ID: 1101361298

View in Genome Browser
Species Human (GRCh38)
Location 12:104030041-104030063
Sequence TTGAGCAGGAACAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 2, 2: 6, 3: 46, 4: 364}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101361291_1101361298 26 Left 1101361291 12:104029992-104030014 CCTAAAATGCATATGGAACCGCA 0: 1
1: 7
2: 251
3: 1649
4: 2676
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364
1101361296_1101361298 -4 Left 1101361296 12:104030022-104030044 CCAAATAACTGAAGCAATTTTGA 0: 1
1: 1
2: 15
3: 136
4: 720
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364
1101361293_1101361298 -1 Left 1101361293 12:104030019-104030041 CCCCCAAATAACTGAAGCAATTT 0: 1
1: 0
2: 2
3: 48
4: 339
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364
1101361294_1101361298 -2 Left 1101361294 12:104030020-104030042 CCCCAAATAACTGAAGCAATTTT 0: 1
1: 3
2: 15
3: 121
4: 823
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364
1101361292_1101361298 8 Left 1101361292 12:104030010-104030032 CCGCAAAAGCCCCCAAATAACTG 0: 1
1: 0
2: 7
3: 83
4: 470
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364
1101361295_1101361298 -3 Left 1101361295 12:104030021-104030043 CCCAAATAACTGAAGCAATTTTG 0: 1
1: 1
2: 14
3: 129
4: 898
Right 1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG 0: 1
1: 2
2: 6
3: 46
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101361298 Original CRISPR TTGAGCAGGAACAAAACTGA AGG Intronic
904078698 1:27858560-27858582 TCGAGAAGGAAAAAAACTCAGGG - Intergenic
905236672 1:36554751-36554773 TTGAGCACACACAAAACAGAGGG - Intergenic
905249290 1:36637799-36637821 TGGTGCAGGGAGAAAACTGATGG - Intergenic
905489781 1:38334327-38334349 TTTAGAAGGGACAAAACAGAAGG - Intergenic
906089264 1:43164550-43164572 GTGAGGACGAACAGAACTGAAGG + Intronic
906800534 1:48733250-48733272 TAGAGCAGGAGCATAACTGAAGG + Intronic
908724113 1:67156871-67156893 TTGAGCAGGAACTGAGCTGCAGG - Intronic
910325719 1:86004421-86004443 TTGGGCAGGATTAAAACTAATGG - Intronic
910625749 1:89304610-89304632 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
911228154 1:95330902-95330924 TTGAGAAGGAAAAAAAGAGAGGG - Intergenic
912148735 1:106829319-106829341 ATGAGCAAGAACAAAGCTGAAGG + Intergenic
912395065 1:109336013-109336035 TTAAAGAAGAACAAAACTGAGGG - Intronic
912427027 1:109602998-109603020 AGGAGCACGAACATAACTGAAGG - Exonic
912578541 1:110698829-110698851 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
913066716 1:115262467-115262489 TTGAGCAGGAACAGAAAGAACGG + Intergenic
914892437 1:151638219-151638241 TAGAGCAGGAAAAAAGTTGATGG + Intronic
915440129 1:155940766-155940788 AGGAGCAGGAACAGAACTGAGGG + Intergenic
916978174 1:170104325-170104347 CTGGGCAAGAACAAATCTGAAGG - Intergenic
917640485 1:176978999-176979021 GTGAACAGAAGCAAAACTGATGG + Intronic
917676834 1:177326985-177327007 TTGATCAGAAAGAAATCTGAAGG + Intergenic
917708861 1:177663668-177663690 TTAAGCAGAAAAAAAACTGTAGG + Intergenic
918229974 1:182519646-182519668 TGGAGCAGGAAAAATACTTAAGG - Intronic
918609260 1:186467952-186467974 TTTAGAAAGAACAAAACTGTAGG + Intergenic
918669919 1:187202177-187202199 TAGAGCATGAACATGACTGATGG - Intergenic
918692063 1:187493555-187493577 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
918774867 1:188614317-188614339 CTGAGCAAGAACACAGCTGAAGG + Intergenic
918926945 1:190799254-190799276 GTGAGCAGGAACAATACATATGG - Intergenic
919133953 1:193485483-193485505 TTGAGCAAGAACAAAGCTATAGG + Intergenic
920004715 1:202824569-202824591 TGGATCAGGAACTAAACTCAGGG + Intronic
921517338 1:216111858-216111880 TTGAGTAGGAATGAAGCTGAAGG - Intronic
921560211 1:216648558-216648580 TCTAGCAGGAACAATCCTGAAGG - Intronic
922409532 1:225358160-225358182 CAGAGCAGGAAGAAAACCGAGGG + Intronic
923244321 1:232117438-232117460 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
923949933 1:238938411-238938433 TTAAGCAGTAACAGAAATGAAGG - Intergenic
