ID: 1101366919

View in Genome Browser
Species Human (GRCh38)
Location 12:104081053-104081075
Sequence ACATAAAGCCTACACTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101366919_1101366922 -9 Left 1101366919 12:104081053-104081075 CCTGCCCAGTGTAGGCTTTATGT 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1101366922 12:104081067-104081089 GCTTTATGTAAGTGTTAACCTGG 0: 1
1: 1
2: 1
3: 7
4: 69
1101366919_1101366923 -8 Left 1101366919 12:104081053-104081075 CCTGCCCAGTGTAGGCTTTATGT 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1101366923 12:104081068-104081090 CTTTATGTAAGTGTTAACCTGGG 0: 1
1: 0
2: 0
3: 3
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101366919 Original CRISPR ACATAAAGCCTACACTGGGC AGG (reversed) Intronic
902255627 1:15187042-15187064 ACACAAAACCTGCACTGGGCCGG + Intronic
902594132 1:17496418-17496440 CCATAAAGCTTTCACTGGGGAGG + Intergenic
902716976 1:18279728-18279750 ACAGACAGGCTTCACTGGGCTGG + Intronic
905628111 1:39501941-39501963 AAAGAAACCCCACACTGGGCCGG + Intronic
905819212 1:40976750-40976772 AAATAAAGACAACAGTGGGCTGG - Intergenic
907100989 1:51835355-51835377 AAATAAAACTTACACGGGGCCGG - Intronic
913582523 1:120240658-120240680 ACAGAAAGCATTCACTGGCCAGG + Intergenic
913625650 1:120657703-120657725 ACAGAAAGCATTCACTGGCCAGG - Intergenic
918186582 1:182132920-182132942 ACATTAGGCCTAGACTGGACTGG - Intergenic
1064078497 10:12289070-12289092 AAAAAAAGCCCACACAGGGCTGG + Intergenic
1064546419 10:16454931-16454953 ACCTAAAGACTAAACTGGCCAGG + Intronic
1073063820 10:100746905-100746927 ACAAGAAGCCTATGCTGGGCTGG - Intronic
1073094240 10:100970039-100970061 AAATACCGCCTACACTAGGCAGG + Intronic
1076548876 10:131264516-131264538 ACCTGAAGGCTGCACTGGGCAGG + Intronic
1077777322 11:5285757-5285779 ACCTAGAGCCTACGCTGAGCAGG - Intronic
1078004804 11:7524630-7524652 ACATAAATGCTAAACTGGGTGGG + Intronic
1083502002 11:63117801-63117823 ACTTATAGCCTACTCTTGGCTGG - Intronic
1096187933 12:49595246-49595268 ACATCAAGGCTACACTGTACTGG - Intronic
1098021341 12:66159410-66159432 ACATGAAGGCTTGACTGGGCTGG - Intronic
1099612051 12:84885932-84885954 ACATAAGCCCTAAACTGGGCGGG - Exonic
1101366919 12:104081053-104081075 ACATAAAGCCTACACTGGGCAGG - Intronic
1101442587 12:104714705-104714727 AAATAAATCCTACACTACGCTGG - Intronic
1102037408 12:109779933-109779955 ACAGAAAACCTACACTGGCTGGG - Intergenic
1103583554 12:121934347-121934369 ACACAAAGCCTACCCTGTGAAGG - Exonic
1108853689 13:54767334-54767356 ACAAAAAGGAAACACTGGGCTGG - Intergenic
1111135762 13:84040798-84040820 ACATAAAGGCTAAAGAGGGCTGG + Intergenic
1120001443 14:79307595-79307617 ACCTGAAGCCTTGACTGGGCTGG + Intronic
1120751254 14:88200585-88200607 AAATAAACCCTACACTGGGAAGG + Intronic
1124058274 15:26262531-26262553 AAATAACTCTTACACTGGGCTGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1129093100 15:73172736-73172758 AGATAAGCACTACACTGGGCAGG + Intronic
