ID: 1101369126

View in Genome Browser
Species Human (GRCh38)
Location 12:104108802-104108824
Sequence GTAAACACCCTGACATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101369126_1101369128 5 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369128 12:104108830-104108852 AAAGAGAAGAAAGTATGAATTGG 0: 1
1: 0
2: 9
3: 149
4: 1420
1101369126_1101369130 22 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369130 12:104108847-104108869 AATTGGTGGCATATCAGATATGG 0: 1
1: 0
2: 0
3: 15
4: 142
1101369126_1101369129 8 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369129 12:104108833-104108855 GAGAAGAAAGTATGAATTGGTGG 0: 1
1: 0
2: 3
3: 37
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101369126 Original CRISPR GTAAACACCCTGACATCTCT AGG (reversed) Intergenic
901035710 1:6334793-6334815 GTAAACCCCTAGACGTCTCTGGG - Intronic
901759536 1:11461784-11461806 GGACACACACTGACATTTCTGGG - Intergenic
908610369 1:65852035-65852057 GAAATCAGCCTTACATCTCTAGG + Intronic
911268926 1:95776938-95776960 GGAATCACTCTGTCATCTCTTGG - Intergenic
911618768 1:100042927-100042949 ATAAACACCCTGATGTTTCTAGG - Intronic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
923149672 1:231221741-231221763 GTAATCACCCTGAGATTTCCTGG - Intergenic
1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG + Intronic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1069679084 10:70270896-70270918 CTATACACCCTGATCTCTCTTGG - Intronic
1070797819 10:79227276-79227298 TTAAACACCCTCCCATCTTTGGG + Intronic
1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG + Exonic
1070928801 10:80245855-80245877 GGAAACACCCTGACTTTTGTAGG - Intergenic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1084473934 11:69378195-69378217 GCAAACCCCCTGGCATCTCCAGG - Intergenic
1089424980 11:118365473-118365495 GAAAACAGCCTGACAGCTTTGGG - Intronic
1096556408 12:52406672-52406694 TTATACACCCTGGCTTCTCTGGG + Intergenic
1101212739 12:102550982-102551004 ATAAAAACACTGACATCTTTTGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG + Intergenic
1102602076 12:114039050-114039072 TTAAACAGCCTAACATTTCTAGG + Intergenic
1102678173 12:114672479-114672501 GTCAACACTCAGAAATCTCTAGG + Intronic
1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG + Intronic
1103442243 12:120971905-120971927 GGAAACACAGTGACATCTGTTGG + Intergenic
1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG + Intergenic
1108438557 13:50425631-50425653 AAAAACAACCTCACATCTCTGGG - Intronic
1110635978 13:77767442-77767464 GTAAACTTCCTGACTCCTCTTGG - Intergenic
1111515328 13:89323695-89323717 ATAAACATTCTGTCATCTCTTGG - Intergenic
1112100854 13:96187689-96187711 CTAAACATCCTGACATGTCATGG + Intronic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1116360507 14:43990055-43990077 GTAGACACCCAGAAAGCTCTAGG + Intergenic
1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122395631 14:101427533-101427555 GTAAACCCCTTGACTTTTCTAGG - Intergenic
1126717401 15:51533602-51533624 GTGCACACCTTGACATCACTTGG - Intronic
1128336289 15:66787654-66787676 GTTAGCACCCTGCCCTCTCTGGG - Intergenic
1130765640 15:86868020-86868042 ATACACAATCTGACATCTCTTGG - Intronic
1130832432 15:87615382-87615404 GGAAATACCCTGCCTTCTCTGGG + Intergenic
1131485519 15:92816874-92816896 GTAAACACCGTGAAAAGTCTGGG - Intergenic
1138066958 16:53952171-53952193 GTAAATTCCCTAACCTCTCTGGG - Intronic
1138128068 16:54455088-54455110 GTAAACACCCTGGCTTCACGAGG - Intergenic
1139148244 16:64348368-64348390 GTAAACACCCCGAAATCCTTTGG - Intergenic
1140241005 16:73200581-73200603 GTAAACAGTCTGACATTTATCGG - Intergenic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1148495629 17:48051868-48051890 GTAAACACCCTGGCATGTGTAGG - Intronic
1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG + Intergenic
1158942196 18:62415032-62415054 AGATTCACCCTGACATCTCTAGG + Intergenic
1167577574 19:50325193-50325215 ATAAAGCCCATGACATCTCTAGG - Intronic
925598716 2:5586599-5586621 GGATATACCCTGACATCGCTGGG + Intergenic
930104845 2:47631701-47631723 TTAAACACCCAGACATGTCCAGG - Intergenic
934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG + Intronic
935446905 2:103166713-103166735 CTAAGCAGCATGACATCTCTTGG + Intergenic
939165842 2:138640463-138640485 CCAAATACCCTGGCATCTCTTGG - Intergenic
945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG + Intergenic