924402569 1:243702272-243702294 TTGAGTGGGAAAGAAACTGAAGG - Intronic
1063200741 10:3783910-3783932 TTGAGGAGGAAAAAAACAGGAGG + Intronic
1063397659 10:5706279-5706301 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1064573083 10:16715742-16715764 TTGAGAAAGAACAAAACTGAAGG - Intronic
1065714911 10:28556994-28557016 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1066041143 10:31548931-31548953 AAGAGCAGGAACAAAAGTCAGGG - Intergenic
1067925855 10:50507275-50507297 TTGAGCAAAAGCAAAACAGAAGG + Intronic
1067965989 10:50913255-50913277 TAGAGCAGGCACAAGATTGAGGG - Intergenic
1068815799 10:61310652-61310674 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1069203149 10:65648182-65648204 TGGAGCAACAACAAAACAGATGG + Intergenic
1071232056 10:83599822-83599844 TTGAGCAGGAATAAGAACGAAGG + Intergenic
1071582284 10:86783287-86783309 TTGATTAAGAACAAAACTGTAGG - Intronic
1072021366 10:91406524-91406546 TAGAGCAGGTAAGAAACTGAAGG + Intergenic
1072210968 10:93246814-93246836 TTGAGTAGGCACATACCTGAAGG - Intergenic
1072359623 10:94647059-94647081 TGGACCAGGAACACAGCTGAAGG + Intergenic
1072848329 10:98857902-98857924 TTGAGTAGGAAAAAATGTGAGGG + Intronic
1072878395 10:99199716-99199738 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1073921806 10:108467226-108467248 ATGAGAAGGAAGAAAACTGAGGG - Intergenic
1074547094 10:114409474-114409496 TTTTCCAAGAACAAAACTGAAGG + Intergenic
1074641639 10:115390621-115390643 ATGAGCAAGAATAAAACTGAAGG - Intronic
1076244769 10:128938327-128938349 CTGAGGAGGAACAGAACTCAGGG - Intergenic
1076508552 10:130995396-130995418 TTTAGCAGGAAGGAAAATGATGG - Intergenic
1076800313 10:132819443-132819465 CTGAGCAAGAACAAAGCTGGTGG + Intronic
1077925254 11:6675763-6675785 TTGATAAAGAACAAAACTGGAGG + Intergenic
1078960304 11:16259483-16259505 TTGAGTAAGAACAAAATTAAAGG + Intronic
1079586882 11:22136661-22136683 TTGAGAAAGAACAAAGCTGGAGG + Intergenic
1080447448 11:32350763-32350785 TTGACTAGGAACACCACTGAAGG - Intergenic
1080497769 11:32837434-32837456 TTGATAAGGTACAAAACAGATGG + Intronic
1081035489 11:38139417-38139439 TTGAGCAAGAGCAAAGCTGGAGG + Intergenic
1081374892 11:42346101-42346123 TTGGGCATTAAGAAAACTGAAGG - Intergenic
1081478889 11:43465080-43465102 TTAAGAAGGGACAAAACTAAGGG + Intronic
1081940858 11:46940328-46940350 TTGCAAAGGAACAAAACTGCAGG - Intronic
1082006867 11:47424203-47424225 TTGAGCTGGGCCAAATCTGAAGG - Intronic
1083133086 11:60645466-60645488 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1083828957 11:65218859-65218881 GTGCGCAGGAACAAACATGAGGG - Intergenic
1085374183 11:76043275-76043297 CTCATCAGGAACAAAAATGAGGG + Intronic
1085954462 11:81374504-81374526 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1086056895 11:82657438-82657460 TTGAGCAAGAACAAAGCTAGGGG + Intergenic
1087005257 11:93464357-93464379 CTGAACAGAAAAAAAACTGAAGG + Intergenic
1087068784 11:94054285-94054307 TTGAGAGGGACCAAAATTGAGGG + Intronic
1087679774 11:101206932-101206954 TGGAGCAAGAACAAAGTTGAAGG - Intergenic
1088455240 11:110026521-110026543 TTGAGCTGGAAGAAATCTTAAGG + Intergenic
1088959578 11:114649656-114649678 TTGAGCTGGAAGAAGACTGGAGG + Intergenic
1089260476 11:117220675-117220697 TGGAGCTGGGACAACACTGACGG + Intronic
1089650914 11:119912254-119912276 TTGAGAGGGAACAAATCTGTTGG - Intergenic
1090493047 11:127182677-127182699 ATAAGCAAGTACAAAACTGAGGG - Intergenic
1090544056 11:127743126-127743148 TTGAAAAAGAACAAAACTGGAGG - Intergenic
1090570813 11:128042817-128042839 TGGAGCAGGAACAGAACTTGGGG - Intergenic
1091849654 12:3685026-3685048 ATGAGCAGAAACAATACTCAGGG - Intronic
1092155708 12:6280361-6280383 CACAGCAGGAACAAAACAGAAGG - Intergenic
1093588421 12:20870758-20870780 TTGAGAAAGAACAAAGGTGATGG - Intronic
1094180089 12:27583353-27583375 TTGAGCAGGAAAACAACTTCCGG - Intronic
1094258101 12:28458863-28458885 TTGAAAAGGCACAAAACTGGAGG - Intronic