1135988973 16:27205543-27205565 AAATAAAGCCTTCTCTGGGCCGG + Intronic
1136916100 16:34199421-34199443 ACATAAAAACTACACAGGGCCGG - Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1138981947 16:62280584-62280606 ACATAGAGCCAAAACTGGCCTGG + Intergenic
1144209894 17:13005303-13005325 ACTTCAGGCCTACACTGGCCAGG + Intronic
1146903050 17:36600673-36600695 ACAAGAAGCCAAGACTGGGCTGG - Exonic
1147043799 17:37738055-37738077 GCATAAAGCTTAAATTGGGCAGG + Intronic
1148734098 17:49854921-49854943 CCAGAAAGCTTACACAGGGCAGG + Intergenic
1155425851 18:25706794-25706816 ACGGAAAGCCGACCCTGGGCTGG - Intergenic
1158215750 18:55098925-55098947 ACATACAGACAACACTGTGCTGG + Intergenic
1158912958 18:62086320-62086342 ATAAAAAGCCTGAACTGGGCCGG + Intronic
1159373351 18:67558937-67558959 ACATAAAGGCTAGAGAGGGCTGG + Intergenic
1161555201 19:4937657-4937679 AAATAAATCCTAAACTGGCCGGG - Intronic
1161778947 19:6279105-6279127 AGATAAAGCTTAGGCTGGGCCGG + Intronic
1162645293 19:12045295-12045317 ACAGAAAGCCTACACTTTGCTGG - Intronic
1163203679 19:15787052-15787074 ACACAAAGCCCACAGAGGGCAGG - Intergenic
1166153424 19:40892033-40892055 ACATAAAACCACCACTGGCCGGG - Exonic
1166175005 19:41061607-41061629 ACATAAAACCACCACTGGCCGGG + Intergenic
1167026801 19:46925626-46925648 ACACATAGCCTTCCCTGGGCAGG - Intronic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
926035708 2:9633864-9633886 ACATGTTGCCTACACTGGTCTGG - Intergenic
929293157 2:40215997-40216019 AAAAAAAGCATACACTGGGAAGG - Intronic
929773061 2:44909006-44909028 CCATAAAGCTGACACTGGCCGGG + Intergenic
929835060 2:45388342-45388364 AAATAAAGCCCACAGTGGACTGG - Intergenic
932416118 2:71574849-71574871 ACAGAAAGCGCACCCTGGGCAGG - Intronic
936581063 2:113700966-113700988 ACATAAAAACCACCCTGGGCTGG + Intergenic
938342472 2:130544652-130544674 ACATGAGGCCCACACAGGGCAGG - Intronic
938347360 2:130576057-130576079 ACATGAGGCCCACACAGGGCAGG + Intronic
943914903 2:193618614-193618636 CCAAAAAGCCTAAACTGAGCCGG + Intergenic
944393671 2:199245957-199245979 ACAGAAAGGCTATAGTGGGCTGG + Intergenic
945221208 2:207486131-207486153 ACATAAATGGTACACTGGCCAGG + Intergenic
948547418 2:238742752-238742774 ACCTAAAGGCTTGACTGGGCTGG + Intergenic
1180644700 22:17328962-17328984 ACATAAAACCTTATCTGGGCTGG - Intergenic
1183619700 22:38965290-38965312 ACATCTAACCTACCCTGGGCTGG + Intronic
952798984 3:37270511-37270533 ACAAAAAAGCTACACTGGGCTGG - Intronic
953258656 3:41315646-41315668 ACAGAAACCCTACTCTAGGCTGG + Intronic
954629448 3:52040155-52040177 GCATGAAGCCTGCTCTGGGCCGG - Intergenic
957475904 3:80723787-80723809 GCAGAAAGCTTACACTGTGCTGG - Intergenic
964653666 3:159042383-159042405 ACCTACAGTCTACATTGGGCTGG - Intronic
965069504 3:163900422-163900444 ACATAAAGCATACACAAGGAAGG - Intergenic
965222793 3:165949717-165949739 AAATATAACTTACACTGGGCAGG + Intergenic
