ID: 1101369128

View in Genome Browser
Species Human (GRCh38)
Location 12:104108830-104108852
Sequence AAAGAGAAGAAAGTATGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1579
Summary {0: 1, 1: 0, 2: 9, 3: 149, 4: 1420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101369126_1101369128 5 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369128 12:104108830-104108852 AAAGAGAAGAAAGTATGAATTGG 0: 1
1: 0
2: 9
3: 149
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101369128 Original CRISPR AAAGAGAAGAAAGTATGAAT TGG Intergenic
900944356 1:5821432-5821454 AAAGAAAAGAAAGAAAGAAAGGG + Intergenic
901849534 1:12006799-12006821 ACAGAGGAGAAAGTATGCAGTGG - Intronic
902405122 1:16178513-16178535 AAAGAGAAAAAAAAATGAAAAGG - Intergenic
902418388 1:16257169-16257191 AAAGAAAAGAAAGAATGTAGAGG + Intronic
902899667 1:19506015-19506037 AAAGAGAATAAAGGAAGAACAGG - Intergenic
903290146 1:22306158-22306180 AAAGGGAACAAAGAACGAATGGG + Intergenic
904426991 1:30433657-30433679 AATCTGAATAAAGTATGAATTGG + Intergenic
905055825 1:35092568-35092590 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
905151208 1:35929688-35929710 AAGAAGAAGAAAGTAAGAATTGG + Intergenic
905485991 1:38296974-38296996 ATAGACAAGAAACTATGAAAAGG - Intergenic
905799949 1:40837062-40837084 AAAGAAAAGAAAAGATGGATTGG - Intronic
905840006 1:41168321-41168343 AAAAAGAAAAAAGAATGAAAAGG - Intronic
906116326 1:43359456-43359478 AAAGAGAAGACAGTCTGACCAGG - Intronic
906226602 1:44127600-44127622 AAAGAAAAGAAAGAAAGAAAGGG - Intronic
906356229 1:45107775-45107797 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
906469256 1:46113954-46113976 AAAGAGAAGGAATTATAAAGAGG + Intronic
906851243 1:49252353-49252375 ATAGAGAAAAAAGAATGAAAAGG + Intronic
906881055 1:49591434-49591456 AAAAAAAAGAAAATCTGAATAGG + Intronic
906926347 1:50121436-50121458 ATAGAAAAGAAAGTATCATTGGG + Intronic
907021285 1:51068823-51068845 AAAGAAAAGAAAGTAGGGAATGG - Intergenic
907419857 1:54339920-54339942 AAAGAAAAGAAAGAACGAAAGGG + Intronic
907940614 1:59083841-59083863 GAAGAAAAGAAGGTATGCATTGG - Intergenic
908055720 1:60284525-60284547 AAGGGGAAGGAAGTATTAATAGG + Intergenic
908065040 1:60393717-60393739 AAAGAGATGTAACTATGAAGAGG - Intergenic
908140486 1:61179330-61179352 TAAGAGAAGAAGGTAGGATTTGG + Intronic
908204701 1:61834239-61834261 AGGGAGAGGAGAGTATGAATTGG - Intronic
908341463 1:63184580-63184602 AAAGAAAAGAAAATATGTATTGG - Intergenic
908551336 1:65211864-65211886 AAAGAAAATAAAGGGTGAATAGG + Intronic
908690465 1:66774147-66774169 AAAGAGAAGAAAGTGCACATAGG - Intronic
908869997 1:68599273-68599295 AAAGAAAAGAAAGTGAGAGTAGG - Intergenic
908910772 1:69070677-69070699 ATAGAGAAAAAAGAATGAAACGG - Intergenic
908974108 1:69877119-69877141 ACAGAGAAGAAACTGTGAAGGGG + Intronic
909002181 1:70231716-70231738 TAAGAGAAGAAAGTATGTAAAGG - Intronic
909123447 1:71634635-71634657 TAAAAGAAGAGAGTATGAAGGGG + Intronic
909151274 1:72009012-72009034 AAAGAAAAGAAAGAAAGAAGGGG + Intronic
909209904 1:72809822-72809844 AAAGAGAATAAGGACTGAATAGG + Intergenic
909315780 1:74216434-74216456 AAAGAGAAGAAAGTAAAATAAGG - Intronic
909374633 1:74925342-74925364 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
909625536 1:77711761-77711783 AAAAAGAAGAAAAACTGAATTGG - Exonic
909678462 1:78264413-78264435 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
909860049 1:80593834-80593856 AAAGTGTGGAAAGTATGAAAGGG + Intergenic
909893888 1:81041629-81041651 AAAGAGAAGAAAGGAAAAAGTGG + Intergenic
910038562 1:82819143-82819165 AAAGAGATGGAAGTATGTTTTGG + Intergenic
910148359 1:84109997-84110019 AAAAAGCTGAAAGTATGAGTAGG - Intronic
910177356 1:84444516-84444538 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
910257676 1:85264585-85264607 AGAGGGAGGAAGGTATGAATAGG + Intergenic
910317672 1:85905369-85905391 AGAGAGAAGAGAGTAAAAATAGG + Intronic
910443022 1:87272419-87272441 AAAGAGAAGAGAGAAAGAATAGG - Intergenic
910446202 1:87301081-87301103 AAAGAGAAGAGAGAATAAAAAGG + Intergenic
910526865 1:88189189-88189211 AAAAAGAAAAACGTTTGAATTGG + Intergenic
910766290 1:90786043-90786065 TAAGAGAACAAAGTAGGGATGGG - Intergenic
911261745 1:95694603-95694625 AAATAGAAGAAAGTAGGCATGGG - Intergenic
911369715 1:96982425-96982447 AAAGAGATGAAAATATGCAGAGG + Intergenic
911525068 1:98974500-98974522 AAATAGAAGAAACTCTGAAATGG + Intronic
911797036 1:102088688-102088710 GAAGAGTAGAAAGAATGAACCGG - Intergenic
912124295 1:106514264-106514286 AAAGAGAAGTATGCATGCATAGG + Intergenic
912281392 1:108318395-108318417 AAATAGAAGAAATAATGATTAGG + Intergenic
912354612 1:109044373-109044395 AAAGAAAAGAAATAATAAATGGG + Intergenic
912366793 1:109140362-109140384 AAAGAGAGGAAAGACTGAAGAGG + Intronic
912780880 1:112546556-112546578 AAGGAAAGGAAAGTAAGAATAGG + Intronic
912809994 1:112786852-112786874 AAAGAAAAGAAAGAAAGAAGAGG + Intergenic
913062157 1:115218476-115218498 AAGGAGAAGAAAGTATAAAAGGG - Intergenic
913089549 1:115467122-115467144 AGAGAGAAGAAAGAAAGAAAAGG + Intergenic
913135871 1:115888444-115888466 AAAAAAAAAAAAGAATGAATGGG + Intergenic
913206299 1:116542286-116542308 AAAGAGAAAGAAACATGAATAGG + Intronic
913335009 1:117701581-117701603 GGAGAGAAGAAAGTATGGATAGG - Intergenic
913380348 1:118203504-118203526 AAAGAGAAGAAAAGAGGGATGGG - Intergenic
913707076 1:121435753-121435775 AAGCAGAAGAAAGAATCAATGGG + Intergenic
914979448 1:152399756-152399778 AAAGAGAAGAAAGGAAAAGTAGG + Intergenic
915017156 1:152744682-152744704 CAAGAGAAGAAAGAATGAGAGGG - Intronic
915224748 1:154404257-154404279 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
915493987 1:156267974-156267996 AATGCCAAGAAAGGATGAATTGG + Intronic
915780358 1:158543164-158543186 AAAGAGAAGAAAAAGAGAATGGG - Intergenic
915885425 1:159716480-159716502 AAAGAGAAAAAAGGAAGGATGGG + Intergenic
915995550 1:160558925-160558947 AAAAAGAAAAAAGAATGAAAAGG + Intronic
916007059 1:160672224-160672246 AAAGATGAGAAAGGATGAAAAGG - Intergenic
916361624 1:163976702-163976724 AAAAAAAAGAAAGAAAGAATTGG - Intergenic
916611614 1:166397255-166397277 AAAGAGAGGAAAGGAAGAAAGGG - Intergenic
916919471 1:169448757-169448779 AAAGAGAAGAAGGAGTGAATGGG - Intronic
916979907 1:170123801-170123823 AAAGAGAAGAAATAATAAATTGG - Intergenic
917448311 1:175125543-175125565 AAAGAGAAGAAAGGAAGAGGTGG - Intronic
917549633 1:176011497-176011519 AATGAGAAAAAAGTAAGAAAGGG - Intronic
917675439 1:177314589-177314611 AAAGAAAAGATATTATGAAGAGG + Intergenic
917766466 1:178224028-178224050 AAAGAAGACAAAGTATGAACTGG + Intronic
917785897 1:178457364-178457386 TTAGACAAGTAAGTATGAATTGG + Intronic
917803879 1:178596479-178596501 AATGAGAAGAAAGAATAAAATGG + Intergenic
918206413 1:182313454-182313476 AAAGAGAAAAAAGGAGGAAAAGG + Intergenic
918435787 1:184511565-184511587 GAACAGAAGAATGAATGAATAGG + Intronic
918485164 1:185021273-185021295 AAAGAAAAAAAAGGATAAATTGG + Intergenic
918614660 1:186530850-186530872 ACAGAGAAAAAAGAATGAAAAGG - Intergenic
918757543 1:188356957-188356979 ATAGAGAAGAGAGGTTGAATTGG + Intergenic
919017163 1:192053351-192053373 AAAGAGAAGAAAGTAGTCAAGGG + Intergenic
919045333 1:192443939-192443961 ACAGAGAGGAGAGTATGCATGGG + Intergenic
919561379 1:199124369-199124391 AAAGTGAGGAAAGCAAGAATGGG + Intergenic
919578834 1:199345726-199345748 AAAAAGAAGATGGTAGGAATGGG - Intergenic
919586480 1:199446831-199446853 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
919644891 1:200085675-200085697 AAAGAAAAGAAAGAAAGAAATGG + Intronic
919919218 1:202158335-202158357 AAAGAAAAGCAAATATGATTGGG - Intronic
920222821 1:204416746-204416768 AAAGAAGAGAAAGGAAGAATGGG + Intergenic
920350341 1:205333935-205333957 AAAGAGAAAAAAGAAAGAAGAGG - Intergenic
921067869 1:211635370-211635392 AAAGAAAAGAAAGGAAAAATTGG - Intergenic
921104378 1:211961030-211961052 ATAGAGAAAAAAGAATGAAAAGG + Intronic
921123053 1:212153293-212153315 AAGGAGAAGAGAGAATGAACTGG + Intergenic
921142889 1:212322360-212322382 AAAGAGCAGAAAATATAAATAGG - Intronic
921271939 1:213478023-213478045 AGAGGGAAGAAGGGATGAATAGG - Intergenic
921333720 1:214065558-214065580 AAAGAGAAGAAAGGATGTGTAGG + Intergenic
921434146 1:215097404-215097426 AAAAAAAGGAAAGTAAGAATGGG - Intronic
921485553 1:215711839-215711861 AAAGGGAGGGAAGTGTGAATAGG - Intronic
921541950 1:216427029-216427051 AAAGAGAAAACAATATAAATTGG - Intergenic
921684717 1:218076535-218076557 AGAGAGAAGTAAGTAAGAAATGG - Intergenic
921736271 1:218632479-218632501 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
921780562 1:219158027-219158049 AAAGAGAACTGAGTAAGAATAGG - Intergenic
921854257 1:219964258-219964280 GAAGAGAAGAAAATATGAAGAGG + Intergenic
921966059 1:221091252-221091274 AAAGAGCAGAAAATTTGCATAGG + Intergenic
922158151 1:223056192-223056214 AAAGATAAGAAAGTATGGGTAGG - Intergenic
922371637 1:224917098-224917120 CAAGAGCAAGAAGTATGAATCGG + Intronic
922375825 1:224964208-224964230 CAAGAGAAGAGACTAGGAATAGG - Intronic
922428292 1:225520867-225520889 AAAGAAAAGAAAGGAGGAAGCGG + Intronic
922777411 1:228221884-228221906 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
923195372 1:231661439-231661461 ATAGAGAAAAAAGAATGAAAAGG - Intronic
923612400 1:235506131-235506153 AAAGGCAAGAAAGTAATAATTGG + Intergenic
923955128 1:239008380-239008402 TAAGAGAAGAAAGTGAGAAAGGG + Intergenic
924276033 1:242388214-242388236 TAAGAGAAGAAGGAATGAAGAGG + Intronic
924312967 1:242764760-242764782 AAAGATAAAAAAGAATGAAAAGG + Intergenic
924377336 1:243426487-243426509 ACAGAGAAGAAATGAAGAATTGG + Exonic
924396950 1:243630648-243630670 AAAAAAAAGCAAGAATGAATTGG - Intronic
924536882 1:244942897-244942919 AAAAAGAATAAAATAGGAATTGG + Intergenic
924809199 1:247386483-247386505 AAAGAGAAGAAGGGAAGAAGGGG - Intergenic
1063238046 10:4139764-4139786 AAATACTAGCAAGTATGAATGGG - Intergenic
1063507810 10:6617337-6617359 AAAGAAAAGAAAGTAACAAAAGG + Intergenic
1063696757 10:8343319-8343341 GAAGAGAAGAAAGCAGGATTAGG + Intergenic
1063868622 10:10394127-10394149 AAAAAAAACAAACTATGAATAGG + Intergenic
1064514082 10:16127117-16127139 ATAGTGAAGAAACTATAAATCGG + Intergenic