1096928149 12:55172653-55172675 TTCAAAAAGAACAAAACTGAAGG - Intergenic
1097367919 12:58740832-58740854 TTGAGCAAGAAGAAATCTGGAGG + Intronic
1097764521 12:63510168-63510190 TAGAGCAAGAACAAAACTGGAGG + Intergenic
1098355518 12:69609422-69609444 TTCAGCAGGCACTAAACTGCTGG + Exonic
1098413749 12:70209357-70209379 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1098944927 12:76579500-76579522 TTGAGAAAGAACAAAACTGGAGG + Intergenic
1100043472 12:90348749-90348771 TTAAGTATGAAGAAAACTGAAGG + Intergenic
1100118075 12:91333630-91333652 GTGAGCAGGAACATCACTAAGGG + Intergenic
1100243639 12:92734762-92734784 TGGAACTGGAGCAAAACTGAAGG - Intronic
1100733571 12:97501047-97501069 TGGACCAGTAACAAAACTGCTGG + Intergenic
1101017351 12:100515513-100515535 ATGGGCACAAACAAAACTGAGGG + Intronic
1101102304 12:101406815-101406837 GAGAGGCGGAACAAAACTGAAGG + Intronic
1101201305 12:102439220-102439242 TTGAGCATGAAAAAAAATGCAGG - Intronic
1101237655 12:102805616-102805638 TTGAGCAGAAACTTAAATGAAGG - Intergenic
1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG + Intronic
1105482672 13:20793261-20793283 TTCAGAAGAAACAAAAATGAAGG - Intronic
1107031661 13:35860293-35860315 TTGAGAAGGAAAAAAAATGCAGG + Intronic
1108103237 13:46980700-46980722 TTGAGAAAGAACAAAACTAGAGG + Intergenic
1108868783 13:54956408-54956430 TTGATAAAGAACAAAGCTGAAGG - Intergenic
1108941920 13:55965920-55965942 TTGAGCAAAAACAAAGTTGAAGG + Intergenic
1109329824 13:60915271-60915293 TTGAGCAGTGTCAAAAATGAGGG + Intergenic
1109843083 13:67946979-67947001 TTGAGGGGGGATAAAACTGAGGG - Intergenic
1109927573 13:69165982-69166004 AATAGCAGAAACAAAACTGATGG + Intergenic
1110188444 13:72702059-72702081 TTCAGCAGGAACAAAGATCACGG + Intergenic
1111189233 13:84787689-84787711 TTGAGCAGTTACAAATCTGGGGG + Intergenic
1111381620 13:87461220-87461242 TTAAGGAGAAGCAAAACTGAAGG - Intergenic
1111891938 13:94093541-94093563 TTGAGCAAGAACAAAGCTGGAGG - Intronic
1112667572 13:101594134-101594156 TTCAGCAAGAACAAAGCTGAAGG + Intronic
1112860610 13:103825704-103825726 CTGAGCAAGAACAAAGCTGGAGG - Intergenic
1114811448 14:25905184-25905206 TTGAACAGGAAAAAAAATGAAGG + Intergenic
1114999755 14:28407627-28407649 CTGAGCAGGAAAGAAAATGAGGG - Intergenic
1115005866 14:28483854-28483876 TTAAGCAGGAAAAAGAATGAGGG - Intergenic
1115064070 14:29233762-29233784 TTGAGCAGTACCAAAATTCATGG + Intergenic
1115101546 14:29707261-29707283 ATGAGAGGGAACAAAACTGGAGG + Intronic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1116921340 14:50579418-50579440 TTGAAGAGGAACAAAATTGGGGG - Intronic
1117237529 14:53794384-53794406 CAGAGCAGGAATCAAACTGATGG + Intergenic
1117782556 14:59249090-59249112 TTGAAGAAGTACAAAACTGAGGG - Intronic
1118363110 14:65072305-65072327 TTGAGAAGGAAGAAAGCTGAGGG - Intronic
1118587066 14:67363841-67363863 TTGAGCAGTGACAACAGTGAAGG + Intronic
1119548548 14:75491523-75491545 TTCATCAGTGACAAAACTGATGG - Intergenic
1119609202 14:76047447-76047469 TTAAGCAGGAAGAAAACAAATGG + Intronic
1119692365 14:76685312-76685334 TTGAGCAGAAACAAAGCTGGAGG - Intergenic
1121373687 14:93385116-93385138 CTAAGCAAAAACAAAACTGAAGG - Intronic
1122026481 14:98881210-98881232 GAGAGCAGGAACAAGAGTGAGGG - Intergenic
1124036188 15:26055287-26055309 TTCAGCAAGAAGAAAACGGATGG + Intergenic
1125425658 15:39546434-39546456 TTGAGAAAGAACAAAGCTGGAGG + Intergenic
1125568643 15:40696985-40697007 TTTAGCACAAACATAACTGAGGG - Intronic
1125815468 15:42580478-42580500 TTGATTTGGAACAAAAATGAGGG + Intronic
1126204618 15:46031292-46031314 TTGAGCAGAAACAAAGCAGTAGG - Intergenic
1126394985 15:48205412-48205434 TTAAGCAGGAACCAAACTGTGGG - Intronic
1127036008 15:54918300-54918322 TAGAGAAGGTACAAAATTGAAGG - Intergenic
1127229111 15:56969430-56969452 TTGAGAATGAAGAAAACTGGAGG + Intronic
1127442478 15:59023779-59023801 TTCAGGGGGAAAAAAACTGATGG - Intronic
1131480809 15:92779998-92780020 TGGAGCAGGAACAAATCACAAGG + Intronic
