ID: 1101366746

View in Genome Browser
Species Human (GRCh38)
Location 12:104078916-104078938
Sequence CACCCAGATGGTAGTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101366741_1101366746 -2 Left 1101366741 12:104078895-104078917 CCCTACATAGCTGCATATGGCCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1101366746 12:104078916-104078938 CACCCAGATGGTAGTTTTATGGG 0: 1
1: 0
2: 0
3: 10
4: 193
1101366742_1101366746 -3 Left 1101366742 12:104078896-104078918 CCTACATAGCTGCATATGGCCAC 0: 1
1: 0
2: 0
3: 14
4: 70
Right 1101366746 12:104078916-104078938 CACCCAGATGGTAGTTTTATGGG 0: 1
1: 0
2: 0
3: 10
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101366746 Original CRISPR CACCCAGATGGTAGTTTTAT GGG Intronic
905981475 1:42232752-42232774 CACTCTGATGGTAGTTTCTTTGG + Intronic
906454858 1:45985652-45985674 CAGGCAGCTGGTATTTTTATTGG + Intronic
906489515 1:46257337-46257359 GACCCTGAAGGTAGTTTTAATGG - Intronic
907236400 1:53053189-53053211 TACACAGAAGCTAGTTTTATTGG + Intergenic
907879212 1:58529256-58529278 CACCCAGATGGCACTCTGATGGG + Intronic
908277572 1:62491463-62491485 AACCCAGATGGGATGTTTATTGG - Intronic
908583701 1:65545765-65545787 CACTCTGATGGTAGTTTCTTTGG + Intronic
908624162 1:66021274-66021296 CACTCTGATGGTAGTTTCTTTGG + Intronic
909770835 1:79419318-79419340 CACTCTGATGGTAGTTTCTTTGG - Intergenic
911824350 1:102462331-102462353 CACTCTGATGGTAGTTTCTTTGG + Intergenic
914229276 1:145750216-145750238 CACCCAGATAGGAATTTTAGAGG + Intronic
914922331 1:151855670-151855692 CGCCCAGCTGGAAGTTTTTTTGG + Intergenic
919240299 1:194906849-194906871 CACTCTGATGGTAGTTTCTTTGG - Intergenic
921166293 1:212509982-212510004 CACCCAGCTGCTAGTGTTCTGGG + Intergenic
922843240 1:228661862-228661884 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1065418522 10:25516328-25516350 CACTCTGATGGTAGTTTCTTTGG + Intronic
1065480463 10:26188450-26188472 CACTCTGATGGTAGTTTCTTTGG + Intronic
1065965212 10:30765326-30765348 CACCCAGATGGTCCATTTAAAGG - Intergenic
1066016528 10:31250478-31250500 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1068434987 10:56978776-56978798 CACCAAGATCCTATTTTTATAGG - Intergenic
1068477490 10:57547234-57547256 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1068609077 10:59038803-59038825 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1069781873 10:70961991-70962013 CCTCCAGATGGAAGTTCTATGGG - Intergenic
1071210672 10:83338330-83338352 CACCCTGCTGGTAGTTTATTTGG + Intergenic
1073367485 10:102955557-102955579 CACTCTGATGGTAGTTTCTTTGG - Intronic
1073777192 10:106799413-106799435 CACTCTGATGGTAGTTTCTTTGG - Intronic
1074138818 10:110652918-110652940 CACCCACACGGGACTTTTATGGG + Intronic
1075285261 10:121179333-121179355 CACCCAGATTGTGGTTCTATTGG - Intergenic
1079021929 11:16916316-16916338 CACTCTGATGGTAGTTTCTTTGG + Intronic
1079872392 11:25815865-25815887 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1082744071 11:56943339-56943361 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1087371278 11:97288197-97288219 CACCTAGATGATAGGTTGATAGG - Intergenic
1088791264 11:113229116-113229138 CACTCTGATGGTAGTTTCTTTGG - Intronic
