intergenic
1133862522 16:9609595-9609617 CAGCAGGCAGACCATGCCAGGGG + Intergenic
1133965807 16:10530942-10530964 CAGCCTCCCTACCATGCCACAGG + Exonic
1135221086 16:20614538-20614560 CAGCCTGACAACCATGCTCTAGG - Intronic
1136619153 16:31416502-31416524 CAGCCTGCAGACCCTGACCGTGG + Exonic
1140851248 16:78936598-78936620 CAGCCTGTGGACCTTGCCCAGGG - Intronic
1148159798 17:45443468-45443490 CAGCCTGCTTCCCATGCCTGTGG - Intronic
1150391086 17:64790340-64790362 CAGCCTGCTTCCCATGCCTGTGG - Intergenic
1151591495 17:75047373-75047395 CAGCCGGGCGGCCGTGCCCGCGG - Exonic
1152423180 17:80204966-80204988 CAGCCAGCCTACCCTGCCCCGGG - Intronic
1152538087 17:80961765-80961787 CACCCTGCCACCCCTGCCCGTGG - Intronic
1160455670 18:78997264-78997286 CAGCCAGCCGCCCATTCACGCGG + Exonic
1161709222 19:5838516-5838538 CAGCCTGCAGACCCTCCCCCAGG + Intronic
1162237630 19:9321492-9321514 CAGCCAGCCGTCCCTGCCCCGGG + Intergenic
1163385827 19:16999870-16999892 CAGCCTGACCACCATGGCCTGGG - Intronic
1164769327 19:30795980-30796002 CAGACCCCCGACCATGCCGGTGG - Intergenic
1165326266 19:35116161-35116183 CAACCTGCCGCCCATGGCTGGGG + Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167509497 19:49888576-49888598 CAGCCTGGAGATCCTGCCCGAGG + Exonic
925153654 2:1634567-1634589 CACCCTTCCGTCCATGCCCACGG + Intronic
926063138 2:9816931-9816953 CGGCCTGCAGATCTTGCCCGTGG + Intergenic
934615821 2:95770030-95770052 CATCCTGCCCACCATGGCTGAGG + Intergenic
938292401 2:130157149-130157171 CACCCTGCCCTCCATGCCCTGGG + Intronic
938370162 2:130763586-130763608 CAGCCAGCTGACGATGCCCATGG - Exonic
938464153 2:131515827-131515849 CACCCTGCCCTCCATGCCCTGGG - Intergenic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
946246902 2:218393040-218393062 CATCCTGCCCACCGTGCTCGTGG + Exonic
947727856 2:232410877-232410899 CAGCCTGCTGACACTGCCCCAGG - Intergenic
1169220676 20:3820595-3820617 CAGCCTTCCGTCCGGGCCCGCGG - Exonic
1170963443 20:21045974-21045996 CAGCCTGCTGAGAATGCCTGTGG + Intergenic
1174533190 20:51230855-51230877 CAGCCTGCAGACCTCGGCCGAGG + Intergenic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179576206 21:42310050-42310072 GAGCCCCCCGACCATGCCTGGGG + Intergenic
1179924749 21:44528324-44528346 CAGCCTGACGGCCAAGCCTGAGG + Intronic
1181111908 22:20607309-20607331 CACCCTGCCCCCCATGCCCCGGG + Intergenic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1183393191 22:37557398-37557420 CTGCCTGCCCTCCCTGCCCGCGG + Intergenic
1183456847 22:37927560-37927582 GAGCCTGCTGTCCATGCCCCTGG + Exonic
1183744696 22:39685811-39685833 CAGCCTGCAGACCACGCTCGAGG + Exonic
1185297146 22:50059989-50060011 CGGCCTGCAGACCCTGCCAGGGG - Exonic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
954411532 3:50373371-50373393 CTGCCTGCCCACCACGCCCGAGG - Intronic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