1131592322 15:93762903-93762925 CTGAGCAAGAACAAATGTGATGG - Intergenic
1132241903 15:100264614-100264636 TTCAGGAAGAACAAAACTGTAGG + Intronic
1134235863 16:12465642-12465664 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1136142636 16:28297360-28297382 CTGAACAGAAACGAAACTGATGG + Intronic
1136269608 16:29140903-29140925 CTGAGCAGGAACAGGACAGAAGG + Intergenic
1137414806 16:48265660-48265682 TTGAGCAAGAACAAACGTGGAGG - Intronic
1138376589 16:56568494-56568516 TGGAGCAGGAAGAGGACTGAGGG + Intronic
1139457578 16:67094258-67094280 AAGAGTAGGAACAAAAATGAGGG - Intronic
1140953801 16:79844240-79844262 TTGATTAGGAAAGAAACTGATGG + Intergenic
1141656576 16:85419901-85419923 CTGGGCTGGAACAGAACTGAGGG + Intergenic
1142073286 16:88103160-88103182 TAGAGCAGGAACAGGACAGATGG + Intronic
1144793831 17:17877762-17877784 TGGAGTTGGAACAAAACAGAGGG + Intronic
1145184021 17:20778871-20778893 TTGAGAAAGAACAAAGTTGAAGG - Intergenic
1145283375 17:21485184-21485206 TTCAGCAGGAACAGTACAGAGGG - Intergenic
1145394111 17:22480646-22480668 TTCAGCAGGAACACTACAGAGGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148745578 17:49916205-49916227 AGGAGCAGGGACAGAACTGAGGG - Intergenic
1148931714 17:51132317-51132339 TTGAGCAGCAAGCAAAATGAGGG + Intergenic
1149130306 17:53292525-53292547 TTGATCACCAACAAAGCTGATGG + Intergenic
1149594047 17:57853068-57853090 GTGAGCAGCAACAAGCCTGATGG + Intergenic
1150037908 17:61824364-61824386 TTGAAAAAGAACAAAACTGGAGG + Intronic
1150201722 17:63363788-63363810 CTAAGCAAGAACAAAACTGGAGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151604242 17:75126151-75126173 CTGAGCAGGAACCAAAGGGAGGG + Intronic
1152147139 17:78575175-78575197 CGGAGCAGGAACAAAACAGTTGG + Intronic
1155743843 18:29325030-29325052 ATGATGAGGAACAAAAATGAGGG - Intergenic
1156075182 18:33266974-33266996 TTTGGCATGTACAAAACTGACGG - Exonic
1156489568 18:37488140-37488162 TTGAGCAGAAACCAGAGTGAAGG - Intronic
1158423409 18:57315956-57315978 TTGATCAAGAACAAAACTGAAGG - Intergenic
1158897659 18:61930137-61930159 ATGAGCAGCAAAAAAGCTGATGG + Intergenic
1159432364 18:68369644-68369666 TTGAGAAAAAACAAAGCTGAGGG + Intergenic
1164665133 19:30025658-30025680 TTGAAAAAGAACAAAATTGAAGG - Intergenic
1164869516 19:31631583-31631605 TGGAGCATGAACAAAGCTCATGG + Intergenic
1165142436 19:33708664-33708686 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1168340516 19:55620757-55620779 TTTAATAGGAACAGAACTGAAGG + Exonic
925840371 2:7986268-7986290 GTGTGGAGGAAGAAAACTGATGG + Intergenic
926450170 2:12993925-12993947 GACAGCAGGGACAAAACTGAAGG - Intergenic
926554360 2:14340403-14340425 TTGAGCAAGAACAAAACTAGAGG + Intergenic
926576279 2:14585735-14585757 TTAAGAAAGAACAAAAGTGAGGG - Intergenic
928283395 2:29968077-29968099 TTGACCAGAGACAAAACAGAAGG + Intergenic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
930586892 2:53277790-53277812 TTGAGCAGGAGCAAGATTGTGGG + Intergenic
931174214 2:59836661-59836683 TTGAGCAGGTACAGGACTCAAGG - Intergenic
932381268 2:71285682-71285704 TTGAGAAAGAACAAAGCTGTTGG + Intronic
933045091 2:77525608-77525630 TTGAGCAGGAACAAAAGAAAGGG + Intronic
933318989 2:80748266-80748288 TTGAACAGTAATAAAACAGATGG + Intergenic
934168272 2:89316884-89316906 CTCAGAAGAAACAAAACTGAAGG - Intergenic
934199015 2:89865698-89865720 CTCAGAAGAAACAAAACTGAAGG + Intergenic
935065523 2:99643910-99643932 TTGAGAAAGGGCAAAACTGAGGG + Intronic
935448161 2:103178774-103178796 TTGTGAAGGAAAAAAAGTGAAGG - Intergenic
936392116 2:112084810-112084832 TTGGAGAGGAACAAAACTGCAGG - Intronic
937135844 2:119551690-119551712 TTGAAAAAGAACAAAACTGGAGG - Intronic
937241363 2:120464641-120464663 CTCGGCAGGAAGAAAACTGAAGG - Intergenic
937608407 2:123829228-123829250 TTGCACAGGAACAAAAATGAGGG + Intergenic
937814100 2:126231987-126232009 TTGAGCAAGAAAGAAACGGAGGG - Intergenic
937833801 2:126451254-126451276 TTGAACAAGAACAAAGCTGGAGG - Intergenic
938797526 2:134730882-134730904 TGGAGCAGGAGCAAAAGAGAGGG - Intergenic