1064549792 10:16488063-16488085 ACAGAGAAGTCAGTATTAATGGG + Intronic
1064619779 10:17203111-17203133 AAAGAGAGGAAAGTATAATGAGG + Intergenic
1064817956 10:19288383-19288405 AAAAAATAGAAAGAATGAATAGG - Intronic
1064838977 10:19568385-19568407 AAAGAAAAGAAACTTTGAGTAGG - Intronic
1064931679 10:20635619-20635641 AATTAGAAAAAAGGATGAATAGG - Intergenic
1065018975 10:21487032-21487054 AAAAAAAAAAAAGTATAAATTGG - Intergenic
1065123645 10:22552168-22552190 AGAGAGATGCAAATATGAATAGG + Intronic
1065169643 10:23013333-23013355 AAAGAAAATAAAGAATGAATAGG - Intronic
1065182065 10:23136242-23136264 AAAGAGAACAAAAGAAGAATGGG + Intergenic
1065228419 10:23571261-23571283 AAAGAGAAGGAAGTAAATATAGG + Intergenic
1065932306 10:30490671-30490693 AAAGAGGAGAAGGAATGAAGAGG + Intergenic
1066035617 10:31479900-31479922 GTAGAGAAGAAAGTATAAGTTGG + Intronic
1066143647 10:32534086-32534108 AAAAAGAAGAAAGAATGAAAAGG - Intronic
1066152959 10:32643565-32643587 AAAGAGAAGTAAACATGGATTGG - Intronic
1066340456 10:34527532-34527554 AAAAAGAAGAAAGTAGAACTAGG + Intronic
1066505766 10:36040958-36040980 AAAGAGAATGAAGAATGATTTGG + Intergenic
1066549451 10:36539452-36539474 AAAGAGAAGAAAGTACAGAGTGG - Intergenic
1067207477 10:44232177-44232199 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1067345165 10:45432984-45433006 AATGAGCAGAGAATATGAATAGG + Intronic
1067363760 10:45606055-45606077 ATAGAGAATAAAGTTTGACTAGG + Intergenic
1067927449 10:50524448-50524470 CAAGAGAAGAAAGGAGGAAAAGG - Intronic
1068061922 10:52079201-52079223 AAAGAGATAAATGAATGAATGGG - Intronic
1068112009 10:52690910-52690932 AAAGGGAAGACAGTATGATGAGG + Intergenic
1068126736 10:52850310-52850332 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1068343697 10:55742554-55742576 AAATACACGAAACTATGAATGGG + Intergenic
1068410934 10:56653591-56653613 AAAAAGAGGAAAGTATGTGTAGG + Intergenic
1069072139 10:63999772-63999794 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1069108813 10:64417655-64417677 ATAGAGAAGAAACTCTAAATAGG + Intergenic
1069243172 10:66167761-66167783 GGAGAGAAGAAAGGATGATTGGG + Intronic
1069258263 10:66361418-66361440 AAAGAAAAGAAAGAAGGAAAGGG - Intronic
1069277030 10:66605253-66605275 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1069333948 10:67326919-67326941 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1069360001 10:67631545-67631567 AAAGTGAAGAAATTTTTAATGGG + Intronic
1069382831 10:67858003-67858025 AAAGGGAAGAAAATGAGAATAGG - Intergenic
1069445587 10:68470625-68470647 AAAGAAAGGAAAGTATAAATTGG + Intronic
1069725794 10:70577268-70577290 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1070235162 10:74616844-74616866 AAATAGAGGAAAATATGGATTGG - Intronic
1070334359 10:75441051-75441073 AAAGAGAAAAAAGAATAAACAGG + Intronic
1070471464 10:76784390-76784412 AAAGAAAAGTAAGAATGAAGTGG + Intergenic
1070664731 10:78334980-78335002 AAAGAAAAAAGAGTAGGAATGGG + Intergenic
1070668463 10:78361788-78361810 AAGGAAAAGAAAGAAAGAATGGG - Intergenic
1070953266 10:80447673-80447695 AAAGAGCAAAAAGAATGAAGGGG - Intergenic
1070992457 10:80744455-80744477 AAAGAGAAGTAAATAAGAATAGG + Intergenic
1071053620 10:81481715-81481737 AAAGGGAAGATAATATGTATAGG - Intergenic
1071061433 10:81574619-81574641 GAAGGGAAGAAAGAATGATTGGG - Intergenic
1071068793 10:81667845-81667867 AAAGACAGGAAAGTGTGATTAGG - Intergenic
1071071440 10:81698351-81698373 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1071095760 10:81972645-81972667 ACAGAGAAAAAACAATGAATGGG + Intronic
1071382296 10:85079791-85079813 AAAAAGAAGAAAGTCTGAAAAGG + Intergenic
1071441242 10:85698339-85698361 AAAGTGTGGAAAATATGAATTGG - Intronic
1071554853 10:86594050-86594072 AAAGAGAGGAAAGAAAGAAAGGG + Intergenic
1071554854 10:86594067-86594089 AAAGGGAAGAAAGAAAGAAAAGG + Intergenic
1071736338 10:88304636-88304658 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1071742543 10:88376312-88376334 AAAAAGGAGAAAATAAGAATAGG + Intronic
1071760984 10:88606506-88606528 AAAGGTATGAAAGTATGAATAGG - Intronic
1071882036 10:89910090-89910112 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1072075455 10:91968194-91968216 ACAGGGAAGGAAGGATGAATAGG - Intronic
1072138020 10:92565423-92565445 AAAGAAAAGAAAGAAAGAAATGG + Intronic
1072222323 10:93336896-93336918 AAAGAGAAGAAAGGAAGGAAGGG + Intronic
1072764827 10:98086883-98086905 AAAGAGAAGTCAGTGGGAATTGG + Intergenic
1072834622 10:98697451-98697473 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1072977987 10:100075741-100075763 AAATATAAGAAAGGATGAAGAGG - Intronic
1073643852 10:105279346-105279368 AAAGAAAAGAAAGAAAGAAGGGG - Intergenic
1073820709 10:107260474-107260496 AAGGGGAAAATAGTATGAATTGG + Intergenic
1073863366 10:107772071-107772093 ATAAAGAAAAAAGAATGAATAGG + Intergenic
1073909684 10:108326976-108326998 AAAGAAAAGAAAGAAAGAAGAGG + Intergenic
1074003492 10:109394923-109394945 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1074270213 10:111946114-111946136 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1074622109 10:115136591-115136613 AGGGAGAGGAAAGAATGAATAGG - Intronic
1074664829 10:115709633-115709655 AATGAGAAGAAATAATGAACAGG + Intronic
1074752130 10:116596681-116596703 AAAGAGAAGGGAGAAAGAATTGG - Intronic
1075502695 10:122990598-122990620 AAAGAGAAGAAACTAGGAGGGGG + Intronic
1075899202 10:126025482-126025504 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1076645433 10:131951049-131951071 AAAGAGCAAAAACCATGAATGGG + Intronic
1077622523 11:3739927-3739949 AAAGAAAAGAATGTATTATTAGG - Intronic
1077694291 11:4379825-4379847 AAATAAAATAAAGTATGAACAGG + Intergenic
1077847202 11:6038708-6038730 AAACAGAAAAAAATAAGAATGGG - Intergenic
1077881905 11:6357441-6357463 AGAGAGTCGCAAGTATGAATCGG + Intergenic
1078501806 11:11886537-11886559 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1078506052 11:11946814-11946836 AATTAGAAGAAAGTATGAAGAGG - Intronic
1078686043 11:13533359-13533381 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1078823155 11:14903254-14903276 GGAGTGAAGAAAGTAGGAATGGG - Intergenic
1078841654 11:15081507-15081529 AAAGAAAAAAAAAGATGAATTGG - Exonic
1078989704 11:16634410-16634432 AAAGAGGAGAAAGAGAGAATGGG + Intronic
1079894561 11:26102554-26102576 AAAGAGAAGAAAGCCTGAGATGG - Intergenic
1079966231 11:26983602-26983624 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1079970947 11:27034129-27034151 AAACAGAAAAAAGTAGGCATTGG + Intergenic
1080225138 11:29951470-29951492 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1080292715 11:30688902-30688924 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1080355393 11:31438520-31438542 ATAGGAAAAAAAGTATGAATTGG - Intronic
1081129951 11:39367056-39367078 AAAGAGAAGAAAGAAAAAATAGG - Intergenic
1081359238 11:42153342-42153364 GAAGAAAAGAAAATATGAATAGG + Intergenic
1081454809 11:43211392-43211414 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1081725648 11:45326395-45326417 CAACAAAAGAAGGTATGAATTGG - Intergenic
1082746382 11:56967699-56967721 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1082772322 11:57217569-57217591 AAAGGGAAGAAAGCACGAAAAGG - Intergenic
1083438234 11:62657964-62657986 AAAAAGAAGAAATTATAAGTTGG + Intronic
1083509234 11:63191789-63191811 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1083942661 11:65905387-65905409 AAAGAAAAAAAATTAAGAATGGG - Intergenic
1084010475 11:66345632-66345654 GGAGAGCAAAAAGTATGAATGGG - Exonic
1084290896 11:68166264-68166286 AAAGAGAAGAAACCCTAAATGGG - Intronic
1084919601 11:72458346-72458368 GAAGAGAAGAAAGTGAGAGTGGG + Intergenic
1085066454 11:73499819-73499841 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1085181019 11:74536087-74536109 AGGGAGAAGAAAATTTGAATGGG - Intronic
1085619334 11:78025884-78025906 AAAGAGAAGAAACTTTACATTGG + Intronic
1085749964 11:79153253-79153275 AATGAGAAAAATGTATGAAAAGG + Intronic
1085860495 11:80227744-80227766 AAACAGAAAAAAGAATGAAAAGG + Intergenic
1086085396 11:82948641-82948663 AAGGAGAAGAAACATTGAATAGG - Intronic
1086522469 11:87685655-87685677 AAATAGAATAAAGTGAGAATGGG + Intergenic
1086683407 11:89702416-89702438 AAACAGAGGAAAGTATGAGAGGG - Intergenic
1087002755 11:93437129-93437151 ATAGAGAAGAAAATAAGGATTGG - Intronic
1087261624 11:96018564-96018586 TAAGAGAAGAAAGTATGTCAAGG + Intronic
1087467007 11:98521138-98521160 AAAGAGGAGAAAGCATGGAAGGG + Intergenic
1087569186 11:99902849-99902871 AAAGATAGGAAAGAAAGAATTGG + Intronic
1087884666 11:103465145-103465167 AAAGAGAAAAAAATATAAAATGG + Intronic
1087955757 11:104286001-104286023 AAAGAGAAAAAAGAAGGAAGAGG + Intergenic
1088140838 11:106614117-106614139 AAAAGAAAGAAAGTTTGAATAGG + Intergenic
1088411516 11:109539605-109539627 AAAGAGAGGAAAGAATAAAGGGG - Intergenic
1088517550 11:110655117-110655139 AAAGAGAAGAAAACATAAAGGGG + Intronic
1088923274 11:114277249-114277271 AAAGAAAAGAAAGAAAGAAATGG + Intronic
1089272602 11:117312445-117312467 AAAGAGAATAATGTATTTATAGG - Intronic
1089438942 11:118498323-118498345 AAACATATGAAAGTCTGAATAGG + Intronic
1089532358 11:119138669-119138691 AGAGAGAAGAAGGTAGGAATGGG + Intergenic
1089966861 11:122660457-122660479 AAGGAAAAGAAAGAATGTATTGG + Intronic
1090053638 11:123402647-123402669 AGAGAGCAGAAAGTCTGAAGTGG - Intergenic
1090063417 11:123483366-123483388 AAAGAAAAGAAAATATTAAATGG - Intergenic
1090240557 11:125178518-125178540 AAAAAGAAGAAAGAAAGAAAGGG + Intronic
1090742331 11:129675968-129675990 AAAGAAAAGAAAGAAAGAAAAGG + Intergenic
1090825482 11:130382247-130382269 AAAGACAAGAAATTAAGAAGGGG + Intergenic
1090852523 11:130583025-130583047 AAAGAAAAGAATGTTAGAATTGG + Intergenic
1090927538 11:131261665-131261687 AAAGAGAATAAACTAGGAATAGG - Intergenic
1091387541 12:104434-104456 ATAAAGAAGAAAATATAAATGGG + Intronic
1091557117 12:1582175-1582197 AAAGAAAAGAAAGGAAGAAAAGG + Intronic
1091946325 12:4547377-4547399 AAAGAAATGAAAGTTTGATTAGG + Intronic
1092443025 12:8526384-8526406 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1092623013 12:10294298-10294320 AAAAACAAGCAAGTATGAAGAGG + Intergenic
