ID: 1101355991

View in Genome Browser
Species Human (GRCh38)
Location 12:103978128-103978150
Sequence GACACTGTTTGAATAATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101355991 Original CRISPR GACACTGTTTGAATAATCTA GGG Intronic
903834741 1:26196347-26196369 GAGACTGATTGGATAAACTATGG - Intronic
904125713 1:28236773-28236795 GACACTGTGCGAAGAATCTGGGG - Intronic
905891748 1:41522349-41522371 GAAACTGTTTGACTAATAGAGGG - Intronic
908035637 1:60048958-60048980 TGAACTGTTTGAATAAACTAAGG - Intronic
908808526 1:67955712-67955734 GACAGTGTTAGAATGATCCATGG - Intergenic
908933300 1:69342158-69342180 GACAATGTTTGAAAAAACAAAGG - Intergenic
910362812 1:86431381-86431403 GAGACTGGTTGAATAAATTATGG - Intronic
911304886 1:96221622-96221644 GCCACTGTTTTAATAAGCCAAGG - Intergenic
913133877 1:115868448-115868470 GAGACTGGTTGAGTAAACTATGG - Intergenic
913938289 1:125077483-125077505 GAATCTTTTAGAATAATCTAAGG + Intergenic
913944547 1:125146518-125146540 GAATCTTTTAGAATAATCTAAGG - Intergenic
917990782 1:180376446-180376468 GAGAGTGTTTCAATAAACTATGG + Intronic
919955266 1:202408343-202408365 GAAACTGTTTAACTAATCTCTGG - Intronic
923235567 1:232029928-232029950 GACACTGATTGACCAATCCAAGG + Intronic
923425115 1:233861002-233861024 CACAGTGTTTGACTAATCTAAGG + Intergenic
1064216401 10:13404281-13404303 GTCTCTGTTTGAAATATCTAAGG - Intergenic
1064777446 10:18795219-18795241 ACCACTGTTTTAAAAATCTAGGG + Intergenic
1068220771 10:54042852-54042874 GATACTATTTACATAATCTAGGG + Intronic
1069563371 10:69447382-69447404 GACACTGTTTGAACAAGGAATGG + Intergenic
1073690622 10:105804815-105804837 TGCACTGTTTGAATAATGAATGG - Intergenic
1074277381 10:112016550-112016572 GACACTTTATGAAAAATTTATGG - Intergenic
1075135433 10:119781089-119781111 GACAGTGGTTGAATAAACTATGG - Intronic
1076225300 10:128769998-128770020 GAAACTGTTTAAATTATGTACGG - Intergenic
1078486671 11:11729545-11729567 AACTCTGTTTGAATAACTTAAGG - Intergenic
1079720705 11:23809147-23809169 GAGAGTGGTTGAATAAACTAAGG - Intergenic
1079834367 11:25314371-25314393 GAAATTATTTGAATAATCTAAGG - Intergenic
1079892401 11:26073044-26073066 GACAATGTTTGAATCAGCTATGG + Intergenic
1085661865 11:78375382-78375404 TACACAGTTTGAAAAATCTAAGG + Intronic
1090824180 11:130372226-130372248 GAAACAGTTTGTATAATATAAGG - Intergenic
1093803553 12:23403713-23403735 GAGATTGCTTGAATAAACTATGG - Intergenic
1094481344 12:30884715-30884737 AACAGTGTTTGAAAAATGTAGGG - Intergenic
1095381744 12:41602971-41602993 GACAGTGTTTATAAAATCTACGG - Intergenic
1098846580 12:75544424-75544446 GAAGCTGTTTTAATATTCTAAGG + Intergenic
1099565177 12:84233281-84233303 GAAACTGGTTGAAAAATATATGG + Intergenic
1100456546 12:94757167-94757189 GACATTGTTTAAATAAGCTATGG + Intergenic
1101326107 12:103717219-103717241 GACACTGTCTGAAGAAGCTGGGG - Intronic
1101355991 12:103978128-103978150 GACACTGTTTGAATAATCTAGGG + Intronic
1102113315 12:110381640-110381662 AACTCTGTTAGAATAATCTGGGG - Intronic
1104040317 12:125125724-125125746 GAAATTGATTGAATAATTTAGGG + Intronic
1105233999 13:18528800-18528822 GAATCTTTTAGAATAATCTAAGG - Intergenic
1106674362 13:31942220-31942242 CAGACTGTTTGAACAATCTGAGG + Intergenic
1107349030 13:39494585-39494607 GAAACTGTTTGCATAAAATAAGG - Intronic