938977821 2:136495972-136495994 GGGAGCAGGAACAAAAATTAAGG + Intergenic
939130305 2:138227768-138227790 AATAGCAGGAACAAAATTGATGG - Intergenic
939678517 2:145102027-145102049 TTGAAAAGGAACAAAGTTGAGGG + Intergenic
941389768 2:164897379-164897401 TTGAACAGGGACAACTCTGATGG + Intronic
942024398 2:171897953-171897975 TTGAGAAGGAACAAAGTTGGAGG + Intronic
942203075 2:173591975-173591997 TTGAGCACGAAAATAAATGATGG - Intergenic
944432546 2:199649373-199649395 TCGAGAAGGAATAAAACTGGAGG - Intergenic
945112444 2:206373711-206373733 TCGAGCAAGAACAAAACTCCAGG - Intergenic
945632830 2:212304130-212304152 TTCAGCAGAATCAAAACTAAGGG + Intronic
945868131 2:215199548-215199570 GTAAGCAGGAACAAAACAGGAGG - Intergenic
946021113 2:216640754-216640776 CTGTCCAGGAACAAAACTGCTGG - Intronic
947048503 2:226016518-226016540 TTGAGCAGAAACAGGAATGAAGG - Intergenic
947508984 2:230733459-230733481 TTGAGAAGGAAGAAAAGTCAAGG - Intronic
947609304 2:231513618-231513640 TTGAGCAGGAAAAAAGGTCAAGG - Intergenic
947939869 2:234043407-234043429 TTCAGAAAGAACAAAACTGGAGG + Intergenic
948270995 2:236673085-236673107 TTGATCAGGTACACAACTGTTGG + Intergenic
1169310065 20:4529769-4529791 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1169938709 20:10913497-10913519 TTGACAAGGAACAAAATTGCAGG + Intergenic
1170014001 20:11760191-11760213 CTGAGAAAGAACAAAGCTGAAGG - Intergenic
1170748945 20:19127149-19127171 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1171516048 20:25737238-25737260 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1171726817 20:28630839-28630861 TTGAGCAAGAACAAAGCTACAGG + Intergenic
1171751444 20:29053773-29053795 TTGAGCAAGAACAAAGCTACAGG - Intergenic
1171790886 20:29524104-29524126 TTGAGCAAGAACAAAGCTACAGG + Intergenic
1171794369 20:29554898-29554920 GTGATCAGGAACAAAGCTCAGGG - Intergenic
1172761071 20:37322607-37322629 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1173082956 20:39887119-39887141 TGAAGAAGCAACAAAACTGAGGG - Intergenic
1173779049 20:45738030-45738052 TGGAGCAGGAACCAAATTGTTGG - Intergenic
1174238446 20:49113303-49113325 TTGAGCAGTAACTAAAATAAGGG - Intergenic
1174530167 20:51205701-51205723 TTAAGCAGGAAGAGAACTAAAGG + Intergenic
1175548126 20:59793224-59793246 TTGAGCAAGAACGAAGCTGGAGG - Intronic
1176313335 21:5217171-5217193 TTGAGCAAGAACAAAGCTACAGG + Intergenic
1176517922 21:7800080-7800102 TTGAACAGGCACAGAACTGGAGG + Intergenic
1177444901 21:21181771-21181793 TTGTGCAGGAAAAAAAACGAAGG - Intronic
1178212214 21:30548715-30548737 CTGAGCAAGAACAAAGCTGGAGG - Intronic
1178651950 21:34430093-34430115 TTGAACAGGCACAGAACTGGAGG + Intergenic
1178847811 21:36187956-36187978 TTGAGTAGGAGTAGAACTGAAGG - Intronic
1178997020 21:37411827-37411849 ATGTGCAGGAAAAAAACTGGTGG - Intronic
1181918652 22:26301701-26301723 TTGAGTAGGAAATAGACTGAGGG + Intronic
1183052980 22:35279926-35279948 TTGATGAAGAACAAAGCTGAAGG - Intronic
1183695563 22:39419967-39419989 TTGAGCTGGGCCAAAGCTGAGGG + Intronic
1184806751 22:46799785-46799807 TTTGGCAGGAACATCACTGAAGG + Intronic
949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG + Intergenic
949922362 3:9013213-9013235 TCAAGCAGTAAGAAAACTGAAGG + Intronic
951021514 3:17785892-17785914 TTGACCAAGAACAAAGCTGGAGG - Intronic
951636232 3:24780904-24780926 TAAAGTAGGAAAAAAACTGAAGG - Intergenic
951711582 3:25589490-25589512 TCGAGCAGGAATAGAAATGAAGG + Intronic
951716735 3:25656892-25656914 TTAAGCTAGAATAAAACTGAAGG + Intronic
954631340 3:52049371-52049393 TGGAGAAGGAACAAAACTGGAGG + Exonic
955035672 3:55264804-55264826 TAGAGCAGGAACATGGCTGATGG + Intergenic
955503869 3:59611882-59611904 ATGATCAGGAAAAAAACTGTGGG - Intergenic
957140212 3:76345212-76345234 TGCAGCAGGAACAAAACTCCTGG + Intronic
957420542 3:79963542-79963564 TTGAGCAACAACAAACCTGGAGG + Intergenic
958424659 3:93966440-93966462 TTGAGAGGAAACATAACTGATGG - Intronic