1088944063 11:114491196-114491218 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1091136150 11:133191831-133191853 CACACAAATGGAAGTTTTAATGG - Intronic
1093256499 12:16874360-16874382 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1093659047 12:21733137-21733159 AACCCAAATGGTAGTTTAATAGG + Intronic
1094205809 12:27839142-27839164 CACGCAGGTGATAATTTTATAGG + Intergenic
1095446703 12:42289186-42289208 CACCCAGAAGGAAATTTTGTCGG + Intronic
1095704029 12:45218551-45218573 CACCTAGTTGGTTGTTTTTTTGG + Intronic
1098186812 12:67905248-67905270 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1098623057 12:72628240-72628262 AAGCCAGATGGAAGGTTTATAGG + Intronic
1098844420 12:75518390-75518412 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1099403071 12:82224122-82224144 CACTCTGATGGTAGTTTCTTTGG - Intronic
1099828514 12:87810559-87810581 AAACCAGATTGGAGTTTTATAGG - Intergenic
1100109366 12:91219566-91219588 CACTCATATGGTTGCTTTATGGG + Intergenic
1101366746 12:104078916-104078938 CACCCAGATGGTAGTTTTATGGG + Intronic
1102148161 12:110670129-110670151 CTCCCAGATGGTAGTTTTTCTGG - Intronic
1102960548 12:117090754-117090776 CACCCACCTGGTAGTTCTAAGGG - Intronic
1107243783 13:38268048-38268070 CACCCTGATGATAGTTTCTTTGG - Intergenic
1107358509 13:39594149-39594171 CACTCTGATGGTAGTTTCTTTGG - Intronic
1108145931 13:47476998-47477020 TACCCAAATGGTAGTCATATTGG - Intergenic
1110079873 13:71296405-71296427 CACCCAGATATCAGATTTATAGG - Intergenic
1111073148 13:83196586-83196608 CACTCTGATGATAGTTTTTTTGG + Intergenic
1112869785 13:103955927-103955949 CCCCAAGATGATAGTATTATAGG - Intergenic
1115537383 14:34385714-34385736 CACTCTGATGGTAGTTTTGTAGG - Intronic
1116062623 14:39942703-39942725 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1120843645 14:89107933-89107955 CAGCCAGATGGTGGTTTCCTAGG + Intergenic
1120971069 14:90207733-90207755 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1126001523 15:44215091-44215113 CACTCAGATGGTATTTACATTGG - Intergenic
1126523541 15:49623519-49623541 CTCCCAAATGCTAGTATTATAGG + Intronic
1126542021 15:49834179-49834201 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1127561680 15:60144575-60144597 CACCATGATGGTGGATTTATTGG + Intergenic
1129263272 15:74380877-74380899 CACCCAGATGGTCGAGTTGTGGG - Intergenic
1131694519 15:94861422-94861444 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1136986963 16:35115912-35115934 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1142938516 17:3360375-3360397 CACCCTGATGGTAGTTTCTTTGG + Intergenic
1145805936 17:27729757-27729779 CACCCTGATGATAGTTTCTTTGG + Intergenic
1148179399 17:45592817-45592839 CCCTCAGATGGTATTTTTATTGG - Intergenic
1149955849 17:61048815-61048837 CACTCAGATGGTTGTTTCCTAGG - Intronic
1153396500 18:4627660-4627682 GACACAGATGCTAGTTGTATCGG + Intergenic
1155767527 18:29653580-29653602 CACAAAGATGGTAATTCTATGGG + Intergenic
1159338698 18:67105218-67105240 TACGCAGATGGTAGATTTGTCGG + Intergenic
1159893231 18:73972479-73972501 CACCCAGATGGTTGTGCGATTGG - Intergenic