974348285 4:60710944-60710966 AAATAAAGACTAAATTGGGCAGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
984444948 4:179824938-179824960 ACATAAAGGGGACACTGGGATGG - Intergenic
985026198 4:185741804-185741826 CCAGAAATCATACACTGGGCTGG + Intronic
990326753 5:54684561-54684583 ACAGGAAGCCTACAGTGGCCAGG - Intergenic
990725524 5:58749538-58749560 AGATAAAGCCTTCACAGGGAAGG + Intronic
992525166 5:77602434-77602456 ACATAAAGAGTAGAATGGGCTGG - Intronic
999664820 5:153901717-153901739 ACCTGAAGGCTCCACTGGGCTGG - Intergenic
1000720504 5:164700300-164700322 ACTTAGAGCTTACACAGGGCTGG + Intergenic
1009515682 6:64613959-64613981 ACAGAAAATCTACACAGGGCTGG - Intronic
1010091465 6:71987624-71987646 ACAATAAGACTACACTTGGCTGG + Intronic
1012986096 6:105877920-105877942 ATATAAAGCCTAAGCTGGGATGG - Intergenic
1031272087 7:119664638-119664660 AAATAAAGTCTACACTAAGCAGG + Intergenic
1032446646 7:131989894-131989916 ACATGCAGCCTCCACTGGGTGGG - Intergenic
1034387643 7:150753696-150753718 AAAAAAAGCCTATTCTGGGCTGG + Intergenic
1036015051 8:4773897-4773919 ACAAAAATCCTACTCTTGGCTGG + Intronic
1036104014 8:5820389-5820411 ACATAAAGCTTCCACTCTGCAGG - Intergenic
1036884496 8:12541467-12541489 ATGAAAAGCCTTCACTGGGCTGG + Intergenic
1037906769 8:22720053-22720075 ACTGAAAGCCAACAGTGGGCTGG + Intronic
1039000101 8:32970555-32970577 ACACAAAGCCTACCCAGGGAGGG + Intergenic
1039155688 8:34554171-34554193 ACCTCAAGGCTCCACTGGGCAGG - Intergenic
1039384961 8:37127466-37127488 ACAGAGAGCCTACTATGGGCTGG - Intergenic
1041378582 8:57227445-57227467 ACAAAAAGCCTGGCCTGGGCAGG + Intergenic
1042143828 8:65706549-65706571 ATTAAAAGCCTGCACTGGGCTGG - Intronic
1043939946 8:86186178-86186200 AGCTAAAGCCTACAGTGTGCAGG - Intergenic
1044617197 8:94154838-94154860 ACATAGTGCCCACAGTGGGCTGG + Intronic
1045877732 8:107001684-107001706 ACATAAAGCCTCCAGGTGGCTGG + Intergenic
1047354742 8:124109718-124109740 ACAGAAAGCCTCCCCTGGGCAGG + Intronic
1048089562 8:131224497-131224519 ATATAAAGCCAACACTGTGCTGG - Intergenic
1051704428 9:19861134-19861156 ACATAAAGCCAACACAGCACTGG - Intergenic
1061238514 9:129355903-129355925 ATCTAAAGGCTCCACTGGGCTGG + Intergenic
1061661907 9:132136043-132136065 TCTTAAAACCTACAATGGGCTGG - Intergenic
1062220195 9:135410921-135410943 ACTGAAAGCCTACCCAGGGCAGG + Intergenic
1187407285 X:19015421-19015443 TCAAAAAGCCTAGACTTGGCTGG + Intronic
1188378589 X:29463965-29463987 ACATAAAGACTGGACTGGGCTGG - Intronic
1188582987 X:31737896-31737918 AAATAAAGCCTCAAATGGGCTGG + Intronic
1188717115 X:33474017-33474039 ATATAAAGCAAGCACTGGGCAGG + Intergenic
1189636429 X:43015366-43015388 ACTTAAAGGGTAAACTGGGCTGG - Intergenic
1190195438 X:48314084-48314106 ATATAAAGCAGACACTTGGCAGG + Intergenic
1196202744 X:112903981-112904003 ACACAATGGCTAGACTGGGCTGG - Intergenic
1198477411 X:137008978-137009000 ACAGAATGCTTACACTGTGCTGG + Intergenic