1108870620 13:54980087-54980109 GCTACTGTGTTAATAATCTAAGG - Intergenic
1109394417 13:61736994-61737016 GATTATGTTTGAATAATTTATGG + Intergenic
1110403664 13:75123379-75123401 GATACTGTTGGGAAAATCTAGGG + Intergenic
1112517661 13:100068986-100069008 GAGACTGATTGAATAAACTAGGG + Intergenic
1112898947 13:104336137-104336159 TTCACTGTTTGAATAATCCTTGG - Intergenic
1118733772 14:68687916-68687938 GACACTGCTGAAATAAACTATGG + Intronic
1122611808 14:102989513-102989535 GAGACTACTTGAATAAACTATGG + Intronic
1126266447 15:46759883-46759905 GATTCAGTTTGAAAAATCTAGGG + Intergenic
1127126224 15:55814415-55814437 GAGACTGATTGAATAAACTAAGG - Intergenic
1127396934 15:58550578-58550600 GACTGTGTTTGAAGAATATACGG - Intronic
1128573964 15:68757115-68757137 GATACTGGTTAAATAATTTATGG + Intergenic
1129698649 15:77754969-77754991 GACACTTTTTGACTTATCTGGGG + Intronic
1131736845 15:95341790-95341812 GACAGTATTTGTATAATCTCAGG - Intergenic
1134130246 16:11644421-11644443 GGAACTGGTTGAATAATCTATGG + Intergenic
1135175077 16:20220926-20220948 GACACTTTTTAATTAATCTTGGG - Intergenic
1136935306 16:34457384-34457406 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136938136 16:34495147-34495169 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136949230 16:34695045-34695067 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136961679 16:34853410-34853432 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136964512 16:34891196-34891218 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136968653 16:34945756-34945778 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137089116 16:36166306-36166328 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137093654 16:36225524-36225546 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137407827 16:48204011-48204033 GCCACTGGTTAAATAATTTATGG - Intronic
1140738171 16:77917672-77917694 GATTCTATCTGAATAATCTAAGG + Intronic
1143074556 17:4329609-4329631 GACACTATTTCCATAATTTAAGG + Intronic
1143353191 17:6304591-6304613 GAGAATGTTTTAATAATATATGG - Intergenic
1144507035 17:15840807-15840829 GACAATATTTGAATATTCCAGGG - Intergenic
1145171160 17:20658408-20658430 GACAATATTTGAATATTCCAGGG - Intergenic
1203184215 17_KI270729v1_random:97091-97113 GAATCTTTTAGAATAATCTAAGG - Intergenic
1153704372 18:7730311-7730333 GACACTGTTTGAATATTTAATGG + Intronic
1154515538 18:15161077-15161099 GAATCTTTTAGAATAATCTAAGG + Intergenic
1154961098 18:21309526-21309548 GATGCTGTTTGAGTGATCTAAGG + Intronic
1157017333 18:43732456-43732478 GACACTAGTTGAATAAAATATGG - Intergenic
1158859222 18:61575818-61575840 GACACTGTTTTAGTTTTCTAGGG - Intergenic
1159034763 18:63266180-63266202 GAGACTGATTAAATAAACTATGG + Intronic
1159101665 18:63965271-63965293 CACACTGTTTCAACAATCAATGG + Intronic
1159527203 18:69607716-69607738 AAAACTGTGTGCATAATCTAGGG + Intronic
1159558765 18:69972782-69972804 AAAACTGGTTGAATAAACTATGG + Intergenic
1159807883 18:72977723-72977745 TACACAGTTTGCATAATATATGG + Intergenic
925480619 2:4267524-4267546 AACAGTGTTTGATTAATCTTGGG - Intergenic
925857798 2:8146901-8146923 TACACTCTTTGCATGATCTAAGG - Intergenic
926488517 2:13493925-13493947 GACACTTTTTTAAGATTCTAAGG - Intergenic
926829951 2:16950773-16950795 GCCACTCTTTGAATAGTCTAGGG + Intergenic