958738755 3:98042456-98042478 CTGAGCAAGAACAAAGCTGGAGG + Intergenic
959010165 3:101066046-101066068 TTGAACAGTAACAAAACCAAAGG - Intergenic
959266263 3:104142820-104142842 TTAAAAAGGAACAAAACTGCTGG - Intergenic
959670298 3:108969963-108969985 TTGTGCAGATACAAAACTCAAGG + Intronic
960207735 3:114923274-114923296 TTGAAAAGGAACAAAGCTGGAGG + Intronic
960902675 3:122567484-122567506 TTGAGAAGGAACAAAACATTAGG + Intronic
961459014 3:127038576-127038598 TTGTGCCGGAAAAAAGCTGAAGG - Intergenic
961471982 3:127121083-127121105 TTGATCAAGAACATGACTGAGGG - Intergenic
962111847 3:132459248-132459270 ATGAGCAGAAACAAAAAGGAAGG + Intronic
963375562 3:144459093-144459115 TTGATCAGGAAAAAAACGAAAGG - Intergenic
963462610 3:145636456-145636478 TTGATCAGGGACAACTCTGAAGG + Intergenic
963516386 3:146314981-146315003 TTTAGCAAGAAAACAACTGAAGG - Intergenic
964141730 3:153410033-153410055 TTAATCTGGAATAAAACTGAGGG - Intergenic
965394038 3:168140315-168140337 TTGAACAGGATCAAATCTGGAGG + Intergenic
965485606 3:169274472-169274494 TTGAGCAGGAAGAAATCAAAAGG + Intronic
965890565 3:173508701-173508723 ATGAGCAGGACAAAAACTCAAGG - Intronic
968406932 4:348756-348778 TTGAGAAAGAACAAAGCTGGGGG - Intronic
969229714 4:5821545-5821567 TTCAGCATGAACACAACTGTGGG + Exonic
970733658 4:19139946-19139968 TTGAGCAGGAAGAAAAAAGCTGG + Intergenic
972399747 4:38689585-38689607 TATAGCAGGAACAAATCTGTGGG - Intronic
973224674 4:47769573-47769595 TTGAGCGAAAAGAAAACTGAAGG + Intronic
975408993 4:74025963-74025985 TTGAACAGGAACAACACTGGAGG - Intergenic
975470980 4:74767623-74767645 TTGAGCAAGAACAAAGTTGGAGG + Intronic
975833431 4:78394645-78394667 TTGAGCAAGAACAAAGCTGGTGG - Intronic
975896283 4:79095349-79095371 TTGAACAAGAACAAAGCTGGGGG - Intergenic
976030939 4:80752191-80752213 TGGAGAAGGAAGAAAAGTGAAGG - Intronic
977829632 4:101575652-101575674 TTGAGGAGGAAACAAACAGATGG - Intronic
977902121 4:102434912-102434934 TTGAGGAAGAACAAAGCTGGAGG + Intergenic
978126472 4:105141900-105141922 ATAAGCAGGAAAAAAACAGAAGG + Intergenic
978568127 4:110106464-110106486 TTCCCCAGGAACAGAACTGAGGG + Intronic
979430663 4:120625621-120625643 TTGAGCAAGAACAAATCTGGAGG + Intergenic
980311746 4:131140133-131140155 TTCAGCAAGAAAAAAACAGAAGG + Intergenic
980404327 4:132337122-132337144 TTGAGCTGGAGCAAGACTGAGGG + Intergenic
980919488 4:139068626-139068648 ATGAGGAGGAACAAAAGGGAAGG - Intronic
981912325 4:149995751-149995773 TAGAGCAGGAGCAAAAGAGAGGG - Intergenic
982314591 4:154019325-154019347 TTGAGCAGAAACAAGAATCACGG + Intergenic
982342633 4:154318900-154318922 TTGAGAAAGAACAAAGCTGGAGG + Intronic
983043764 4:162960364-162960386 TTCAGCAGGAACAAGAATGGAGG - Intergenic
983201929 4:164870235-164870257 TTGTTCATGAACAAAAGTGAAGG - Intergenic
983665252 4:170174350-170174372 TTGGGCAAGAACAAAGCTGGAGG - Intergenic
983950947 4:173640794-173640816 TTGAGAAAGAACAAAGCTGGTGG + Intergenic
985059577 4:186063471-186063493 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
985379467 4:189377142-189377164 CTGAGCAGAAACACAACAGATGG + Intergenic
985433829 4:189908130-189908152 TTGAGCAAGAACAAAGCTACAGG - Intergenic
985970990 5:3378140-3378162 TTGAGTAGGAAAATAACAGAGGG - Intergenic
986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG + Intergenic
986816630 5:11419805-11419827 TTGAGCAGGTTCATAACAGATGG - Intronic
990231325 5:53716059-53716081 CTGAGCAGGCACCAAACTGCAGG + Intergenic
990662769 5:58036474-58036496 TTGAAGAGGAACAAAATTGGAGG + Intergenic
992316154 5:75557268-75557290 TAGAAGAAGAACAAAACTGAAGG - Intronic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
994786752 5:104175363-104175385 TTGATCAGGAAAAAGACAGAAGG + Intergenic
994932651 5:106208507-106208529 TTGTTCAGGAAGAAAAATGAAGG - Intergenic
995130737 5:108627849-108627871 CAGGGCAGGAACAACACTGAAGG - Intergenic
995577664 5:113558319-113558341 ATTGGCAGGAACAAAAATGATGG + Intronic
996684697 5:126267498-126267520 TGAAGCAGGAGCAAAACGGAAGG + Intergenic