1162246124 19:9402781-9402803 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1165405048 19:35624816-35624838 TGCACAGATGGTAGTTTTACTGG + Exonic
1166390844 19:42407975-42407997 CACCGAGATGGAAGTGCTATCGG - Exonic
927885690 2:26717217-26717239 CACCCAGTGGGCAGTGTTATGGG - Intronic
928182306 2:29077464-29077486 GACCTAGGTGGTAGTTATATGGG + Intergenic
929127196 2:38532804-38532826 CTCCCAGATGGTTGTTTGCTTGG - Intergenic
930626356 2:53702222-53702244 CAAACAAATGGTAGTTTTTTTGG - Intronic
931014112 2:57955653-57955675 CACCCAGGTGATAGGTTGATAGG + Intronic
931963394 2:67506142-67506164 CACTCTGATGGTAGTTTCTTTGG + Intergenic
936268776 2:111032585-111032607 CACTGAGTTGGTAGCTTTATGGG + Intronic
936576636 2:113662227-113662249 CACTCTGATGGTAGTTTCTTTGG - Intergenic
938167030 2:129039098-129039120 CACTCTGATGGTAGTTTCTTTGG + Intergenic
939469930 2:142608739-142608761 CACTCTGATGGTAGTTTCTTTGG + Intergenic
939503117 2:143011095-143011117 CACTCTGATGGTAGTTTCTTTGG - Intronic
940114450 2:150192687-150192709 CAGGGAGATGGGAGTTTTATCGG - Intergenic
941032257 2:160525978-160526000 CACTCTGATGGTAGTTTCTTTGG + Intergenic
943535787 2:189148221-189148243 AAGCAAGATGCTAGTTTTATAGG + Intronic
946511377 2:220360514-220360536 CACTCTGATGGTAGTTTCTTAGG - Intergenic
946888064 2:224244589-224244611 CACCCACATTATACTTTTATTGG + Intergenic
948018901 2:234714242-234714264 TACCAAGATGGTAATTTTCTTGG - Intergenic
948611332 2:239169053-239169075 CCTCAAGATGGTATTTTTATTGG + Intronic
1168735132 20:128291-128313 AACCTAGATGGCAGGTTTATAGG + Intergenic
1169975705 20:11324935-11324957 CACCCAGATCTTAGATTTCTAGG + Intergenic
1171023081 20:21604147-21604169 AACCCAGATGATGGGTTTATAGG - Intergenic
1171748486 20:29023701-29023723 CCCCCAGATGTTAGTCTGATGGG - Intergenic
1174211631 20:48883839-48883861 GCCCCAGCTGGGAGTTTTATAGG - Intergenic
1174344315 20:49918631-49918653 CACCCTGATGTTAGGTTTAAAGG + Intergenic
1179198723 21:39193065-39193087 CCCTCAGATGGTATTTTTATTGG + Intronic
1180394820 22:12321848-12321870 CCCCCAGATGTTAGTCTGATGGG + Intergenic
1180404922 22:12542900-12542922 CCCCCAGATGTTAGTCTGATGGG - Intergenic
949652566 3:6176958-6176980 CACTCTGATGGTAGTTTCGTTGG - Intergenic
950951578 3:17005436-17005458 ATCCCAGATGGTAATTTTAGTGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952761540 3:36919233-36919255 CACCCAGGTGGGAGTTAGATGGG - Intronic
956959450 3:74381528-74381550 AATACAGATAGTAGTTTTATAGG + Intronic
957154223 3:76526918-76526940 AACAAATATGGTAGTTTTATAGG - Intronic
960776550 3:121262829-121262851 CAGGGAGATGGGAGTTTTATGGG - Intronic
962597790 3:136964652-136964674 CACTCTGATGGTAGTTTCTTTGG + Intronic
964475376 3:157093001-157093023 CATCCAGATGGCATCTTTATAGG + Intergenic
964833942 3:160916092-160916114 CACTCCGATGGTAGTTTCTTTGG - Intronic
967938168 3:194745986-194746008 CTCCCAGATGGTTGTCTCATGGG + Intergenic
969197319 4:5573309-5573331 GACCCACATGGTAATTATATTGG - Intronic
970001514 4:11369787-11369809 CACTCTGATGGTAGTTTCTTTGG + Intergenic
970811783 4:20102743-20102765 CACCCTGAGGGTTCTTTTATGGG + Intergenic
971910201 4:32786095-32786117 AACCCTGATGGTATTTTGATTGG + Intergenic