927881838 2:26694491-26694513 GACACTGTTCCAAGAATCTACGG + Intronic
928328990 2:30342889-30342911 TGCACTGTTTGAATATACTAAGG + Intergenic
929289302 2:40170962-40170984 GCAACTGTTTGGATAACCTAGGG + Intronic
930338036 2:50075410-50075432 GACATTATTTTAATGATCTAAGG - Intronic
930938318 2:56983031-56983053 GAAACTGATTGCATCATCTATGG + Intergenic
931570334 2:63662459-63662481 GATACTGTGTGAATAATGAATGG - Intronic
931986475 2:67747232-67747254 GAGACTGTTTGAATAGTATTGGG - Intergenic
933302897 2:80562695-80562717 GGCACTGGTTGAATAAATTATGG + Intronic
934332170 2:92079105-92079127 GAATCTTTTAGAATAATCTAAGG - Intergenic
935456557 2:103275787-103275809 GAGACTGATTAAATAAACTATGG - Intergenic
935501331 2:103843386-103843408 TACACTGTTTCATTAATCTTAGG - Intergenic
938515800 2:132005848-132005870 GAATCTTTTAGAATAATCTAAGG + Intergenic
938786896 2:134638223-134638245 GACACTGCTTAAATAAATTACGG - Intronic
939342274 2:140914056-140914078 GACACTTTTTGAATTAGCAATGG + Intronic
940149290 2:150581365-150581387 TGCTCTGTTTGAAGAATCTAGGG - Intergenic
940614361 2:156031896-156031918 GGCACTGGTTGAATAAATTATGG + Intergenic
941911296 2:170767601-170767623 GGGACTGTTTGAATAAATTATGG + Intergenic
943740934 2:191408402-191408424 AACACTGTATTAATAATATACGG - Intronic
943823285 2:192355434-192355456 GTCACTGCTAGAATGATCTATGG + Intergenic
944056941 2:195532147-195532169 AACTCTGTTTGAATGCTCTATGG - Intergenic
945369689 2:209001993-209002015 GTCACTTTTTGAAGAAGCTAAGG - Intergenic
1169739146 20:8871111-8871133 TACTCTGTTTTCATAATCTATGG - Intronic
1173097334 20:40047977-40047999 CACACTGCTTGAACAATCAAAGG + Intergenic
1176777986 21:13157062-13157084 GAATCTTTTAGAATAATCTAAGG - Intergenic
1176907810 21:14524717-14524739 GATACTGATTGAATAATATATGG + Intronic
1177015198 21:15778668-15778690 GAAACAGTTTGATTCATCTAAGG + Intronic
1177691504 21:24515427-24515449 GACACTTTTGGAATAATGTATGG - Intergenic
1177975606 21:27846078-27846100 GAATCTTTTAGAATAATCTAAGG - Intergenic
1178323176 21:31621565-31621587 GAAATTGTTTGAATAAATTATGG - Intergenic
1179942354 21:44648441-44648463 GACACGGGTTGAATAAACTCTGG - Intronic
1180525764 22:16258488-16258510 GAATCTTTTAGAATAATCTAAGG - Intergenic
1183692856 22:39400698-39400720 GGCACTGTTAGAATTGTCTATGG + Intronic
1203322608 22_KI270737v1_random:82415-82437 GAATCTTTTAGAATAATCTAAGG + Intergenic
950371456 3:12534240-12534262 GACACTGTTTGCAAAATCACAGG - Intronic
951552212 3:23885558-23885580 GACAATGTTTAAAAAATCTCTGG + Intronic
952197785 3:31094129-31094151 GAACCTGTTTGAGTTATCTATGG - Intergenic
954359251 3:50110258-50110280 CACACTGTAGCAATAATCTAAGG - Intronic
955181889 3:56680097-56680119 TACCCAGTTTGAATAATCTAAGG - Intronic
955926448 3:64010274-64010296 GACACTGTTTGTTTAATTTTAGG + Intergenic
959769693 3:110078009-110078031 GGAACTGTTAGAATAATCTAAGG - Intergenic
961154032 3:124663817-124663839 ACCACTGTATGAATAATTTACGG + Intronic
962544919 3:136424265-136424287 GACAATGTATGAAACATCTAAGG + Intronic
963309160 3:143689340-143689362 AAGACTGATTGAATAAACTATGG + Intronic
964253541 3:154748848-154748870 GAGAGTGGTTGAATAAACTATGG - Intergenic
964566011 3:158053561-158053583 GAAAATGATTGAATAAACTATGG + Intergenic
966263607 3:178010569-178010591 GAGAGTGATTGAATAAACTATGG - Intergenic
967595815 3:191325944-191325966 AAGACTGTATGAATATTCTAAGG - Intronic