1093021188 12:14205911-14205933 AAAAAAAAGAAAGTATAATTGGG + Intergenic
1093060547 12:14598412-14598434 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1093113686 12:15183097-15183119 ACAGAAAAGAAAGTATTAATGGG + Intronic
1093127312 12:15346089-15346111 AAAGAGAAGAAAAAATAACTTGG - Intronic
1093223603 12:16453250-16453272 AAAGAGAAGGAAATATGTTTAGG + Intronic
1093263300 12:16968130-16968152 AAAAAAAAGAAACTATGATTAGG + Intergenic
1093373596 12:18394977-18394999 AAAGAAAAGAAAGAAAGAAAGGG - Intronic
1093413517 12:18894920-18894942 TCAGAGAAAAAAGTATGAAAAGG - Intergenic
1093516839 12:19997478-19997500 AAAAAAAAGAAAGAAAGAATTGG + Intergenic
1093715160 12:22373439-22373461 AAAGGGAAGAAAAGATAAATGGG + Intronic
1093732282 12:22579045-22579067 AAAATTAAGAAAGTATGTATTGG - Intergenic
1093745637 12:22737794-22737816 TCTGAGAAGATAGTATGAATGGG - Intergenic
1093797482 12:23330107-23330129 AGATAGAGGAAAGTATAAATGGG + Intergenic
1093896408 12:24579601-24579623 AAGGAGAAGAAAGTAAGAACAGG + Intergenic
1093937950 12:25021072-25021094 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
1094382235 12:29855436-29855458 AAAGAAAAGAAAGAAAGATTCGG + Intergenic
1094694840 12:32808221-32808243 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1094766721 12:33604494-33604516 AAAGTGAATAAAGTATAAATGGG + Intergenic
1095197874 12:39343995-39344017 AGAGAGAAGAAAGTACAAGTAGG + Intronic
1095408581 12:41895463-41895485 AAAGAGAGGAAAGAGAGAATTGG - Intergenic
1095426872 12:42084262-42084284 AAAGAGAAAGGAGTAAGAATGGG - Exonic
1095519179 12:43041536-43041558 ATACAGATGAAAGGATGAATAGG + Intergenic
1095675073 12:44907077-44907099 AAGGAGAAGAATGAATGAAGAGG - Intronic
1095899041 12:47308403-47308425 AAAGAAAAAAAAGAATGAAAAGG + Intergenic
1095985643 12:47997716-47997738 AAAGAGAAAAAGGCATCAATGGG + Intronic
1096088957 12:48885535-48885557 AAAGAGAAGAAAGGTTGAGAAGG + Intergenic
1096376199 12:51112949-51112971 AAAGGGAAGCAAGAATTAATGGG + Intronic
1096720221 12:53515818-53515840 AAAGAGAAGAGAGAAGAAATGGG + Exonic
1096851900 12:54445079-54445101 AAGAAAAAAAAAGTATGAATGGG + Intergenic
1097016714 12:55992460-55992482 AAAGTGAAGAAAGTTTGTTTTGG - Exonic
1097355215 12:58593580-58593602 AAAAAGAATAAAGTGTGAATTGG + Intronic
1097473772 12:60028305-60028327 AAAGAAAAGAAAGAAAAAATTGG + Intergenic
1097696379 12:62778953-62778975 AAAGAAAAGAAAGGAAGAAAGGG + Intronic
1097786950 12:63771175-63771197 AAAAACAAGAAAGTATGATTTGG + Intergenic
1097890674 12:64774235-64774257 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1097899765 12:64860755-64860777 AGAGAGAGGAAACTATGAGTTGG + Intronic
1097918578 12:65046604-65046626 AAAGAGTAGAAACTATGAGTTGG + Intergenic
1098045704 12:66398197-66398219 AAAGAGAAGAAATTATATGTTGG - Intronic
1098147787 12:67515597-67515619 AAAGAGCTGAAAGTATCAATAGG + Intergenic
1098171938 12:67755869-67755891 AAAGAGAAGAATTTAGGATTAGG - Intergenic
1098241794 12:68474968-68474990 AAAGAAAATAATGTATGTATTGG + Intergenic
1098446801 12:70574430-70574452 AAGGAGAGGAAATTATGAAGTGG + Intronic
1098580458 12:72093506-72093528 AAAAAGAAAAAAGAATGAAAAGG - Intronic
1098618589 12:72561486-72561508 GAGGAGAACAAAGTGTGAATCGG + Intronic
1098757583 12:74386107-74386129 AAAATACAGAAAGTATGAATAGG + Intergenic
1098766827 12:74501145-74501167 AATGAGAAAAAAATATGATTAGG + Intergenic
1098807525 12:75038107-75038129 AAGGGGAAGAAAGGATGAATTGG + Intergenic
1098951097 12:76641253-76641275 AAAGAAAAGAAAGAAAGAAAGGG - Intergenic
1099051038 12:77781835-77781857 AAAGAGAAGAGAGAATGACTAGG + Intergenic
1099077979 12:78135829-78135851 AAAAAGAAGAAAGGATGGAAAGG - Intronic
1099406081 12:82264661-82264683 GAAGAGAAGAAAGGAAGAAATGG + Intronic
1099793125 12:87362352-87362374 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1099800089 12:87445982-87446004 AAAGGGAAGAAAGTGTGAAAAGG - Intergenic
1099829505 12:87822436-87822458 AAATAGAGGAAAGTATGAGATGG + Intergenic
1100188018 12:92158606-92158628 AGAGAGAAGAATGTTTGAAAGGG - Intergenic
1100224894 12:92546425-92546447 AAAGATAAAGAAGTATGAAATGG - Intergenic
1100454546 12:94739816-94739838 AAAGAAAAGAAAGCATGAAAAGG + Intergenic
1100872124 12:98921092-98921114 AAAGGGAAGAAAGGATGACAGGG - Intronic
1101101157 12:101394082-101394104 AAAGAGACTAAAGTAGGAATGGG + Exonic
1101141641 12:101801640-101801662 ATAGAGAAGAAAGAAGGAAGGGG - Intronic
1101145550 12:101837325-101837347 AAACAGAATAAAGTATGGTTGGG - Intergenic
1101253778 12:102958117-102958139 AAAGAAAAGGAAATATGAAGCGG - Exonic
1101369128 12:104108830-104108852 AAAGAGAAGAAAGTATGAATTGG + Intergenic
1101466716 12:104957667-104957689 AAAGAGAAGAATGAAAGAAAAGG + Intronic
1101509430 12:105379602-105379624 TAAGGAAAGAAAGAATGAATGGG - Intronic
1101752368 12:107592716-107592738 AAAAAGAATAAAGCATGCATAGG + Intronic
1101774372 12:107780158-107780180 AAAGAGAAGAAAGCAGGGACAGG + Intergenic
1101800902 12:108021289-108021311 AAAGAGAAGAAAGACTCACTTGG + Intergenic
1102097828 12:110254426-110254448 AAAAAAAAGAAAGCATGAACTGG + Intergenic
1102693479 12:114779916-114779938 AAAGAGAAAAAAGAAAGAAAAGG - Intergenic
1102693799 12:114782296-114782318 AAAGAAAAGAAAGCAGGGATTGG + Intergenic
1102771945 12:115485560-115485582 ACAGAGAAGCATGGATGAATGGG - Intergenic
1103641993 12:122358751-122358773 AAAAAAAAAAAAGAATGAATTGG + Intronic
1103653647 12:122453497-122453519 AACCACAAGAAAGCATGAATAGG - Intergenic
1104455506 12:128908346-128908368 AAAGAAAAGAAAGAAAGAAAGGG - Intronic
1105363250 13:19740344-19740366 AAAAAAAAAAAAGAATGAATTGG + Intronic
1105400436 13:20089285-20089307 AAAGAAAAAAAAGTACAAATTGG - Exonic
1105586036 13:21743541-21743563 AGAGAGTTGAAAGAATGAATGGG - Intergenic
1105752274 13:23432415-23432437 AAGGAGAAGAAAGGATGAAAGGG + Intronic
1105936983 13:25110213-25110235 AAAGAGAAAAACAGATGAATTGG - Intergenic
1106257398 13:28033808-28033830 AAAGAGAAGAAGGCATGGGTGGG + Intronic
1106789452 13:33139741-33139763 AAATAGAAAAAAAAATGAATAGG - Intronic
1107059371 13:36140062-36140084 GAAGAAAAGAAAGGAGGAATGGG + Intergenic
1107234374 13:38151387-38151409 AGAGAGAAGGAAGAATGAATAGG + Intergenic
1107288320 13:38822333-38822355 AAAAAAAAGAAAGAAAGAATGGG - Intronic
1107333003 13:39321688-39321710 AAAGAGAAGAAAGAAACAAAAGG + Intergenic
1107577426 13:41741975-41741997 AATGAGTAGAAAGTATGTCTAGG + Intronic
1107579197 13:41764106-41764128 AAAGAGAAAAAAGTAGGTTTGGG - Intronic
1107664558 13:42675386-42675408 AAAGATTAGAAATTATGATTTGG - Intergenic
1107781713 13:43910581-43910603 AAAAAAAAGAAAGTAGTAATAGG - Intergenic
1108048963 13:46410727-46410749 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1108221535 13:48239171-48239193 AAAGGGAGGAAAAAATGAATTGG - Intronic
1108277746 13:48828102-48828124 AAAAAGAAGAATGAATGATTTGG + Intergenic
1108427982 13:50324617-50324639 AAAAAAAAAAAAGTAAGAATGGG - Intronic
1108433282 13:50376273-50376295 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
1108600016 13:51984358-51984380 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1109070041 13:57753612-57753634 ATTGAGAAGAAATTATAAATTGG + Intergenic
1109376750 13:61505113-61505135 AAGAAGAAGGAAGTAGGAATGGG + Intergenic
1109581554 13:64345636-64345658 AAAGACAAGAAAGCTAGAATAGG + Intergenic
1109887780 13:68564807-68564829 AGAAAGAAAAAAGTATTAATTGG + Intergenic
1110076400 13:71249802-71249824 AAATAGCAGAAATTATGAATGGG - Intergenic
1110105987 13:71676715-71676737 AAAGATAAGAATGTTTCAATGGG + Intronic
1110133034 13:72030265-72030287 AAGGAGAAAAAAGAATGAAAAGG + Intergenic
1110144651 13:72175637-72175659 AAAGAGTAAAAAGTATTATTGGG - Intergenic
1110265127 13:73528940-73528962 ACAGACAAGAAAGTAGAAATTGG - Intergenic
1110372181 13:74752215-74752237 CAAGAGATGAAAGAATGACTTGG - Intergenic
1110406407 13:75155456-75155478 AATGAGAAGAAAGAACAAATTGG - Intergenic
1110499951 13:76215542-76215564 AATGAGAAGAAAGCAACAATGGG + Intergenic
1110634751 13:77753821-77753843 AAAAAGACAAAAGTATGCATAGG - Intronic
1110883831 13:80607907-80607929 AAAAAGAAGAAATTAAGAATAGG - Intergenic
1111092328 13:83463254-83463276 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1111123955 13:83889015-83889037 AAAGAGAAAAAAGTCTTTATTGG - Intergenic
1111129613 13:83957515-83957537 AAAGAAGAGAAAGTATCAAAGGG + Intergenic
1111233861 13:85382226-85382248 AAATAGAAGAAGGTATAAATGGG - Intergenic
1111256153 13:85671374-85671396 AAATAGAAGAAAGTGGGAAATGG + Intergenic
1111332676 13:86781119-86781141 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1111469626 13:88661425-88661447 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
1111535623 13:89599003-89599025 AAAGAGGAGAAAGTAAGATTCGG - Intergenic
1111575660 13:90151127-90151149 ACAGAAAAGAAAGTATGTACAGG + Intergenic
1111588891 13:90318025-90318047 TAAGAGGAGAAAGTTTGAATAGG + Intergenic
1111720153 13:91933314-91933336 AAAGAACAAAAACTATGAATTGG - Intronic
1112090120 13:96074428-96074450 ATGTAGAAGAAAGTATGAAAGGG + Intergenic
1112544344 13:100350819-100350841 AATGGGAAAGAAGTATGAATAGG - Intronic
1112614921 13:100994387-100994409 AAAGAGAAGATAGTAACAGTGGG + Intergenic
1112684490 13:101808305-101808327 AAAGAAAAGAAAAGATGAAAAGG - Intronic
1112958752 13:105094643-105094665 ACAGAGCCGAAAGTATGAAGTGG - Intergenic
1112994599 13:105557688-105557710 GAAGAGAAGAAAGTGTTATTTGG + Intergenic
1113115123 13:106867050-106867072 AATGAGAAGAAAGCATAAAAGGG + Intergenic
1113281646 13:108795185-108795207 AAAAAAAAGAAAGTAAGAAAAGG - Intronic
1113641472 13:111960520-111960542 AGAGAGATGAATGAATGAATGGG + Intergenic
1114706116 14:24727962-24727984 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1115089611 14:29558132-29558154 AAAAAAAAAAAAGTATCAATGGG + Intergenic
1115194547 14:30782001-30782023 AAAGGAAAGAAATAATGAATTGG + Intergenic
1115333018 14:32218564-32218586 AAGGAGAAAAAATTATGAATGGG - Intergenic
1115901007 14:38148165-38148187 AAAGAGAAGAGAGTATAATGAGG - Intergenic
1116002364 14:39258282-39258304 TTAGAGAAAAAAGTATGAAAAGG - Intronic
1116039779 14:39671734-39671756 AAAATGAAGAAACTATGATTAGG - Intergenic
1116042884 14:39707178-39707200 AAAAAGAAGAAAGTACAGATAGG - Intergenic