974463926 4:62228962-62228984 CATCCAGATGTCAGTTTTTTGGG - Intergenic
977669153 4:99675952-99675974 CACTCTGATGGTAGTTTATTTGG - Intergenic
983508670 4:168584370-168584392 AACCAAGATGGTACTTTTACTGG + Intronic
984360634 4:178726687-178726709 AACCCAGTAGGTAGTTTTTTAGG + Intergenic
985376837 4:189349692-189349714 CACTCTGATGGTAGTTTCTTTGG + Intergenic
985798500 5:1984343-1984365 TACACATATGGTGGTTTTATTGG + Intergenic
986302111 5:6485515-6485537 CCCCCAGATAGAAGTTTTAGGGG + Intronic
987395288 5:17417196-17417218 CACTCTGATGGTAGTTTCTTTGG + Intergenic
987423762 5:17750559-17750581 CACTCTGATGGTAGTTTCTTTGG + Intergenic
988454057 5:31372014-31372036 AACCCAGATGACAGGTTTATAGG + Intergenic
989316322 5:40083097-40083119 CATCCATATGGTGGTTTTCTTGG - Intergenic
989418712 5:41210400-41210422 CACTCTGATGGTAGTTTCTTTGG - Intronic
991553279 5:67866947-67866969 CACTCTGATGGTAGTTTCTTTGG + Intergenic
991568224 5:68027334-68027356 CACCCCGATAATAGTGTTATTGG - Intergenic
992523243 5:77578513-77578535 CAACCAGATGGTGGATTTAATGG + Intronic
993720151 5:91314220-91314242 CACCCAGCTGGAACTCTTATGGG - Intergenic
995594140 5:113730697-113730719 CACCCAGTTGGGTGTTTCATGGG + Intergenic
995715236 5:115076177-115076199 CACTCTGATGGTAGTTTCTTTGG - Intergenic
996541013 5:124630015-124630037 CACCCAGCTGGAAGTTCTAGGGG + Intergenic
996809762 5:127503440-127503462 AACTCAGATGGTATTTTTATGGG - Intergenic
998122301 5:139588730-139588752 CACACAGATCGTATTTTTAAAGG + Intronic
1003095232 6:3137484-3137506 CTCCCAGATGGTAGGTTACTGGG + Exonic
1003274409 6:4637043-4637065 CACCCAGGTGTTTGTTTTCTAGG + Intergenic
1003492979 6:6640092-6640114 CATGCAGGTGGTGGTTTTATGGG - Intronic
1004556375 6:16702518-16702540 CACTCCGATGGTAGTTTCTTTGG - Intronic
1008401698 6:51070683-51070705 CACACAGATTGTAGGTTTAATGG - Intergenic
1008796844 6:55313227-55313249 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1010102872 6:72130583-72130605 CAGCAAGATGATAGTGTTATTGG + Intronic
1011995861 6:93587432-93587454 AACCCAGAGAATAGTTTTATAGG - Intergenic
1012184225 6:96193236-96193258 CACTCTGATGGTAGTTTCTTTGG - Intronic
1014642047 6:123924226-123924248 CACCCAGATGGAATTTTACTAGG - Intronic
1016434072 6:144017634-144017656 CACCCACATGGTTGTCTAATTGG - Intronic
1016621811 6:146119399-146119421 CACTCTGATGGTAGTTTCTTTGG + Intronic
1018118012 6:160606770-160606792 CAATCATATGGTACTTTTATGGG - Intronic
1018330698 6:162724930-162724952 AACCCAGATGTTCGTTTTCTAGG - Intronic
1020847451 7:13305378-13305400 CACTCTGATGATAGTTTCATTGG + Intergenic
1021391679 7:20101123-20101145 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1022603607 7:31785872-31785894 TACCCAGAGGGAGGTTTTATAGG + Intronic
1027722084 7:81756258-81756280 CACACAGCGGGTAGTTTTATTGG - Intronic
1027983444 7:85254901-85254923 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1027988747 7:85330675-85330697 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1029179963 7:98693270-98693292 CAGCCTGAAGCTAGTTTTATGGG + Intergenic
1030972298 7:116075562-116075584 CACACAGATGGCAGTCTTAAAGG - Intronic
1031399533 7:121315108-121315130 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1032415192 7:131730149-131730171 CACCCAGGAGGGAGTTTTCTGGG + Intergenic