971144960 4:23966582-23966604 GTCACTGTTAGGATAAACTACGG - Intergenic
971648261 4:29236092-29236114 GAGGCTATTTGAATAATGTAGGG - Intergenic
971788822 4:31140993-31141015 GACGCTGTTTCAATAATCGATGG + Intronic
976136927 4:81947615-81947637 CACACTGTTTGAATAATGACAGG - Intronic
976359519 4:84161156-84161178 TACATTGTTTGAATAAGCCAAGG - Intergenic
976673522 4:87679861-87679883 TAAACTTTTTGAATAATCAAAGG - Intergenic
978934355 4:114357339-114357361 TACAGTGTTACAATAATCTATGG + Intergenic
980406688 4:132362111-132362133 GACCATGTATGAATATTCTAAGG - Intergenic
982890038 4:160835846-160835868 GAGCCTGTTTAAATAAACTATGG - Intergenic
983122265 4:163901257-163901279 GACAATGTTTTAATAAATTATGG + Intronic
983727553 4:170947119-170947141 TACAGTGTCTGAATATTCTATGG + Intergenic
985045159 4:185933336-185933358 AACAGTGTTTGAATCATCTGTGG + Intronic
986571847 5:9173743-9173765 GACCTTGTTTGAAGAATCAAAGG - Intronic
986713444 5:10504219-10504241 CACACTGTTGGCATAAACTAAGG + Intergenic
987212796 5:15700727-15700749 GATACTTTTTGGATAATTTATGG + Intronic
987334391 5:16885963-16885985 TACTCTGTTTGAGTACTCTATGG - Intronic
990340767 5:54820800-54820822 GAAGTTGTTAGAATAATCTAAGG + Intergenic
990811633 5:59731507-59731529 AACAATGGTTGAATCATCTAAGG - Intronic
993617276 5:90129045-90129067 GAGGCTGTTACAATAATCTAAGG + Intergenic
994391523 5:99197695-99197717 GATACTGTTTGTAAAATCCAGGG - Intergenic
996044854 5:118860423-118860445 TGGACTGTTTGAATAAACTATGG - Intronic
998282690 5:140827839-140827861 GATACTGTTTTAAAAATATATGG + Intronic
998826524 5:146107173-146107195 GAGACTGGTTGAATAAACTAAGG + Intergenic
999830316 5:155312792-155312814 GACAGTGTTAGCATAATCCAAGG + Intergenic
1000866660 5:166522671-166522693 GACACTGTGTGACTAGTCTTGGG + Intergenic
1001463347 5:171938769-171938791 GACACTGGCTGAATAAACTATGG + Intronic
1003294164 6:4809313-4809335 GAGAGTGGTTGAATAAACTATGG - Intronic
1004439831 6:15639135-15639157 GACACTGGTGGAATAATTGATGG + Intronic
1004461320 6:15839577-15839599 GTCACTGGTTGAATAAACTAAGG - Intergenic
1004948476 6:20641719-20641741 GACACTGGTTAAATAAATTACGG - Intronic
1007799749 6:44382018-44382040 GACACTGGTGGAACTATCTAGGG + Intergenic
1007878346 6:45133010-45133032 GACACTACTTGAATAATAAAGGG + Intronic
1008076063 6:47147351-47147373 AACACTGTTTGAACATTCAAAGG - Intergenic
1009763109 6:68034627-68034649 GGCAATGTTTGAATTTTCTATGG - Intergenic
1009955009 6:70442897-70442919 GGGACTGGTTGAATAAACTATGG - Intronic
1010099540 6:72088133-72088155 GACACTTTATGAAAAATTTATGG - Intronic
1010259642 6:73800325-73800347 GAGACTGATTGAATAAACTATGG - Intronic
1010996705 6:82541638-82541660 GAAAGTGTTTGAATAAACCATGG + Intergenic
1013992432 6:116269537-116269559 GATACCATTTGAATAATCTGAGG + Intronic
1014822204 6:126003035-126003057 GAGATTGTTTGAATAAATTACGG - Intronic
1017271959 6:152517597-152517619 GAGAGTGGTTGAATAAACTATGG + Intronic
1017281727 6:152633112-152633134 AAAACTGTTTTAATAATCTTGGG - Intronic
1017397238 6:154016213-154016235 GGCACTGGTTGAATAAAGTATGG + Intronic
1020415319 7:7939182-7939204 GAGACTGTTTAAATAAATTAAGG + Intronic
1021078078 7:16329496-16329518 CACACTCTTTGGATAATCAAAGG - Intronic
1022780157 7:33573534-33573556 GAGAGTGGTTGAATAAACTATGG - Intronic
1023955022 7:44878415-44878437 TAAACTGTTAGAATCATCTATGG + Exonic