1116096175 14:40371916-40371938 AAAGAGAAAGAAGTAAAAATGGG - Intergenic
1116157615 14:41227875-41227897 TAAGAAAAGAAAATATGACTCGG + Intergenic
1116189301 14:41643200-41643222 CAAGAGAAAAAGGTATAAATAGG + Intronic
1116479200 14:45377746-45377768 AAAAAGAAGAAAGAATGCCTAGG + Intergenic
1116572294 14:46533769-46533791 TAAGAGAAAAAAGAATGAAAAGG - Intergenic
1116977553 14:51132618-51132640 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1117043543 14:51789962-51789984 AAAGAGAAGACAGAATGAGAGGG + Intergenic
1117135109 14:52727678-52727700 AAAGAAAATAATGTATGTATTGG + Exonic
1117226166 14:53661975-53661997 AAAAATAAGAAATTATAAATTGG + Intergenic
1117543666 14:56772615-56772637 CCAGAGATGAAAGTAGGAATGGG + Intergenic
1117641193 14:57800812-57800834 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1117710865 14:58527148-58527170 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1117876738 14:60259435-60259457 GAAGAGAAAAAAGGATGGATTGG + Intronic
1117886052 14:60364220-60364242 AAAGGGAATAAAGAATGAACAGG - Intergenic
1117925578 14:60775839-60775861 AGAGAGAAGAAAGTATGAAATGG + Intronic
1117968112 14:61226423-61226445 CAAGAGAGGAAAGTATGTGTGGG + Intronic
1118242869 14:64078515-64078537 AAATAGAAGAAATTAACAATGGG + Exonic
1118448659 14:65876494-65876516 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1118704281 14:68466085-68466107 AATGAGAAGAAAGTATAGGTGGG - Intronic
1119944740 14:78681397-78681419 AAATAGAAATAAGTAGGAATCGG + Intronic
1119986763 14:79147151-79147173 AAGGAGAAGAAACTTTGACTGGG - Intronic
1120106475 14:80501483-80501505 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
1120242374 14:81964472-81964494 AAACACAAAAAAGTATCAATCGG - Intergenic
1120256000 14:82120479-82120501 AAAGAGAATGAAATATGACTTGG + Intergenic
1120288246 14:82533230-82533252 AATGAAAAGAAAGTCTGAACTGG + Intergenic
1120381721 14:83789280-83789302 AGTAAGAAGAAAGTATGAAAGGG + Intergenic
1120449905 14:84654219-84654241 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1120464879 14:84843573-84843595 GAAGAGAATAAAGTAGGGATGGG - Intergenic
1120557954 14:85953759-85953781 AAAGAGAAGTAGCTATGAAAAGG - Intergenic
1120638024 14:86975270-86975292 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1120722115 14:87900823-87900845 AAAGAGAAGAGAGGAAGAAGGGG + Intronic
1120723686 14:87915279-87915301 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1120948920 14:90023040-90023062 GAAGAGAATAAAGGATGAAGTGG + Intronic
1122380685 14:101304420-101304442 AAAGAATAGATAATATGAATAGG + Intergenic
1123577936 15:21691480-21691502 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1123614561 15:22133962-22133984 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1123679529 15:22749628-22749650 AAAGAACAAAAACTATGAATTGG - Intergenic
1124125374 15:26934282-26934304 AAAGGAAAGAAAGAAAGAATGGG + Intronic
1124331745 15:28824081-28824103 AAAGAACAAAAACTATGAATTGG - Intergenic
1124530916 15:30505560-30505582 AAAAAAAAGAAAATATGTATAGG - Intergenic
1124767741 15:32502135-32502157 AAAAAAAAGAAAATATGTATAGG + Intergenic
1125056324 15:35361775-35361797 AAGGAATAGAAAGTATGAAAAGG - Intronic
1125162522 15:36662544-36662566 TAATAGAAGAAAGTATGAGAAGG + Intronic
1125300350 15:38248411-38248433 AAAGAAAAGAAACTTTGAATAGG + Intergenic
1125908918 15:43418882-43418904 AAAAAGAAGAGAGTATGGAAAGG + Intronic
1126445716 15:48741313-48741335 AAAAAGAAGAAATTATAAGTGGG - Intronic
1126869344 15:52971148-52971170 AAAGATAAGCAAGAATGTATTGG + Intergenic
1126888173 15:53174941-53174963 AAAGAGGAGAGAGTAAGAGTGGG + Intergenic
1127184374 15:56462897-56462919 AAAGAGAAAATAATAAGAATAGG + Intronic
1127340281 15:58035145-58035167 AAAGAGAAATATGTATGAATAGG - Intronic
1127368202 15:58310806-58310828 AAGGAGAAGACAGTATGTGTCGG + Intronic
1127538511 15:59914049-59914071 AAGGAGAAAAAAGTATTAAAAGG - Intergenic
1127614031 15:60665682-60665704 AAAGAAAAGAAAGAAAGAATAGG - Intronic
1127655981 15:61056430-61056452 AAACAGAAGAAAGTAAAAAAGGG + Intronic
1127923683 15:63516916-63516938 AAAGAAAAAAAAGAATAAATTGG - Intronic
1127933434 15:63613065-63613087 ACAAAGAAGAAAGTAAAAATGGG + Intronic
1127934611 15:63624908-63624930 AAATAGATGAAATTATTAATGGG - Intronic
1128095694 15:64953086-64953108 AAAGAAAAGAAAGTATAAGAAGG - Intronic
1128100914 15:64999141-64999163 AAAGAAAAGAAAGAAAGAAATGG - Intergenic
1128315386 15:66656343-66656365 AAAAAGAAGAAGGTAGGAACAGG + Intronic
1128461668 15:67873389-67873411 AAAAAGAAAAATGAATGAATTGG + Intergenic
1128508356 15:68296812-68296834 AAAAAAAAAAAAGTATGACTTGG - Intronic
1128597701 15:68966113-68966135 AAAGAGAAGAAAGTGTTAAGAGG - Intronic
1128690671 15:69722328-69722350 CAAAAAAAGAAAGTATGAAATGG - Intergenic
1128893167 15:71349305-71349327 AAAGAGAAAAAAATAAGAAAGGG - Intronic
1128965555 15:72053887-72053909 GAAGAGAAAAAAGTCAGAATAGG + Intronic
1129004727 15:72363054-72363076 GAAGAGAAGAAAGTGGGCATGGG - Intronic
1129144899 15:73637895-73637917 AAAGAGAACAAAATATGCAAAGG - Intergenic
1129275737 15:74444123-74444145 AATAAGAAGAAAGGATGAAAGGG + Intergenic
1129396501 15:75251875-75251897 AAAGAGATGAAAATCTGAAGTGG - Intergenic
1129748317 15:78040673-78040695 AAAGAAAAGAAAGAAAGAAAGGG + Intronic
1130065368 15:80598516-80598538 AATAAGAAGAATGTTTGAATAGG - Intergenic
1130561414 15:84962413-84962435 AAAGAGAAGAAAGAAAGGGTGGG + Intergenic
1130585694 15:85180185-85180207 AAAAAAAAGAAAGTATAAAGTGG - Intergenic
1130608851 15:85342238-85342260 AAAGATGAGAACGTATGCATGGG - Intergenic
1130717324 15:86348058-86348080 AAAGAGAAGTAGGGGTGAATTGG - Intronic
1131131362 15:89902727-89902749 AAAGAAAAGCAACTGTGAATAGG + Intronic
1131278270 15:91000445-91000467 AGAGAGAATGAAATATGAATGGG + Intronic
1131581381 15:93646939-93646961 AAAGAAAAGAAAGTTTGAAAGGG + Intergenic
1131733668 15:95309327-95309349 AAAGAAAATAAATTAGGAATAGG - Intergenic
1131733717 15:95309657-95309679 AAAGTTAAGAAATTAGGAATAGG - Intergenic
1132005522 15:98223073-98223095 AAAGAGAAAAAAATATGTAGTGG + Intergenic
1202986806 15_KI270727v1_random:425725-425747 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1133096220 16:3448103-3448125 ACAGAGAAGAAAGGATGGGTTGG + Intronic
1133263940 16:4571831-4571853 AAAGAAAAGAAAGCATGGAGGGG - Intronic
1133289749 16:4711834-4711856 TAAGAAAAGAAAGTATGAGGAGG + Intronic
1133886838 16:9837482-9837504 AGAGAGAAAAAAATATCAATTGG - Intronic
1134174339 16:11993679-11993701 AAAGAGCAGAAATTAAGAACAGG - Intronic
1134315919 16:13118704-13118726 AAAGAAAAGAAAGAAAGAAATGG - Intronic
1134847485 16:17452266-17452288 AAACAAAAGAAAGTAGGAAAGGG - Intronic
1135066954 16:19318111-19318133 AAAGAAAAGAAAGAAAAAATTGG - Intronic
1135432325 16:22396145-22396167 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
1135640222 16:24113409-24113431 AAAGAAAAGAAAGAATGAGAGGG - Intronic
1135807703 16:25557589-25557611 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1135936376 16:26783864-26783886 AGAAAGAAGAAAGTTGGAATAGG + Intergenic
1136044377 16:27603601-27603623 AAAAAGAAGAAAGTAGGAAGGGG - Intronic
1136059684 16:27718018-27718040 ACAGAGCAGAAAATATCAATGGG - Intronic
1136706511 16:32192852-32192874 AAAGAACAAAAACTATGAATTGG + Intergenic
1136745075 16:32579539-32579561 AAAAACAAGAAAGGATCAATCGG + Intergenic
1137308975 16:47234669-47234691 AAATGGAAGAAAATATGACTTGG + Intronic
1137990831 16:53153359-53153381 GAAGAGAAGAAAGAATTACTGGG + Intronic
1138151692 16:54663109-54663131 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
1138723519 16:59110373-59110395 AAAGAAAGGAAAGTATGCTTGGG + Intergenic
1138732604 16:59211452-59211474 CAAGAGATGTAAGAATGAATGGG + Intergenic
1139042425 16:63014150-63014172 GAAGAAAAAAAAATATGAATGGG - Intergenic
1139169553 16:64614526-64614548 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1139539374 16:67602859-67602881 AAAGAGAAGAAAATCTTAATGGG + Intronic
1140043191 16:71423055-71423077 AAAAAGAAGAAAGAAAGAAAGGG + Intergenic
1140159187 16:72468093-72468115 AAAGAGAAAAAAGTATGTCCAGG - Intergenic
1140677832 16:77350958-77350980 AAAGATTAGAAAGTAATAATGGG + Intronic
1140986732 16:80165164-80165186 AGGGAGAGGAAAGTATGAACCGG + Intergenic
1141058779 16:80844215-80844237 AAAAAGAAAAAAGAATGAAAAGG + Intergenic
1141243274 16:82283038-82283060 AAAGAGATGAAAGGATAAACAGG - Intergenic
1141360850 16:83393872-83393894 AGAGAGAAGCAAGCATGAAGAGG + Intronic
1141551293 16:84808378-84808400 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1141609837 16:85175131-85175153 AAAGAGAAGAAAGAAAGAAGAGG + Intronic
1141899551 16:86982142-86982164 AAAAAGAAGAAAGAAAGAAAAGG + Intergenic
1142334813 16:89481050-89481072 ACAGAAAAGAAAGCAGGAATGGG - Intronic
1203047200 16_KI270728v1_random:838748-838770 AAAAACAAGAAAGGATCAATCGG + Intergenic
1203063554 16_KI270728v1_random:996882-996904 AAAGAACAAAAACTATGAATTGG - Intergenic
1142630834 17:1225166-1225188 AAAGAAAAGAAAGAAAGAAATGG + Intronic
1143499886 17:7332424-7332446 CAAGAGAAGAAAATAGCAATGGG - Intergenic
1143791784 17:9302472-9302494 AAATAGAAAAAAATAAGAATAGG - Intronic
1143958369 17:10693426-10693448 AAAGAGAAGAGAGTTACAATAGG + Intronic
1144277010 17:13680132-13680154 AGAGAGAAGAGACTTTGAATGGG - Intergenic
1144600455 17:16608302-16608324 GAAGAGAAGAAAGTGGGATTGGG + Intergenic
1145221924 17:21096585-21096607 AAAGAAAAGAAAAGAAGAATAGG + Intergenic
1145751424 17:27357591-27357613 AAATAAAAGAATGAATGAATTGG + Intergenic
1145984311 17:29034777-29034799 AAAGAGGGGGAAGAATGAATAGG + Intronic
1146045763 17:29504689-29504711 AAAGAAAAGAAAATATGATGGGG + Intronic
1146361726 17:32181864-32181886 AAAGAGAAAAAGGTATAAAATGG - Intronic
1146460692 17:33044022-33044044 TAAGAGCAGAAAATGTGAATTGG + Intronic
1146660251 17:34660780-34660802 AAAGAGAAGCCAGAAGGAATGGG + Intergenic
1146685498 17:34838823-34838845 GAGAAGAAGAAAGGATGAATGGG - Intergenic
1146707865 17:35014773-35014795 AAAGAGAAGGATGTCTGAATAGG + Intronic
1146766331 17:35525152-35525174 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1146947997 17:36887016-36887038 AAAGAGAAAAAAGAAAGAAAAGG + Intergenic