996969454 5:129346057-129346079 CTGAGCAGAAACAGAATTGAGGG + Intergenic
1000246836 5:159455248-159455270 TTGAGAAGAAAAAAAAATGATGG + Intergenic
1000557642 5:162746008-162746030 TTGAACAAGAGCAAAGCTGAAGG + Intergenic
1001433365 5:171680803-171680825 TTGGGGAGGAACAAAAGTCAAGG - Intergenic
1001552534 5:172614127-172614149 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1002920360 6:1565279-1565301 AGGAGCAGCAATAAAACTGATGG + Intergenic
1005089317 6:22040028-22040050 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
1005235087 6:23751205-23751227 CTGAGCAAGAACAAAGCTGGAGG - Intergenic
1005251177 6:23948198-23948220 TTGAGCAAGAACAAAGCTAGAGG + Intergenic
1005530137 6:26695927-26695949 TTGAGCAAAAACAAAACTGGAGG + Intergenic
1005540659 6:26805720-26805742 TTGAGCAAAAACAAAACTGGAGG - Intergenic
1005717848 6:28568732-28568754 TTGAGAAAGAACCAAAGTGAGGG - Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006481891 6:34301807-34301829 TTGAAGAGGAACAAGAGTGATGG - Intronic
1008334942 6:50291548-50291570 TTGACTAAGTACAAAACTGAAGG + Intergenic
1008482764 6:52003788-52003810 TTGAAAAGGAACAAAATTGGAGG - Intronic
1008495628 6:52130745-52130767 TTAACCTTGAACAAAACTGAAGG + Intergenic
1009011472 6:57847815-57847837 TTGAGCAAAAACAAAACTGGAGG - Intergenic
1010373761 6:75142011-75142033 TGGAGCAGGAGCACAACTCACGG + Exonic
1010803672 6:80209395-80209417 TTGAAGAAGAACAAAACTGGAGG + Intronic
1011152726 6:84291607-84291629 TTGAGAAGGAAGAAGACTGATGG - Intergenic
1013602719 6:111720006-111720028 TAAAGAAGCAACAAAACTGACGG - Exonic
1013830057 6:114261152-114261174 TTGGGTAGGAAAAAAAATGAGGG + Intronic
1013857776 6:114594923-114594945 TGGAGCAAGAATAAAAATGAAGG - Intergenic
1014308039 6:119766608-119766630 TTGTGGAGGTAGAAAACTGAAGG - Intergenic
1014580849 6:123135718-123135740 TTGAGCAGAGACCAAAATGAAGG + Intergenic
1015197209 6:130536972-130536994 GTGAGGAGGAACAGAATTGAGGG - Intergenic
1015405684 6:132834697-132834719 TGAAGCAGGAAAAAAACAGAAGG - Intergenic
1015534246 6:134251271-134251293 ATAAGCAGGAACAAAATTTAAGG - Intronic
1016285891 6:142472751-142472773 TTGAGAAAGGACAAAACTGGAGG + Intergenic
1017496890 6:154991373-154991395 ATGGACAGGAACAAAACTGCCGG + Intronic
1017762868 6:157584512-157584534 TGGGGCAGGAATAAATCTGATGG + Intronic
1019087712 6:169496990-169497012 TTGAAAAAGAACAAAACTGGAGG + Intronic
1020053466 7:5099488-5099510 GTGAGCAAGAACGAAGCTGAAGG - Intergenic
1020210444 7:6154456-6154478 GAGAGCAGGAGCAAGACTGAGGG + Exonic
1020597220 7:10223061-10223083 TTGAGAAAGAAAAAAACTTATGG + Intergenic
1020824018 7:13004498-13004520 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1021045985 7:15923957-15923979 TTGAGAAAGAACAAAGCTGGGGG + Intergenic
1021750301 7:23792662-23792684 TTGAAAAAGAACAAAATTGAAGG + Intronic
1022545939 7:31189102-31189124 TTGAGAAAGAAGAAAACTGCTGG - Intergenic
1022899548 7:34791750-34791772 TTGAGAAAGAACAAAGCTCAAGG + Intronic
1023407542 7:39850647-39850669 TTAAAAAGGAAGAAAACTGAAGG - Intergenic
1024351673 7:48372101-48372123 TTGAGGAAGAACAAATCAGATGG - Intronic
1024808157 7:53173617-53173639 TTGAGAAGGAATAAAGCTGGGGG - Intergenic
1025717694 7:63977629-63977651 TTGAGGAATAACAAAGCTGAGGG + Intergenic
1025799544 7:64772713-64772735 TTGAGAAAGAACAAAGCTGGGGG - Intergenic
1027516119 7:79144428-79144450 TGGAGCAGGAATAAGACAGAAGG - Intronic
1030209660 7:106983604-106983626 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1030340308 7:108371920-108371942 TTGAGAAAGAACAAAGCTGGAGG + Intronic
1030487212 7:110184685-110184707 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1032314719 7:130825166-130825188 TTGAGCAAGGACAAAACTGGAGG - Intergenic
1033327558 7:140392152-140392174 CTAAGCAGGAAGATAACTGAAGG + Intronic
1033632018 7:143167883-143167905 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1034676582 7:152896527-152896549 TTGATCAGACACAAAGCTGACGG + Intergenic