1024029586 7:45447216-45447238 GAAATTGGTTGAATAAACTATGG - Intergenic
1024296591 7:47848291-47848313 GAGACTGGCTGAATAAACTACGG + Intronic
1025293635 7:57756057-57756079 AACACTCTTTGTAGAATCTAAGG - Intergenic
1025321947 7:58104129-58104151 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025475089 7:60909456-60909478 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025487809 7:61073533-61073555 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025511911 7:61580438-61580460 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025556469 7:62315510-62315532 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025563460 7:62400791-62400813 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025566176 7:62436891-62436913 GAAACTTTTAGAATAATCTAAGG - Intergenic
1027679337 7:81200190-81200212 GAGACTATTTCAATAATCCAAGG - Intergenic
1029946050 7:104534092-104534114 GAAGCTGTTTGAATAATGCAGGG - Intronic
1030677676 7:112401298-112401320 GACAGTGGTTGAATAATTCATGG + Intergenic
1030727887 7:112947736-112947758 GACACTGATTAAATAAATTATGG + Intergenic
1038013683 8:23495331-23495353 GACATTGGTTGAATAAGATATGG - Intergenic
1038138730 8:24819596-24819618 GAAACTGTTTGTATAATGTGGGG - Intergenic
1042955292 8:74243755-74243777 GAGATTTTTTGAATAATGTATGG - Intronic
1043873001 8:85455733-85455755 GACGCTTTTTGAATGATGTAAGG + Intergenic
1046180831 8:110645230-110645252 GAAACTGTTTGAAATATCTTTGG - Intergenic
1046283827 8:112069983-112070005 GAGGCTGTTTGAAAGATCTATGG + Intergenic
1047179025 8:122569542-122569564 GACGCTGTTCTCATAATCTACGG + Intergenic
1047821951 8:128530640-128530662 GACAGTGTTGGAATAATTGAGGG - Intergenic
1048672537 8:136738999-136739021 GACATTGTTTGAATAAACCTTGG + Intergenic
1050959553 9:11710365-11710387 GACACTGCTTGATCAAACTAAGG - Intergenic
1051861546 9:21630694-21630716 GACACTGTTTCAAAAAACTAAGG + Intergenic
1053892985 9:42714015-42714037 TATACTGTTTAAATAATATATGG + Intergenic
1053946676 9:43316525-43316547 GAATCTTTTAGAATAATCTAAGG - Intergenic
1055184042 9:73428539-73428561 AGGACTGTTTGAATAAACTATGG + Intergenic
1058091027 9:100805702-100805724 GACATGGCTTGAATAATCTTTGG + Intergenic
1061775897 9:132963823-132963845 GGGACTGATTGAATAAACTATGG + Intronic
1203589806 Un_KI270747v1:45083-45105 GAATCTTTTAGAATAATCTAAGG - Intergenic
1185754740 X:2644417-2644439 GACATTTTTTGAATGATCTATGG - Intergenic
1186988477 X:15041634-15041656 GAGACTGATTGAATAGACTAAGG - Intergenic
1187035649 X:15536807-15536829 GACAATGTTTTACCAATCTAAGG + Intronic
1189941426 X:46126685-46126707 AACACTGTTTAAATATGCTATGG - Intergenic
1191239620 X:58174093-58174115 AACACTCTTTGTAGAATCTAAGG + Intergenic
1194416915 X:93625252-93625274 GACATTGGTTGAGTAATCTCAGG + Intergenic
1195236229 X:102901329-102901351 GGAATTGATTGAATAATCTAAGG - Intergenic
1195772862 X:108370890-108370912 AACACTCTTTGAATAAACGATGG + Intronic
1197042474 X:121955855-121955877 GACAATGTTTAAATAAAATATGG + Intergenic
1199062753 X:143377858-143377880 AAAACAGTTTTAATAATCTATGG + Intergenic
1199063107 X:143382553-143382575 GAAACTGTTTTAAAAATTTAGGG - Intergenic
1199701455 X:150379906-150379928 GAGGTTGGTTGAATAATCTATGG - Intronic
1202053220 Y:20802649-20802671 GAAACTGATTGCATCATCTATGG - Intergenic