1147394882 17:40134483-40134505 AAAGTCAAGGAAGTATGAAAGGG - Intronic
1147432964 17:40385298-40385320 AAAAAAAAGAAATAATGAATAGG + Intergenic
1147650234 17:42057946-42057968 AAAAAGAAAAAAGAATGAAAGGG + Intronic
1147682250 17:42257751-42257773 AAAAAGAAGAAAGTAAACATTGG - Intronic
1147708494 17:42445666-42445688 AAAGAAAAGAAAGAAAGAAAGGG + Intergenic
1148273962 17:46286648-46286670 AAAGAGAAAAAAAAATGAAAAGG + Intronic
1148320882 17:46751554-46751576 AAAGGGAAGAAGGTCTGGATAGG + Exonic
1148712046 17:49689035-49689057 AAAGTGAAGACAGTGTGAAGAGG - Intergenic
1148724415 17:49778150-49778172 AAAAAAAGAAAAGTATGAATAGG - Intronic
1148967540 17:51448432-51448454 TAAGAGAAAAAAGAATGAAAAGG + Intergenic
1149219299 17:54397656-54397678 AAAGCTAAGAAAGTTAGAATTGG + Intergenic
1149252815 17:54789524-54789546 AAGGAGAAGAAAATATGAACAGG - Intergenic
1149281123 17:55107133-55107155 TTAGAGAAGAAAGAATGAAAAGG - Intronic
1149360005 17:55885160-55885182 AAAGAAAAGAAAGTATTCAGAGG + Intergenic
1149875397 17:60227563-60227585 AAAGAAAAGAAAAACTGAATGGG - Intronic
1150294433 17:64000309-64000331 AAAGAAAAGAAAAAAAGAATGGG - Intronic
1150460037 17:65342930-65342952 AAGGAGAAGAAAGAAAGAAAAGG - Intergenic
1150546967 17:66169265-66169287 AAAAAGAAGAAATTAAAAATTGG - Intronic
1150668188 17:67165025-67165047 AAAGAAAAGGAAGCATGAAGAGG + Intronic
1150730769 17:67691429-67691451 AAAGAAAAAAAAGCATGACTTGG - Intronic
1150889493 17:69130889-69130911 TAAGTGAAGAAATCATGAATAGG - Intronic
1150915657 17:69434162-69434184 ACAGAGAAGAGAGTTTGCATGGG + Intronic
1151091185 17:71441726-71441748 AAATAGAAGAAAGTTTGAGAAGG - Intergenic
1151413255 17:73944998-73945020 AATAAGAAGAAAGAAAGAATCGG - Intergenic
1151438241 17:74111777-74111799 AAAGTGAAGAAGTTATGGATTGG - Intergenic
1152034082 17:77861320-77861342 GAAGAGAAGAAAGAGTGGATGGG + Intergenic
1152185145 17:78851311-78851333 AAAGAAAAGAAAGAAAGAAGGGG + Intergenic
1152979365 18:261228-261250 AAATAGAAGGAAGAATGAGTAGG - Intronic
1153094461 18:1384559-1384581 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1153171904 18:2326389-2326411 AAAGGGAAAAAAGAATGACTTGG + Intergenic
1153178987 18:2411602-2411624 AAAGAGCAGGAAGTAGGACTTGG - Intergenic
1153190210 18:2529755-2529777 AAAGAAAAAAAAGAATGACTAGG + Intergenic
1153313268 18:3698839-3698861 TTAGAGAAGAAAGAATGAAAAGG - Intronic
1153328240 18:3844129-3844151 AAAGATGAGACAGTAGGAATAGG + Intronic
1153416524 18:4851581-4851603 AAAGAGGAAAAAATATGACTTGG - Intergenic
1153440101 18:5107592-5107614 AAATAAAAGAAAGAATGACTGGG + Intergenic
1153678231 18:7475104-7475126 ACAAAAAAGAAAGTATCAATGGG - Intergenic
1153858216 18:9172417-9172439 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1154339198 18:13489143-13489165 AAAAAAAAGAAAGAAAGAATGGG - Intronic
1155011850 18:21786629-21786651 GAAGAGAAAAAAGAATGAAAAGG - Intronic
1155116383 18:22772506-22772528 AAAAAATAGAAAGAATGAATAGG + Intergenic
1155212916 18:23618797-23618819 AGAAAGAAGGAAGAATGAATTGG + Intronic
1155442009 18:25871879-25871901 AAAGAGAAGGAAGAAGGAAGCGG + Intergenic
1155472644 18:26207044-26207066 AAAAAGAAGAAGCTATGAGTTGG - Intergenic
1155842255 18:30660123-30660145 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1155852674 18:30792335-30792357 AAGGACAAGAGAGTATAAATAGG + Intergenic
1155871230 18:31030886-31030908 AAAGAGAAACAAGGATAAATAGG - Intronic
1155880661 18:31144599-31144621 AGAGAGAAGAAGGCATCAATAGG + Intronic
1155881519 18:31155035-31155057 AAGCAGAAGAAAGAAAGAATAGG - Intronic
1156173628 18:34516261-34516283 AAGGGGAGGAATGTATGAATAGG + Intronic
1156209998 18:34929062-34929084 AGAGAGGAAAAAATATGAATTGG + Intergenic
1156329764 18:36109136-36109158 AAAGAGAAGAATCTGAGAATTGG - Exonic
1156569090 18:38232497-38232519 AGAGGGAAGAGAGTAAGAATTGG - Intergenic
1156842390 18:41624769-41624791 ACAGAGAAGAAAAAATGAAAAGG - Intergenic
1156896702 18:42254967-42254989 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1157411922 18:47470153-47470175 TAATAGAAGCAAGTATGATTGGG - Intergenic
1157540381 18:48498124-48498146 AAAGAGAAGAAAGAGTGAAAAGG + Intergenic
1158156472 18:54431072-54431094 AAAGAGAATGAATTATGAACTGG - Intergenic
1158312758 18:56176589-56176611 AAAGAGAAGAAAGGCTGACTAGG - Intergenic
1158765488 18:60446018-60446040 ATAGAGAAAAAAGAATGAAGAGG - Intergenic
1159183093 18:64935240-64935262 TAGGAGAAGAAAGTATAAATTGG - Intergenic
1159287141 18:66368985-66369007 GAAGAAATAAAAGTATGAATGGG + Intergenic
1159429421 18:68332256-68332278 TAAGAGAAGATAGCATGAAATGG - Intergenic
1159502060 18:69285885-69285907 AAAAAGAAGAAAGAAAGAAGAGG + Intergenic
1159566682 18:70058951-70058973 AAAGAGAAGACACTATGATTTGG + Intronic
1159907087 18:74103328-74103350 AAAAAGAAAAAAGAATGAAAAGG + Intronic
1160105809 18:75974935-75974957 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1160314005 18:77823155-77823177 AAAGAGAAGAAAATAAAAAGGGG + Intergenic
1160409202 18:78663619-78663641 AAAGAGAAGAAAGCATCAGAAGG - Intergenic
1160435584 18:78849847-78849869 AATGAGAAGAAAGTAAAAAAAGG - Intergenic
1160711156 19:551575-551597 AAAGAAAAGAAAGAAAGAGTTGG - Intergenic
1160824251 19:1072044-1072066 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
1161111556 19:2473669-2473691 AAAAAAAAGAAAGAAAGAATGGG - Intergenic
1161276843 19:3423221-3423243 AAATAGAAGAAAGTAATAATGGG + Intronic
1161641991 19:5429976-5429998 AGAGAGAAAAAAAAATGAATAGG + Intergenic
1161644085 19:5442528-5442550 AAAGAAAAGAAAAAAAGAATGGG - Intergenic
1162369946 19:10272536-10272558 AAAGAAAAGAAAGAAAGAAGGGG - Intronic
1162404019 19:10462706-10462728 GATGAGAAGAAAGGAGGAATTGG - Intronic
1162404695 19:10466858-10466880 GAGGGGAAGAAAGTATAAATGGG - Intronic
1162516891 19:11153770-11153792 AAAAAGAAGAAAATATGGCTGGG + Intronic
1162761695 19:12892251-12892273 AAAGAGAAGGAAGGAAGAAAGGG - Intronic
1162865336 19:13541705-13541727 AAAAAGAAGAAAGAAAGAAAAGG + Intronic
1162865353 19:13541802-13541824 AAAGAGAAAAAAGAAAGAAAAGG + Intronic
1164029476 19:21389213-21389235 GAAGGGAAGAAAGAAAGAATTGG + Intergenic
1165002969 19:32780065-32780087 AAAGAAAAGAAAAAAAGAATGGG - Intronic
1165271188 19:34709142-34709164 AAAAAGAAAAAAGTAGGAAATGG - Intergenic
1165534841 19:36435050-36435072 AAGAAGAAGAAAATATGTATAGG + Intergenic
1165708441 19:37992657-37992679 AAAAAAAAAAAATTATGAATGGG + Intronic
1165815136 19:38637185-38637207 AAGGAGGAGGGAGTATGAATGGG + Intergenic
1165983804 19:39749744-39749766 AAATATAACAAAGTAAGAATAGG - Intergenic
1166179595 19:41098292-41098314 AGGGAGGAGGAAGTATGAATAGG + Intergenic
1166442924 19:42831734-42831756 AATGAGAAGAAAGTAGGAGGAGG - Intronic
1166450707 19:42898154-42898176 AATGAGAAGAAAGTAGGAGGGGG - Intronic
1166462609 19:43002496-43002518 AATGAGAAGAAAGTAGGAGGAGG - Intronic
1166989340 19:46681829-46681851 AAAAAAAAAAAAGTATGGATGGG - Intronic
1167223891 19:48223427-48223449 AAAGAGATGAAACTATGATGGGG + Intronic
1167302773 19:48688510-48688532 AAAGAGAAGAAAGTAACCCTTGG + Intergenic
1167337717 19:48896856-48896878 AAAGAAAAGAAAATAGGAATTGG - Intronic
1167340395 19:48912493-48912515 AAAGAGAAGAAAGTGTGTTATGG + Intronic
1167959313 19:53093450-53093472 AAAAAGAAGAAAGGATGGAAGGG + Intronic
1168080479 19:54006503-54006525 AAAGAAAAGAAAGAAGGAACTGG - Intronic
1168609361 19:57786774-57786796 ACTGAGAACAAAGTATGAGTCGG + Intronic
925610756 2:5699929-5699951 AAAGTGCAGAAAGTATAAAACGG + Exonic
925637469 2:5953947-5953969 AGGGAGAGGAAAGAATGAATAGG + Intergenic
926483298 2:13426489-13426511 TTAGAGAAGAAAGAATGAAAAGG - Intergenic
926782546 2:16487307-16487329 AAAAAGAAGAAAGAAAGAAAAGG - Intergenic
927016686 2:18970709-18970731 AAAGAGAAGAAATGTTGAAAAGG - Intergenic
927122233 2:19976678-19976700 AAAAAAAAAAAAGTATCAATTGG - Intronic
927251677 2:21000374-21000396 AAGGCCAAGAAAGTATGATTGGG - Intergenic
927390620 2:22590734-22590756 TTAGAGAAAAAAGAATGAATAGG + Intergenic
927699457 2:25258726-25258748 AAAGAGCGGAAACTAGGAATGGG + Intronic
928477147 2:31640028-31640050 AAAAAGAAGAAAGAATGAAAAGG - Intergenic
928803843 2:35126670-35126692 AAAGAGAAAAAAGAATGAAACGG + Intergenic
928887000 2:36161361-36161383 AAAAAAAAAAAAGTATGATTAGG + Intergenic
928908922 2:36398924-36398946 AATGCCAAGAAAGTATGATTTGG + Intronic
929074154 2:38064195-38064217 AAAGAGAAGAAACTGAGATTAGG + Intronic
930145442 2:47997876-47997898 AATGATAAGAAAATATGAATAGG - Intergenic
930474209 2:51859267-51859289 AAAGAGTGGAAAGAATGAATAGG - Intergenic
930557538 2:52917934-52917956 AGAGAGAGGAAAATATGGATTGG - Intergenic
930823143 2:55668230-55668252 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
931281678 2:60799545-60799567 AAAAAGGAGAAAGTATGATCTGG + Intronic
931389263 2:61826560-61826582 AAATAGAAGAAAGAGAGAATGGG - Exonic
931438599 2:62270587-62270609 AAAGAAAAGAAATAGTGAATAGG + Intergenic
931792426 2:65676544-65676566 TGAGAAAAGAAAGTAAGAATTGG + Intergenic
931855775 2:66300401-66300423 AAAGAGAAGAAAGGAAAAATAGG + Intergenic
932033066 2:68210196-68210218 AAAGAGGAGATTGTAAGAATTGG - Intronic
932108724 2:68973422-68973444 AGAGAGTAGAAACTATCAATTGG - Intergenic
932152763 2:69387629-69387651 AAAAAGCAGGAAGTATGAAAAGG + Intergenic
932454555 2:71840360-71840382 AAAGAGATGGAAATATAAATGGG - Intergenic
932523519 2:72439414-72439436 ACAGAGAAGAAAGAATGAAAAGG - Intronic
932539838 2:72640310-72640332 ATAGAGAAAAAAGAATGAAAAGG + Intronic
932826893 2:74949168-74949190 ATAGAGAAAAAAGAATGAAAGGG + Intergenic
933469979 2:82709919-82709941 ATAGAGAAGAAAGTATAATAGGG + Intergenic
933477057 2:82804309-82804331 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
933597770 2:84299950-84299972 AAATAGATGAAAGAATGGATTGG + Intergenic
933646467 2:84816866-84816888 AATGAGAAGAGAGAATGAACTGG + Intronic
934508357 2:94915679-94915701 GAAGAGAAGGAAGGATGCATAGG + Intergenic
934886045 2:98026141-98026163 AAAGAGTAGAAAATATAAAAAGG - Intergenic
935101082 2:99996981-99997003 AAAGAGAAGAAGGGATCAGTAGG - Intronic
935351700 2:102156411-102156433 AAAGTGAAGAGAATATGAATGGG + Intronic
935378995 2:102431583-102431605 AAAAAGAAAAAAGAATGAAAAGG - Intronic