1032709556 7:134450110-134450132 GGGCCAGGTGGTAGTTTTATAGG - Intronic
1032830566 7:135621203-135621225 TAGCCAAATGGTAGATTTATAGG + Intronic
1033083303 7:138318877-138318899 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1033862431 7:145644406-145644428 CAGCCAGGTGGTTGTTCTATGGG + Intergenic
1035878107 8:3213393-3213415 CACCTAGGTGGTGGTTTCATGGG - Intronic
1043412124 8:80008456-80008478 CACTCCGATGGTAGTTTCTTTGG - Intronic
1044452862 8:92358709-92358731 AACACTGATGTTAGTTTTATAGG - Intergenic
1046066555 8:109203729-109203751 CACCCAGATAATGGTTCTATTGG - Intergenic
1046387024 8:113518890-113518912 CACCCTGATGGAAGGCTTATGGG + Intergenic
1046574343 8:116007282-116007304 CCCCCAGAAAGTTGTTTTATGGG + Intergenic
1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG + Intronic
1048381698 8:133871139-133871161 CACCCAGGTGATGGTTTGATAGG - Intergenic
1049088829 8:140498427-140498449 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1050840971 9:10148748-10148770 CCCAGAGATGGTAGTTTAATTGG - Intronic
1051427573 9:16948998-16949020 AAGCCAGCTGGTATTTTTATAGG + Intergenic
1051702495 9:19838923-19838945 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1203410085 Un_KI270580v1:1427-1449 CCCCCAGATGTTAGTCTGATTGG + Intergenic
1203410577 Un_KI270581v1:4815-4837 CCCCCAGATGTTAGTCTGATGGG - Intergenic
1187297990 X:18021134-18021156 AACCTAGATGGTAGTTCAATGGG + Intergenic
1187596286 X:20776349-20776371 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1191063771 X:56325917-56325939 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1191173311 X:57472276-57472298 CACTCTGATGGTAGTTTCTTTGG - Intronic
1191217496 X:57948817-57948839 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1192406971 X:70896054-70896076 CACTCTGATGGTAGTTTCTTTGG - Intronic
1192847394 X:74920584-74920606 CACTCTGATGGTAGTTTCTTTGG + Intronic
1193619017 X:83727641-83727663 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1194390385 X:93310812-93310834 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1194417582 X:93632503-93632525 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1194422318 X:93691692-93691714 AAGCCAGCTGGTATTTTTATAGG + Intronic
1194603484 X:95952797-95952819 CAACCAGATTGTAGTTTAATGGG + Intergenic
1196229732 X:113207570-113207592 CACTCTGATGGTAGTTTCCTCGG + Intergenic
1196384323 X:115132044-115132066 CACTCTGACGGTAGTTTTTTTGG + Intronic
1196544092 X:116942238-116942260 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1197087674 X:122498136-122498158 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1197090369 X:122529258-122529280 CACTCTGATGGTAGTTTCTTTGG - Intergenic
1197987766 X:132285429-132285451 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1200867109 Y:8056453-8056475 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1201491397 Y:14545738-14545760 CACTCTGATGGTAGTTTCTTTGG + Intronic
1202303406 Y:23442056-23442078 CACTCTGATGGTAGTTTCTTTGG + Intergenic
1202567405 Y:26228538-26228560 CACTCTGATGGTAGTTTCTTTGG - Intergenic