946011174 2:216564709-216564731 GTAAAGTCCCTGACAACTCGAGG + Intronic
1169166755 20:3430693-3430715 GTAACCTCCCCGACATTTCTTGG - Intergenic
1170781798 20:19431845-19431867 CTTAAAACCCTGACATTTCTCGG - Intronic
1170998562 20:21391247-21391269 GGAAACAGCCTGACTACTCTGGG + Intergenic
1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171273156 20:23832135-23832157 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG + Intergenic
1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG + Intronic
1173991319 20:47305872-47305894 GTAAAGACCCTGACGTCATTTGG + Intronic
1178396775 21:32249907-32249929 GAAAACACCCTGATATATTTTGG - Intergenic
1179724126 21:43332333-43332355 GTAGACACAATGACATCACTCGG + Intergenic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
1183236740 22:36624421-36624443 GTGAGCAGCCTGACCTCTCTGGG - Intronic
1184908651 22:47510313-47510335 CAAAACACCATGTCATCTCTTGG - Intergenic
953267303 3:41403849-41403871 GTAAACACACTGATAACTCATGG - Intronic
954827163 3:53384068-53384090 GCACCCACCATGACATCTCTGGG - Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
961001963 3:123380011-123380033 GGACACAACCAGACATCTCTAGG + Intronic
961647855 3:128401959-128401981 GAAAGCTCGCTGACATCTCTAGG - Intronic
963517502 3:146326654-146326676 GGAATCACACTGGCATCTCTTGG + Intergenic
964425222 3:156545948-156545970 GTAAGCAACCTGACTTCACTGGG - Intronic
966568800 3:181416168-181416190 TTAAACACACTGAGATTTCTTGG - Intergenic
967407530 3:189134195-189134217 GTAAATCACCTGCCATCTCTGGG + Intronic
968980359 4:3845363-3845385 CTAAACACACTGACATAGCTTGG - Intergenic
969936729 4:10689494-10689516 GTAAACACCCTGACACTATTCGG + Intergenic
972099346 4:35392959-35392981 GCACACACCCTAACATTTCTAGG - Intergenic
972198997 4:36690368-36690390 CAAAACACACTGAAATCTCTGGG - Intergenic
975619372 4:76280666-76280688 CTCAACACCCTGAATTCTCTAGG + Intronic
982061061 4:151604444-151604466 GGAAACACAGTGACATCTGTTGG + Intronic
986612087 5:9579047-9579069 AGAAACATCTTGACATCTCTGGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
990078225 5:51878387-51878409 GTAAACATCATGCTATCTCTTGG - Intergenic
993552889 5:89296670-89296692 GTAGACATCCTGACATCTGGAGG + Intergenic
995485560 5:112636764-112636786 GTAACTACCCTGACACCTTTTGG - Intergenic
996854800 5:127993532-127993554 GTAAACACATTCACATCTCTTGG - Intergenic
997556549 5:134804213-134804235 ATAAACCTCCTGACATCTCAGGG - Intronic
1017238586 6:152142655-152142677 GTAATCATACTGACATCACTGGG - Intronic
1017332295 6:153213960-153213982 GGACACACACAGACATCTCTTGG - Intergenic
1020796476 7:12683821-12683843 GGAAACACAGTGACATCTGTTGG - Intergenic
1020866996 7:13577784-13577806 AAAAAAACCCTGACATCTATTGG - Intergenic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1023741737 7:43287304-43287326 GTGCACCCCCAGACATCTCTGGG - Intronic
1023885161 7:44349055-44349077 GTGAACACCCTTATGTCTCTGGG - Intergenic
1024050878 7:45622554-45622576 GTAAACATCTGTACATCTCTAGG + Intronic
1024706373 7:51964789-51964811 TGAAACACCCTGACATGTCATGG - Intergenic
1030365685 7:108643375-108643397 AGAAACACAGTGACATCTCTAGG - Intergenic
1031121082 7:117723088-117723110 TCAAACACTCTGACAACTCTGGG + Intronic
1032463221 7:132126957-132126979 GGAGAGACCCTGACATTTCTTGG - Exonic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1043970463 8:86523161-86523183 ATAAAAACCCTGACAACTGTAGG - Intronic
1044931611 8:97257539-97257561 GTCACCACCCTGACATTCCTGGG + Intergenic
1046235119 8:111414108-111414130 GAAAACATACTGAAATCTCTGGG - Intergenic
1049390206 8:142363794-142363816 GTCTTCACCCTGAGATCTCTGGG - Intronic
1052362943 9:27579312-27579334 TTAATCCTCCTGACATCTCTAGG + Intergenic
1053151214 9:35744412-35744434 CTAACCACCCTGATTTCTCTAGG - Exonic
1058127185 9:101208466-101208488 GTAAACACTCTTACCTCTTTTGG + Intronic
1060626175 9:125114120-125114142 GTAAATACGGTGACATCTGTCGG + Intronic
1185791649 X:2931980-2932002 GTAAACACACTGAGCTGTCTTGG + Intergenic
1189254436 X:39626987-39627009 GTAAACTCCCTGGCACTTCTAGG - Intergenic
1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG + Intergenic
1192777775 X:74262955-74262977 GTTAAGAACCAGACATCTCTTGG - Intergenic
1196253992 X:113494351-113494373 GTAAATATCCTGTCATTTCTAGG + Intergenic
1197150231 X:123212882-123212904 GTGGACACCCTCACTTCTCTAGG - Intronic
1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG + Intergenic