935506563 2:103911904-103911926 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
935527185 2:104184509-104184531 AATGAGATTAAAATATGAATTGG + Intergenic
935554211 2:104489900-104489922 AAATAGGAGAAAGTCTGAGTAGG - Intergenic
935848182 2:107188971-107188993 ATACAGAAGAAAGGATGAAAAGG + Intergenic
935894211 2:107716257-107716279 AAAGAGAAAAAAGGAAGAAAGGG - Intergenic
935901800 2:107800615-107800637 AAAAAAAAAAAAGTATGACTGGG + Intergenic
936273790 2:111073266-111073288 AAAGAGAAAAATGGATAAATTGG - Intronic
936277153 2:111109437-111109459 AAAGAGAAAAAAAAATGAACAGG - Intronic
936498666 2:113047726-113047748 AAAGTGTAGAAAGAAAGAATTGG + Intronic
936848938 2:116872901-116872923 CTAGAGAAAAAAGAATGAATAGG - Intergenic
936927151 2:117749007-117749029 AAAGAGACCAAAGAATGACTTGG + Intergenic
937169236 2:119848897-119848919 ACAGAGAAAAAAGAATGAAGAGG - Intronic
937693199 2:124779356-124779378 AAGAAAAAGAAAGTATGAATGGG - Intronic
937813034 2:126220088-126220110 AAAGAGAACAGAATATGGATGGG + Intergenic
937931656 2:127209809-127209831 ATAGAGAAAAAAGAATGAAAAGG + Intronic
938161158 2:128985648-128985670 AAAGAGAGGAAAGTAAAAGTTGG - Intergenic
938321601 2:130369987-130370009 AAAAAGAAAAAAGCATTAATTGG - Intronic
938550649 2:132378681-132378703 AAAGTGAATAAAATATAAATGGG - Intergenic
938828153 2:135027393-135027415 AAAGAAAAGAAAGAAAGAAAAGG + Intronic
938909019 2:135868247-135868269 ATAGAAAGGAAAGCATGAATAGG - Intronic
938939482 2:136156771-136156793 AAAGAGAAGAAAATTTAAAGAGG + Intergenic
938973650 2:136455425-136455447 ACAGAGAAGCAAGTTTGAAAGGG - Intergenic
939132440 2:138253353-138253375 CAAAAAAAAAAAGTATGAATTGG - Intergenic
939201953 2:139047002-139047024 AAGGAGAAGAAAGAGAGAATGGG + Intergenic
939657311 2:144843886-144843908 AAAGAAAAGAAAAAAAGAATGGG + Intergenic
939687001 2:145212523-145212545 TTAGAGAAGAAAGAATGAAAAGG - Intergenic
939689006 2:145234796-145234818 AAAGAGAAGAAATTAACAAGTGG - Intergenic
939833152 2:147096743-147096765 AAGAAGAAGAAAGTAAGAAATGG + Intergenic
940223396 2:151377144-151377166 AAAGAAAAGAAAATGTAAATTGG - Intronic
940309709 2:152264862-152264884 AAAGAGAAGAAAATCGGAAATGG + Intergenic
940323641 2:152402404-152402426 AAAGAGCAGAAAGTGCCAATTGG + Intronic
940638949 2:156328682-156328704 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
940687321 2:156869074-156869096 AAAGAGTAGAAAAAAAGAATGGG + Intergenic
940769579 2:157825839-157825861 GAAGAGAAGAAAGAAGGAAATGG + Intronic
940787379 2:157996291-157996313 AAAGAAAAAAAAGTATGTTTAGG - Intronic
940982191 2:160016286-160016308 AAAGAAAAGAAAGAAAGACTAGG + Intronic
941310609 2:163925773-163925795 AGAGAAAAGAAAGAATGGATGGG - Intergenic
941360680 2:164547508-164547530 AAAAAGAAAAAAGAATGAAAAGG + Intronic
941441091 2:165537765-165537787 AAAGAGAAGAAAATAGAAATGGG - Intronic
941448492 2:165630407-165630429 AAAGAGAAGGCATTATAAATGGG - Intronic
941479383 2:165987319-165987341 AAACAGAAGAAAGTATACTTTGG - Intergenic
941523365 2:166576746-166576768 AAATTGAAGAAAATATGAACAGG - Intergenic
942160251 2:173177870-173177892 AAAAAGAAGAAAATCTGAAGTGG + Intronic
942259434 2:174143756-174143778 AAAGAGAATAAAGGAGGAAGGGG + Intronic
942340918 2:174945610-174945632 AAAATGAAAAAAGAATGAATAGG + Intronic
942364547 2:175210065-175210087 AAAGAGTAGAAAGCAAAAATAGG - Intergenic
942590041 2:177534001-177534023 AAAAAGAACAAATTATGAAATGG - Intronic
942627940 2:177923390-177923412 AAAGAAAAGAAAGTAAGTACAGG + Intronic
942752200 2:179300839-179300861 AAAGAGAAACAAGTATCATTTGG + Intergenic
942924231 2:181412549-181412571 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
942965118 2:181883143-181883165 AAAAAGAAGAAGGAATGAAGAGG + Intergenic
943038663 2:182777072-182777094 AGAAAGGAGAAAGTATGAGTTGG - Intronic
943119358 2:183715060-183715082 AGTAAGGAGAAAGTATGAATTGG + Intergenic
943119800 2:183721539-183721561 AAAAAGAACAAAGTAGGAATGGG + Intergenic
943152919 2:184137325-184137347 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
943533571 2:189118492-189118514 GCAGAGAATAAAGAATGAATTGG - Intronic
943548828 2:189313156-189313178 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
943809940 2:192172246-192172268 GAAGGGAAGAAAGTAAGATTGGG - Intronic
943960840 2:194261756-194261778 ATGGAGAAGAAAGCATGTATTGG + Intergenic
944176979 2:196841508-196841530 TAAAAAAAGAAATTATGAATAGG - Intronic
944379785 2:199094870-199094892 GGAAAGAAGAAAGGATGAATGGG + Intergenic
944477842 2:200125515-200125537 AAAGAGAAGACAGAAGGAATAGG + Intergenic
944914217 2:204341303-204341325 AAATAGAAAAAAGTAAGAATGGG + Intergenic
944915985 2:204360786-204360808 AAAGAGATGAAAGGTTGAAGTGG - Intergenic
945119342 2:206442786-206442808 AAAGTTCAGAAAGTATGACTGGG - Intergenic
945462447 2:210125266-210125288 AAAGAAAAGAAAATTTGAATAGG + Intronic
945481427 2:210350237-210350259 TAAGAGAAAAAAGTATGAAAAGG - Intergenic
945808580 2:214520218-214520240 AAAAAGAAGCAAGTATATATGGG - Intronic
946103598 2:217350208-217350230 ATAGAGAAAAAAGAATGAAAAGG - Intronic
946119141 2:217493910-217493932 AAATGGAAGAAAGGAGGAATGGG - Intronic
946439819 2:219685727-219685749 AAAGAAAAGAAAGAAAGAAAGGG - Intergenic
946499706 2:220234597-220234619 AAAGAAAAGAAAGAAAGAAAAGG + Intergenic
946648854 2:221869555-221869577 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
946667440 2:222066004-222066026 AAAAAAAAAAAAGTATGAATTGG - Intergenic
946764776 2:223030359-223030381 AGAGAGAAGACAGGATAAATAGG - Intergenic
947067792 2:226250103-226250125 AAAGAAAAGAAAGAAAGAAGGGG + Intergenic
947098190 2:226590770-226590792 ACAGAGAAAAAAAAATGAATAGG - Intergenic
947308469 2:228774067-228774089 TAAGGGAAGAAAGTAGAAATAGG - Intergenic
947576537 2:231279476-231279498 AAAGAAAAGAAAGAAAGAAATGG - Intronic
947771249 2:232672059-232672081 AAAAAAAAAAAAGTTTGAATCGG + Intronic
948617433 2:239209820-239209842 GAACAGCAGAAGGTATGAATGGG + Intronic
948685279 2:239666046-239666068 AAAGAAAAGAAAGTTTGGTTGGG + Intergenic
948993508 2:241566276-241566298 AAAGAAAAAAAAGAAAGAATAGG - Intronic
1169280003 20:4258954-4258976 AAAGAGATGAAAGAACAAATGGG + Intergenic
1170000437 20:11608352-11608374 AAAGTGGAGAAAGTGGGAATAGG - Intergenic
1170237850 20:14127560-14127582 GAAGAGAAGAAACTTTGAGTAGG + Intronic
1170256355 20:14348304-14348326 AAAGAAAAGAAAAGATGTATCGG + Intronic
1170341405 20:15331661-15331683 GAAGAGAAGAAAGTCTGGTTGGG - Intronic
1170915659 20:20622214-20622236 AAAGAGAAAATACAATGAATAGG + Intronic
1171060180 20:21949147-21949169 AAGGAGAAAACAGTATGAAAGGG - Intergenic
1171503556 20:25614391-25614413 AAAAAAAAGAAAGTATAAAGGGG - Exonic
1172038170 20:32025117-32025139 AAAGAAAAGAAAGAAAGAAAGGG - Intronic
1172235920 20:33374432-33374454 AGAGAGAAGAAAGTAAGCAGAGG + Intronic
1172474903 20:35229214-35229236 AAAGAGAAGGAAGGAGGAAGAGG - Intronic
1173730689 20:45326328-45326350 AAAGAGAACAAAGAAAGAAGAGG + Exonic
1173801158 20:45895294-45895316 AAAAAGATAAAAGAATGAATTGG - Intronic
1174323419 20:49760302-49760324 AAAGGGAGGAAAGTATGAAGAGG - Intergenic
1174717459 20:52775108-52775130 AAAGAAAAGAAAGAAGGAAGAGG + Intergenic
1174757565 20:53174900-53174922 AAATAAAAGAAAAAATGAATAGG + Intronic
1174958776 20:55131722-55131744 AAAGAAAGGAGAGTATGATTGGG - Intergenic
1174967163 20:55229787-55229809 AAAAAAAAGAAACCATGAATAGG - Intergenic
1174983076 20:55419491-55419513 AAAGGGAAGAAAGGAGGAAGAGG - Intergenic
1175482800 20:59323304-59323326 AAAGAGGAAAAAGAATGAAGAGG - Intronic
1176071289 20:63227744-63227766 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1176977290 21:15336373-15336395 AAAGATGGGAAAGTAGGAATGGG - Intergenic
1177047463 21:16187892-16187914 AAAAAGAAGAAAGAAAGAAAGGG - Intergenic
1177223915 21:18229147-18229169 AAATGGAAGAAAGTATAAAGAGG + Intronic
1177280230 21:18972761-18972783 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1177313365 21:19425602-19425624 GTAGAGAAGAAAGAATGAAAAGG + Intergenic
1177385851 21:20408530-20408552 AAAGAGAAGAGAGTATAATGAGG - Intergenic
1177426025 21:20923541-20923563 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1177552216 21:22638836-22638858 AAGTAGAAGAAAGAATGAGTGGG - Intergenic
1177573376 21:22919587-22919609 AAAGAAAAGAAAGAAAGAAAAGG + Intergenic
1177688513 21:24472025-24472047 AAAGAGAAGGAAGTGTGGTTTGG + Intergenic
1178043963 21:28673202-28673224 AGAAAGAAGAAAGGATGAAAGGG + Intergenic
1178089950 21:29151545-29151567 AAAGAGGAAAAAATATGACTAGG - Intronic
1178125896 21:29515455-29515477 AAAGAGAAGAATTTATCTATTGG - Intronic
1178249658 21:30990228-30990250 AAAGAGAAGTAATTAAGAACTGG - Intergenic
1178312023 21:31537448-31537470 AAAAAAAAAAAAGTATTAATAGG + Intronic
1178431575 21:32522537-32522559 AAAGAGAAGAAGGGATCAAAGGG - Intergenic
1178471945 21:32901672-32901694 AAAAAGAAGAAAGAAAGAAAGGG + Intergenic
1178614655 21:34121474-34121496 AAAGAAAGGAATGAATGAATGGG - Intronic
1178751446 21:35307926-35307948 TAAGAGAAGAATGCATGACTGGG - Intronic
1178984766 21:37293456-37293478 AAAAAGAAGAAAGAAAGAAATGG - Intergenic
1180128952 21:45813110-45813132 GAAGAGAAGAAAGACTGAAATGG - Intronic
1181004137 22:20001797-20001819 AAAGAAAAGAAAGAAAGAAAAGG + Intronic
1181156181 22:20922574-20922596 AAAGGGAAGAAGGGATGATTTGG + Intronic
1181526150 22:23489477-23489499 AATGAGAAAAAAATATTAATTGG + Intergenic
1181836254 22:25611788-25611810 AAAGAAAAAAATGTATAAATTGG - Intronic
1182026018 22:27120000-27120022 GAAGACAAGAAGGTATGAAAGGG - Intergenic
1182610567 22:31543823-31543845 AAAGAAAAAAAACTATGAGTGGG + Intronic
1182848149 22:33448425-33448447 TAAGAAAAGAAAGTATTACTTGG + Intronic
1182923095 22:34098088-34098110 AAAGAAAAGAAAATATAAAGGGG + Intergenic
1182970066 22:34565451-34565473 AAAGAAAAGAAAGAAAGAAATGG - Intergenic
1183051666 22:35266995-35267017 AAAGAAAAGAATCTAGGAATGGG + Intronic
1183176782 22:36230290-36230312 GAAGAGAAGAAGGTCTGAAAGGG + Intronic
1183474506 22:38028639-38028661 ATAGAGAAGAAAGCAGAAATTGG + Intronic
1183789563 22:40055042-40055064 AAAGAAAAGAAATTATGCTTGGG + Intronic
1183848532 22:40563216-40563238 AAAGAGAAGGAAGTAGGATGGGG - Intronic
1184279650 22:43429732-43429754 AAAGAGAAGAGAGTGAGAACGGG + Intronic