1034869429 7:154670482-154670504 TAGAGTTGGAACAAACCTGAAGG - Intronic
1035091097 7:156311443-156311465 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1035164348 7:156976225-156976247 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1036642349 8:10592308-10592330 TTAATAAGGAACAAAATTGAGGG + Intergenic
1037288224 8:17323406-17323428 ATGAACAGGAACCAAACTGAAGG + Intronic
1038368422 8:26961889-26961911 TTGAGCTGGAAAACAACTGCAGG + Intergenic
1038473442 8:27844427-27844449 TTGAGGATGAACAAAGCTGGTGG - Intergenic
1041069139 8:54109811-54109833 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1043386101 8:79749086-79749108 GTGAGCCTAAACAAAACTGAGGG + Intergenic
1044048428 8:87467368-87467390 TTGAAAAAGAACAAAACTGGAGG + Intronic
1044175535 8:89116276-89116298 TTGAGTAACAACAAAACTGAGGG + Intergenic
1045123198 8:99061109-99061131 TTGAGATGGCATAAAACTGAAGG - Intronic
1045132302 8:99166764-99166786 TTGAAAAAGAACAAAGCTGAAGG + Intronic
1046676957 8:117120169-117120191 TTGAGAAAAAACAAAAATGAAGG + Intronic
1047290135 8:123522690-123522712 ATGGGAAGGAACAAAAGTGAAGG - Intronic
1047470311 8:125164927-125164949 TTGATCATGAACAAATCTGTAGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1051229706 9:14943139-14943161 TAGAGCAGGAACAAGACGAAGGG + Intergenic
1051251723 9:15166051-15166073 CTAAGCAGCAATAAAACTGAAGG + Exonic
1051567192 9:18513931-18513953 TTGAGAGAGAACAAAGCTGAAGG - Intronic
1052183409 9:25560609-25560631 TTGATCAAGAACAAAGCTGGAGG + Intergenic
1052501597 9:29298681-29298703 TGGAGAAGGAACAAAACTGGAGG + Intergenic
1052509132 9:29391635-29391657 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1053372416 9:37574155-37574177 TTTGGCAGGGATAAAACTGAGGG - Intronic
1053722928 9:40966263-40966285 TTGAGCAAGAACAAAGCTACAGG - Intergenic
1054343040 9:63885736-63885758 TTGAGCAAGAACAAAGCTACAGG + Intergenic
1055739453 9:79369875-79369897 CTGAGCATGAACAAAATTGGAGG + Intergenic
1056851666 9:90089858-90089880 TTCAAAAGGAACAAACCTGAAGG - Intergenic
1059611836 9:115906360-115906382 TTGAGCAAGAACAAAGCTGGTGG - Intergenic
1059806073 9:117802055-117802077 TTGAACAGGAAGAGAAGTGAAGG + Intergenic
1059905077 9:118974395-118974417 TTGAGAAAAAACAAAGCTGAAGG - Intergenic
1059963075 9:119586517-119586539 CTGAGCAGCTACAGAACTGATGG - Intergenic
1060360806 9:122955108-122955130 TTGATCAAGTACAAAAGTGAGGG + Intronic
1061008891 9:127943775-127943797 GTGAGCAAGAAGGAAACTGAGGG - Intronic
1203452231 Un_GL000219v1:129721-129743 TTGAGGAAGAACAAAGCTGCAGG + Intergenic
1186042008 X:5490825-5490847 TTGAGTAGGAAAAAAAATCAAGG + Intergenic
1187791010 X:22950309-22950331 TTGAGTAGAATCATAACTGATGG - Intergenic
1188385993 X:29558969-29558991 TTGAGCAAGAACAAACTTGGAGG - Intronic
1188864287 X:35295475-35295497 TTGAGCAAGAACCAAGCTGGAGG - Intergenic
1188903204 X:35760597-35760619 TTGAGAAAGAATAAAGCTGAAGG + Intergenic
1190050017 X:47142520-47142542 TGGTGCAGGAACAAAACTCCTGG + Intronic
1191654743 X:63584625-63584647 ATGAGCAGTAACAAAAAAGAAGG + Intergenic
1193884275 X:86965047-86965069 TTAAGAAAGAACCAAACTGATGG + Intergenic
1195171810 X:102276112-102276134 CTAAGCAAGAACAAACCTGAAGG - Intergenic
1195187050 X:102410981-102411003 CTAAGCAAGAACAAACCTGAAGG + Intronic
1196217921 X:113076728-113076750 TTGAGAAAGAACAAAATTGGAGG + Intergenic
1196509980 X:116498391-116498413 ATGAGCAGGAAGAAATCTGAAGG - Intergenic
1197180891 X:123535454-123535476 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1197557956 X:127979598-127979620 TTGAGAAAGAATAAAATTGAAGG + Intergenic
1198593449 X:138210164-138210186 TTGTGAATGAATAAAACTGAAGG + Intergenic
1199567560 X:149231162-149231184 TTGAGTAAAAACATAACTGAAGG - Intergenic
1199975134 X:152890317-152890339 TTGATGATGAAGAAAACTGAGGG + Intergenic
1200037396 X:153340926-153340948 CTCAGCAGGAAGAAAACTGGAGG - Intronic
1200906989 Y:8493914-8493936 TAGACCAGGAACAAATGTGATGG + Intergenic
1201345403 Y:12978293-12978315 CTGAGAAAGAACAAAGCTGATGG + Intergenic