964048578 3:152362288-152362310 CAGCCTGCTGATCCTGCCAGTGG - Intronic
968919228 4:3514097-3514119 CAGCCTGTGGCCCTTGCCCGTGG - Intronic
969525782 4:7703390-7703412 CAGCCTGCCCTCCCTGCCCCGGG - Intronic
976390075 4:84497901-84497923 GAGCCGGCCCTCCATGCCCGTGG - Exonic
978279016 4:106987479-106987501 CAAACTGCAGACCATGCCTGAGG - Intronic
982224336 4:153152342-153152364 CAGCCCGGCGACCACGCCCCAGG - Intronic
985645634 5:1083510-1083532 CAGCTTGCTGACCATGACGGAGG + Intronic
990955041 5:61332391-61332413 CTGCCTGTCGGCCAGGCCCGCGG + Exonic
995650468 5:114362645-114362667 CAGACTGCCGAGGCTGCCCGTGG - Exonic
997347004 5:133199302-133199324 CAGCATGCCCACCTTCCCCGTGG + Exonic
999238691 5:150115088-150115110 CAGCCTGCAGCCCTTGCCCAGGG - Exonic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1002051485 5:176574073-176574095 CTCCCTGCAGACCCTGCCCGTGG + Exonic
1006630711 6:35427850-35427872 CAGCCTCCCTTCCATGCCCCAGG + Exonic
1011075326 6:83431688-83431710 CAGGATGCCGGCCATGCCCGGGG + Intergenic
1017808519 6:157967066-157967088 CAGCCTGTCGGCCAGGCCCCAGG - Intergenic
1018907272 6:168082875-168082897 CACCCTGCCCACCTTGCCCCAGG - Intergenic
1025850273 7:65238896-65238918 CAGCCTGGCGACCATGCATAGGG - Intergenic
1027559127 7:79705114-79705136 CTGTCTGCCTACCATGCCCCAGG + Intergenic
1032308275 7:130757055-130757077 TAGCCTGATGACCATGCACGTGG + Intergenic
1033608962 7:142947306-142947328 CAGCCTTCCTACCTTCCCCGTGG - Intronic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035179704 7:157080345-157080367 CAGCCTGTGGACGGTGCCCGTGG - Intergenic
1035716244 8:1757225-1757247 CAGGCTTCCGACAATGCCCAGGG - Intronic
1036048397 8:5168840-5168862 GAGCCGGCCGACCATGCAGGAGG + Intergenic
1036207499 8:6815828-6815850 CAGCCTGCAGACCATAGCTGGGG - Exonic
1048875392 8:138833236-138833258 CAGCCTGCCCATCCTGCCCCAGG + Intronic
1049384160 8:142332675-142332697 CAGCCTGCAGACCCTTCCCATGG - Intronic
1049693651 8:143973458-143973480 CAGCGGGCCGGCCATGCCGGCGG + Intronic
1051823647 9:21195036-21195058 CAGCCTGCCCAGCCTCCCCGGGG - Intergenic
1051825465 9:21213572-21213594 CAGCCTGCCCAGCCTCCCCGGGG - Intronic
1053055869 9:34992758-34992780 CAGCCTGGGCACCATGCCTGAGG + Intronic
1059234674 9:112751251-112751273 CACCCTGCCGCCCCTTCCCGGGG + Intronic
1060829788 9:126706181-126706203 AAGCCTGCTGACCTTGCTCGAGG - Intergenic
1062098134 9:134713045-134713067 CTGCCTGCCGTCCATGCCTCTGG + Intronic
1062482164 9:136757581-136757603 CAGCCTGCCAACCACGCCAGAGG + Intronic
1062581058 9:137229447-137229469 CAGCCTGCAGCCCAGGCCCCCGG - Exonic
1188114173 X:26223373-26223395 CAGCCTGCCAACCCTGCCTTAGG - Intergenic
1188444436 X:30241871-30241893 CAGCTTGCCAACCCTGCCTGGGG - Intergenic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1200064350 X:153497422-153497444 CACCCTGCCGACCGGGCCTGGGG + Intronic
1200126146 X:153815999-153816021 CACCCTGCCGACCGGGCCTGGGG - Intronic