1184316334 22:43694200-43694222 AAAGAGAGGAGAGAAAGAATGGG + Intronic
1184337152 22:43860673-43860695 AAGGAAAAGAAAATATGAACTGG + Intronic
1184707750 22:46226453-46226475 CAAATGAAGAAAGTAGGAATTGG + Intronic
1185006536 22:48280117-48280139 AAAGAGAGGAAAGAAAGAAAGGG + Intergenic
1185308050 22:50133464-50133486 AAAAAAAAGAAAGAAAGAATGGG + Intronic
1203290107 22_KI270735v1_random:28349-28371 AAAGAAAAGAAAGTAAAAAAAGG - Intergenic
949240894 3:1870199-1870221 AAAAATAAGAAAATAAGAATGGG + Intergenic
949268744 3:2189647-2189669 AGAGAGAGGAAAGTCAGAATGGG - Intronic
949812838 3:8025515-8025537 AAAGAGAAGAAAGACAGAAAGGG - Intergenic
949986575 3:9545914-9545936 AAAGAAAAGAAAGAAAGAAATGG + Intronic
950225653 3:11231836-11231858 AAAAAGAAAAAACAATGAATTGG - Intronic
950759798 3:15211591-15211613 AAAAAAAAAAAAGTATGATTTGG + Intronic
950839900 3:15957863-15957885 AAGGAGACGAATGAATGAATAGG - Intergenic
950955090 3:17044370-17044392 AAAAAGAAGAAAGTACAGATTGG - Intronic
951151907 3:19300267-19300289 AAAGAAAAGAAAATATGAACAGG + Intronic
951215057 3:20015989-20016011 AAAAAGGAGAATGCATGAATTGG - Intergenic
951215661 3:20022404-20022426 CAGGAGAAGAAGGGATGAATAGG + Intergenic
951486287 3:23215005-23215027 AAGGAAAAGAAAGGAAGAATAGG - Intronic
951858618 3:27225753-27225775 AAATGGGAGAAAGTATGTATTGG - Intronic
952031720 3:29150789-29150811 AAACAGAAAAAATTTTGAATTGG + Intergenic
952444626 3:33369009-33369031 AAAGAGAAAAAAGGATGTATGGG - Intronic
952484003 3:33790889-33790911 AAAGATAAGAAATTATTACTTGG + Intergenic
953384409 3:42498409-42498431 AAAGAGGAGAAAGTAGGATTGGG - Intronic
953652111 3:44816019-44816041 AAAAAGAAAAATGTATGTATAGG - Intronic
953688537 3:45097332-45097354 AAAGAAAAGAAAAAAAGAATAGG + Intronic
953701145 3:45196737-45196759 AGACAGAAGAAAGGAGGAATGGG + Intergenic
954294020 3:49664266-49664288 AAAGAGAAGAAGGTAAGAACAGG - Intronic
954491389 3:50909916-50909938 ATAGAGAAGAAAGAATGAAAAGG - Intronic
954842110 3:53520986-53521008 AAAAAGAAGAAAGAAAGAAAAGG - Intronic
954917327 3:54159835-54159857 AAAGAGACAAAATCATGAATAGG + Intronic
954932853 3:54298981-54299003 AAAGAGGAAAGAGTATGGATGGG + Intronic
955142258 3:56280895-56280917 AAAGAGAATAAATCCTGAATGGG + Intronic
955582112 3:60434844-60434866 AAAGAGTAGAAACTATGATTTGG - Intronic
955720479 3:61875136-61875158 AAAGAGAAGAAACTGAGAAGAGG - Intronic
955965063 3:64380614-64380636 AAAGAGAAGATGGTAAGTATTGG + Intronic
956111123 3:65870723-65870745 AAAAAAAAGAAAGAATGAAAAGG + Intronic
956183173 3:66536335-66536357 AAAGAAAAAAAAGGATGAATTGG + Intergenic
956188475 3:66584932-66584954 ACAGGGAAGAAGGGATGAATAGG - Intergenic
956207527 3:66770205-66770227 TTAGAGAAAAAAGTATGAAAAGG - Intergenic
956315367 3:67929509-67929531 AAAAAAAAGAAAATATAAATGGG + Intergenic
956315811 3:67935176-67935198 AAAGAAAAAAAATTATAAATTGG + Intergenic
956386353 3:68724076-68724098 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
956691765 3:71885103-71885125 AGAGCAAAGAAAGGATGAATGGG + Intergenic
956953783 3:74313223-74313245 AAAGAGAAGAAAGGGAGAAAGGG + Intronic
956999252 3:74865848-74865870 ATGAAGAAGAAAGTATGGATTGG + Intergenic
957146458 3:76430481-76430503 AAATAGAAGAAAATAAAAATAGG - Intronic
957291498 3:78282752-78282774 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
957504003 3:81096296-81096318 AAAGGAAAGAAAGTCAGAATTGG - Intergenic
957824969 3:85429970-85429992 AAAGTGAACAAATTATGCATAGG + Intronic
958019927 3:87982367-87982389 AAAAAGAAGAAAGTCTGTCTTGG + Intergenic
958039518 3:88209210-88209232 AAAAAGAAGAAAGAAAGAAACGG - Intergenic
958115296 3:89208381-89208403 AAAGAAAAGAAAGAAAGAAAAGG + Intronic
958122510 3:89309832-89309854 AAAGAGAAGAAAGAAGGAATGGG - Intronic
958704346 3:97634816-97634838 GAAGAGAAGAAAGCAGGATTGGG - Intronic
958759468 3:98290660-98290682 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
958992708 3:100865755-100865777 CAAGAGAAAAAAGTATAATTGGG + Intronic
959092925 3:101923742-101923764 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
959368601 3:105494460-105494482 AAAGAGAAGAAAGGAAGAAAGGG - Intronic
959418222 3:106103237-106103259 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
959450672 3:106495892-106495914 AATGAGAAGAAAATATGTCTAGG + Intergenic
959660375 3:108861749-108861771 AAATGGAATAAAGGATGAATAGG - Intergenic
959995991 3:112680743-112680765 AAAGAGAAAAAAAGATAAATTGG - Intergenic
960113767 3:113872372-113872394 AAAGAAAAAAAAGAATGAAGTGG - Intronic
960320911 3:116234294-116234316 AGAAAGAAGAAAGAATGAAAGGG + Intronic
960396661 3:117146033-117146055 AAAGAAAATAACTTATGAATTGG + Intergenic
960429554 3:117551858-117551880 AAAGAGAATAAAATATGGCTGGG - Intergenic
960794306 3:121468620-121468642 AAATAAATGAATGTATGAATTGG + Intronic
960837855 3:121926080-121926102 AGAAAGAAGAATGTATGAAGGGG + Intronic
961042548 3:123687665-123687687 AAAAAGAAGAAAGGAAGAAAAGG - Intronic
961418427 3:126779881-126779903 AAAGAGAAGTAAAGATAAATAGG - Intronic
962168618 3:133077307-133077329 AAAGAGAAAAAAATATGAGTAGG - Intronic
962182833 3:133226573-133226595 AAAGGGAAGAAAGTATAATAAGG + Intronic
962227050 3:133621981-133622003 AAAGGGAAGAAAGAAGGAAAGGG + Intronic
962464751 3:135647896-135647918 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
963318267 3:143784487-143784509 AAAGAAAAGAAAATAAGACTTGG - Intronic
963460740 3:145611528-145611550 AAAGAGAGGAAAGTGAGAACAGG - Intergenic
963626358 3:147679149-147679171 AAAGAGAAGAAAGAAAGAAAAGG - Intergenic
963667778 3:148211611-148211633 AAAGAGAAAAAAATAACAATTGG - Intergenic
963686003 3:148434729-148434751 CAAGAGAAGTAACTATGAAAAGG - Intergenic
963812247 3:149789426-149789448 AAAGAGAAGACATTAAGAAGTGG + Intronic
964147782 3:153486392-153486414 AAAAAGAAGAAAGAAAGAAAAGG - Intronic
964437394 3:156668795-156668817 AAACAGATAAAAGTGTGAATAGG - Intergenic
964519685 3:157551235-157551257 AAAAAGAAAAAAGAATGAATAGG - Intronic
964581750 3:158247074-158247096 ATAGAGAAAAAAGAATGAAAAGG - Intronic
964613772 3:158641086-158641108 AAAGAAAAGAAAGGATTAATGGG - Intergenic
964736090 3:159919561-159919583 CAAAAGAAAAAACTATGAATTGG + Intergenic
964913762 3:161814247-161814269 AAAGACCAGAAAGCAAGAATAGG - Intergenic
965030535 3:163360202-163360224 AAAGAGAAAATTGTATGTATTGG + Intergenic
965071759 3:163923953-163923975 CAAGAGACAAAAGTATGCATTGG - Intergenic
965074266 3:163956326-163956348 AAAGAGAAAAGACTTTGAATAGG + Intergenic
965211795 3:165799948-165799970 AAATAGTAGAAAATATGGATGGG - Intronic
965283604 3:166786460-166786482 ATAGAGCAGAAAGTATGTTTTGG + Intergenic
965488989 3:169313733-169313755 AAATAGAAGAAGGTATAAAATGG + Intronic
965766297 3:172133974-172133996 CAAGAGAAGAAATTATGAAAGGG + Intronic
965858225 3:173114847-173114869 AAAGAAAAGAAAGGCTGAAAAGG + Intronic
965966328 3:174494699-174494721 AAAAAGAGGAAGGTATGAGTTGG + Intronic
966017949 3:175166364-175166386 GAAGAGAGCAAAGAATGAATGGG - Intronic
966022468 3:175232273-175232295 AGTGGGAAGAAAGCATGAATAGG + Intronic
966036207 3:175419443-175419465 AAACAGATGAAATTATGAAGTGG + Intronic
966403303 3:179568513-179568535 AAAAAAAAGAAAATATGCATGGG - Intronic
966573670 3:181476087-181476109 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
966623432 3:181991077-181991099 AAAGAGAAGGAAGGATCAAGGGG + Intergenic
966657479 3:182375786-182375808 CAAGAGCACAAAGTATGAACAGG + Intergenic
966714129 3:182999097-182999119 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
966991577 3:185236614-185236636 AAAGGGAAAAAAAGATGAATAGG - Intronic
967092313 3:186145566-186145588 AAAGAGAAGAAAAAATGAAAGGG - Intronic
967324188 3:188222824-188222846 AAAGAGAAGAAAATAAGTAAAGG - Intronic
967362789 3:188651001-188651023 AAGGAGAAGAAAAAATAAATAGG + Intronic
967364840 3:188674363-188674385 AAAGAGAAGAGAGAAAGAAGAGG - Intronic
967442830 3:189528619-189528641 AGAGAGGAGAAAGGAGGAATGGG - Intergenic
967489868 3:190078054-190078076 CAAGAGATGAAAGTATTGATGGG + Intronic
967691569 3:192479985-192480007 AAAGAGAAGAAAGAAGGATTTGG + Intronic
968023349 3:195415986-195416008 AATAAGAAGAAAATATAAATAGG + Intronic
968338123 3:197931053-197931075 AAAGAAAAGAAAGAAAGAGTTGG + Intronic
968675164 4:1873630-1873652 AAGGAGAAGATAATCTGAATAGG - Intronic
969108859 4:4828857-4828879 GAAGAGAAGAAAGAAGGAAAGGG - Intergenic
969141826 4:5081561-5081583 AAAGAAAAAAAAGAATGAAAAGG - Intronic
969542122 4:7798905-7798927 AAGGAGAAGGAGGCATGAATTGG - Intronic
969959980 4:10934669-10934691 AAAAAGAGAAAAGTATGAAAGGG + Intergenic
970136117 4:12926037-12926059 ACAGAGAGGAAAGTAGTAATTGG - Intergenic
970190600 4:13512554-13512576 AAAGGGAATAAAGAATGAAAAGG - Intergenic
970368862 4:15388195-15388217 ATAGAGAAGAAGATATGAAATGG + Intronic
970417932 4:15877729-15877751 AAAGAAAAAAAAGAATGAAATGG + Intergenic
970701502 4:18745959-18745981 AGAGGGAAGAAGGGATGAATAGG - Intergenic
970735055 4:19156240-19156262 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
971083757 4:23246174-23246196 AAAGAGAAGAGTGTTTGCATGGG - Intergenic
971525360 4:27610667-27610689 AATGAGAATAAAGTATCAAAGGG + Intergenic
971688030 4:29795752-29795774 AAAAAAAAGAAAGAAAGAATTGG + Intergenic
971695167 4:29892371-29892393 AAAGAAAAGTAAATATGAAATGG - Intergenic
971853704 4:32016629-32016651 AAAAAAAAAAAAGTATGAACTGG + Intergenic
971878438 4:32335921-32335943 AGAGAAAAGAGAGTAAGAATGGG - Intergenic
971885057 4:32434133-32434155 AAAGAGAATAAAGCATGATAAGG + Intergenic
971945011 4:33263642-33263664 AAAGGGAAGAAAGTAAATATAGG + Intergenic
971984479 4:33804173-33804195 AGGTAGAAGAAACTATGAATGGG + Intergenic
972015011 4:34232679-34232701 AAAGAGAAAAAAGAAAGAAAAGG - Intergenic
972082385 4:35170115-35170137 AAAGAGAAGAAATTTGAAATAGG + Intergenic
972108352 4:35523215-35523237 TAAGAGCAGAAAATATGTATGGG + Intergenic
972118770 4:35674135-35674157 AAAGACAACAAAGTTTTAATGGG + Intergenic
972327284 4:38028674-38028696 AGAGAGAAGAAATTATAAAATGG + Intronic
972754946 4:42036593-42036615 AGAGAGAAGAAAATGTGCATAGG - Intronic
972916448 4:43886478-43886500 GAAGGGAAGAAGGTGTGAATAGG - Intergenic
973129034 4:46626407-46626429 AGAGAAGAGAAAGTTTGAATTGG - Intergenic
973701463 4:53541166-53541188 AAAGAAAAGAAAGAAAGAAATGG + Intronic
973710486 4:53625200-53625222 AAACAGAAGAAAAAATAAATTGG + Intronic
973843728 4:54889757-54889779 AAAGAGAAGAAAATTTTAATGGG + Intergenic
973884127 4:55303625-55303647 AATTAGAAGAAGGTATCAATGGG - Intergenic
973964754 4:56150542-56150564 GAAGGGAAGAAATTATGATTGGG - Intergenic
974263817 4:59559194-59559216 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
974480785 4:62440034-62440056 GAAGAAAGGAAAGGATGAATAGG - Intergenic
974506422 4:62779760-62779782 AAAGAGAAGAGTGGTTGAATGGG - Intergenic
974760526 4:66267745-66267767 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
975020228 4:69477037-69477059 AAGTTGATGAAAGTATGAATAGG - Intergenic
975045550 4:69799191-69799213 AAAGAGAAGCAAGTAAGTATAGG + Intergenic
975054332 4:69909738-69909760 AAAGAAAAGAAAGTAAGTAAAGG + Intergenic
975153631 4:71046529-71046551 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
975219520 4:71797930-71797952 AAAGAGAAGAAAGTGAGAACAGG - Intronic
975383775 4:73731659-73731681 AAATGGAAGAAAGTAGGAATTGG - Intergenic
975625589 4:76343512-76343534 AAAGAGAAGCAAGAAAGTATTGG + Intronic
975875544 4:78831888-78831910 AAAGAGAAAAGAGGATGAAGAGG - Intronic
975934678 4:79564362-79564384 AAAGAGAAGAAGGAATGTTTTGG + Intergenic
976063310 4:81155187-81155209 AAAAAGAAGAATGTATAACTAGG + Intronic
976065699 4:81184935-81184957 TAAGAGAAAAAAGAATGAAAAGG + Intronic
976364582 4:84218833-84218855 AAGGAAAAGAAAATATAAATTGG - Intergenic
976374390 4:84327470-84327492 AAAGAGAAGAAAAAAGGAAAAGG - Intergenic
976478061 4:85507550-85507572 AAAGAGAATAAACAATGAAATGG + Intronic
976699951 4:87959276-87959298 AAAGATAAGAAAGTATCAATTGG - Intergenic
976858497 4:89632526-89632548 AAAGAAAAGAAAGGAAGAAAGGG + Intergenic
977197163 4:94077401-94077423 AAAGAGAACAAAGAATAAAGGGG - Intergenic
977418795 4:96769270-96769292 AAATATTACAAAGTATGAATCGG + Intergenic
977654636 4:99506512-99506534 AAAGAGAAGGAAGTAAGGAAGGG - Intergenic
977657131 4:99535434-99535456 ATAGAGAAAAAAGAATGAAAAGG - Intronic
977953095 4:102996389-102996411 AAAGAAAGGAAAGAATAAATTGG - Intronic
978031089 4:103940476-103940498 AAGCAGAAGAAAGAATGAATGGG + Intergenic
978180437 4:105788497-105788519 AAAAAGAACAAAGAATAAATGGG - Intronic
978206316 4:106084381-106084403 ATAGAGAAAAAAGAATGAAAAGG + Intronic
978278181 4:106977437-106977459 ATAGAGAAAAAAGAATGAAAAGG - Intronic
978386468 4:108180490-108180512 AAAGAGAAGAAAGGAAGAGAAGG + Intergenic
978746366 4:112199083-112199105 AAAGAAAAGGAAATATGAAAGGG - Intergenic
978897257 4:113903809-113903831 AAAGAGCAGAAATGCTGAATTGG - Intronic
978897478 4:113906363-113906385 AAAAAAAAGAAAGTAAGAAGAGG + Intronic
978980894 4:114944241-114944263 AGAGAGAAGAAAGAGTGAAGTGG + Intronic
979197692 4:117940429-117940451 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
979534246 4:121801479-121801501 GAAGAGAAGAAGGTATGGTTTGG + Exonic
979626584 4:122851749-122851771 AATGAGAAGAAAGAAAGAAAGGG - Intronic
979858783 4:125667552-125667574 AAAGAGAAGGAAGTATACTTGGG + Intergenic
979870431 4:125813436-125813458 AATGAGAAGAAAGTAAGAAAAGG + Intergenic
979967248 4:127089633-127089655 ATAGAGAAAAAAGAATGAAAGGG + Intergenic
979991775 4:127383032-127383054 ACAGAGTAGAAAGTATAAACAGG + Intergenic
980029249 4:127807360-127807382 AAAAAGATGGAAATATGAATAGG + Intronic
980129440 4:128804691-128804713 AAAGAGAAGTAAGTATGAAATGG - Intergenic
980145521 4:128978897-128978919 AAAGAGGAGAAAGAAAGAAATGG + Intronic
980318051 4:131231298-131231320 AAAGAGAAGCTAGTATGTGTAGG + Intergenic
980501417 4:133659046-133659068 AAAGAGATTAGAGTTTGAATAGG - Intergenic
980996042 4:139780604-139780626 AAAGAAAAGAAAGAAAGAAATGG - Intronic
981113656 4:140964892-140964914 AAATAGAAGCAAGTATATATGGG + Intronic
981205776 4:142038301-142038323 GAAGAGAAGACAGTTTAAATGGG - Intronic
981297515 4:143149103-143149125 AAAGAGAAGAGAATATGCAAAGG + Intergenic
981343012 4:143644290-143644312 AAAGACAAAAAAGTAGAAATAGG - Intronic
981422860 4:144571320-144571342 AAAGGGAGGAAAGTATGATAAGG - Intergenic
981550912 4:145939514-145939536 AAAGAGAGGAAAATAAGATTAGG + Intergenic
981554151 4:145974574-145974596 AAAGAAAAAATAGGATGAATAGG + Intergenic
981692389 4:147523850-147523872 AAAGAGAGGAAAGTATGAAGAGG + Intronic
981811939 4:148785430-148785452 AAAGAAAAGAAAGAAAGAATGGG - Intergenic
981839878 4:149099096-149099118 AGAGAGAAGGAAGGCTGAATAGG - Intergenic
981881049 4:149613225-149613247 AAAGAGAAGAAAATATGATGAGG + Intergenic
981947249 4:150362296-150362318 AAGGAAAAGAAAGAATGACTTGG - Intronic
982280115 4:153675631-153675653 AAAGAGAAAAAAGATTGAACAGG - Intergenic
982324033 4:154110225-154110247 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
982687470 4:158508466-158508488 AAAAAGAAGAAAGTCTTATTTGG + Intronic
982698590 4:158632814-158632836 AAAGAGAACAAAGGAAGAAGGGG + Intronic
982763979 4:159322555-159322577 AAAAAGGAAAAAGTAAGAATTGG - Intronic
982801132 4:159709220-159709242 GAAGGGAAGGAAGTAGGAATAGG + Intergenic
982893704 4:160889300-160889322 AAAGTGAAGAAAGTAAGCAAAGG + Intergenic
982950882 4:161694255-161694277 AAAGAGAAGAAAAGATAAAGGGG - Intronic
982955742 4:161763945-161763967 AAAAAGAAGAAAGGAAGAAAGGG - Intronic
983286119 4:165741807-165741829 AAAGAGAAGAAAACCTGAATGGG - Intergenic
983379791 4:166978208-166978230 AAATAAAATAAAATATGAATTGG - Intronic
983788814 4:171768816-171768838 AAACAGGAGGATGTATGAATTGG - Intergenic
983986899 4:174070395-174070417 AAACAGAAGCAAGGAAGAATTGG + Intergenic
984209947 4:176834611-176834633 GAAGAGAAGAAAGTCTGTTTTGG + Intergenic
984469567 4:180150356-180150378 AAAGAGTAAAAATTATGACTCGG - Intergenic
984851531 4:184157429-184157451 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
984858910 4:184219755-184219777 GAAGAGAAGAAAGGAAGAAAAGG + Intronic
985698219 5:1354308-1354330 AAAAAGAACAAAGAATGAATAGG - Intergenic
985799160 5:1992253-1992275 AAAGAAAAGAAAGTATATTTAGG - Intergenic
986103381 5:4635086-4635108 AATAAGAAGAAAGAATGTATGGG - Intergenic
986426491 5:7636707-7636729 CAAGAGAAGAAGGTATAAGTGGG + Intronic
986754442 5:10822645-10822667 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
986848726 5:11785473-11785495 AAAGTGAATAAAATATGAATTGG + Intronic
987167999 5:15220893-15220915 AAAGAAAAGGAAGAATGATTAGG - Intergenic
987179173 5:15348439-15348461 AAAAACAGGAAATTATGAATAGG - Intergenic
987208020 5:15647597-15647619 GAAAAGAAGTAAGTATGAAAGGG - Intronic
987454016 5:18120648-18120670 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
987471091 5:18329214-18329236 AAAGAGAAGAAAATATAAGATGG - Intergenic
987860191 5:23476209-23476231 AAATAGTATAAAATATGAATAGG + Intergenic
987987470 5:25166164-25166186 AAAGAGAAGAAATCATGGATAGG + Intergenic
988428328 5:31090046-31090068 TAATAGAAGAAAGTTTGAAATGG - Intergenic
988475207 5:31578583-31578605 AAAGAAAAGAAAGAAAGAAAAGG + Intergenic
988589642 5:32537740-32537762 AAAAAAAAGAAAGTGTGAAATGG - Intronic
989007043 5:36826752-36826774 AAAGAAAAGAAAGAAAGAAAGGG + Intergenic
989086652 5:37684038-37684060 ATAGAGAAAAAAGAATGAAAAGG - Intronic
989092203 5:37744728-37744750 ATAGAGAAAAAAGAATGAAAAGG + Intronic
989257120 5:39377845-39377867 AAAGTGAAGAAACTTTGAAATGG - Intronic
989331415 5:40263296-40263318 AAAGAGAAGAAAAAGAGAATGGG + Intergenic
989682468 5:44045772-44045794 ACAGAGAAAAAAGAATGAAAAGG - Intergenic
989967245 5:50478858-50478880 AAAGAGAAGGATATAGGAATAGG + Intergenic
990097037 5:52129016-52129038 GCAGGGAAGAAGGTATGAATAGG + Intergenic
990328171 5:54698635-54698657 GAAGAGAAGAAAGTAGGACTGGG + Intergenic
990407798 5:55509101-55509123 AAAGAGAAATAAATGTGAATGGG + Intronic
990505362 5:56438899-56438921 AAAGAGAAGAGAGTGTGAATGGG + Intergenic
990516631 5:56536548-56536570 AAAGAAAAGAAAGAAAGACTGGG - Intronic
990560341 5:56977665-56977687 CAAGAGATGCAATTATGAATAGG - Intergenic
990814785 5:59771547-59771569 AAAGAAAAGAAAGAATGATATGG + Intronic
990958112 5:61363988-61364010 AAAGAAAAGAAAGAAGGAAAGGG - Intronic
991056360 5:62325071-62325093 AAAGAAAAGAAAGTACAACTTGG - Intronic
991209141 5:64084442-64084464 AAAGAGAAGGAAGAATAAAGGGG - Intergenic
991269629 5:64764524-64764546 AAAGAGTAGAAAGAGTGATTTGG + Intronic
991272174 5:64796902-64796924 AAAGAGAAGAAAGGAAGGAAGGG - Intronic
991360515 5:65815064-65815086 AAAGAGAAAAAAGTCTAACTAGG + Intronic
991933226 5:71776307-71776329 AAATAAAAGAAAATATGATTTGG - Intergenic
992309113 5:75476608-75476630 AATGAGAAGCATGTGTGAATAGG - Intronic
992440124 5:76790637-76790659 ATAGAGCAGGAGGTATGAATAGG + Intergenic
992456895 5:76924380-76924402 AAAGTGAACAGAGAATGAATAGG - Intergenic
992468036 5:77026596-77026618 CAATAGAAGAAAATATGACTTGG + Intergenic
992494148 5:77275348-77275370 AAAGAAAAGAAAGATTGTATGGG - Intronic
992533586 5:77675045-77675067 AAAAAACAGAAAATATGAATAGG + Intergenic
992560242 5:77944853-77944875 AAAGAAAAGAAAGAAAGAAAAGG + Intergenic
992761049 5:79951187-79951209 AAAGAGAAGAAAAAATGCATTGG - Intergenic
992865322 5:80951964-80951986 TGAGAGAAGAAAGTATGATGGGG - Intergenic
992919642 5:81501544-81501566 AAAGAAAAGAAAGAAAGAAAAGG - Intronic
992950759 5:81855557-81855579 AGAGAGAATATAGTATGCATAGG - Intergenic
992970612 5:82053152-82053174 AAAGATCAAAAAGTATGAAAGGG - Intronic
993020989 5:82590541-82590563 AAGGAGAAGAAAGAAAGAAAAGG - Intergenic
993086646 5:83371115-83371137 AAAGAGAAGAGTGGATGAAAGGG - Intergenic
993088294 5:83392247-83392269 AATGAGAAGAAGGAATGAAGTGG - Intergenic
993140593 5:84028181-84028203 AAAGCAAGGAAAGTAGGAATAGG - Intronic
993497656 5:88626076-88626098 ACAGAGAAAGAAGTATGATTAGG + Intergenic
993543914 5:89187280-89187302 AATATGAAGAAATTATGAATTGG - Intergenic
993637373 5:90361259-90361281 AAAAAGAAGAAAGGAGTAATTGG - Intergenic
993932474 5:93956679-93956701 AAAAAAAAAAAAGTAAGAATGGG + Intronic
993963424 5:94330776-94330798 GAAGGGAAGAAAGTCTGAAAAGG - Intronic
993967425 5:94374809-94374831 TAAGAGGAGGAAGTAGGAATAGG - Intronic
993979793 5:94531473-94531495 AAAAAGTAGGAAATATGAATGGG + Intronic
994287293 5:97984641-97984663 AATCAGAAGAAACTAGGAATGGG + Intergenic
994359598 5:98835150-98835172 AAAGAGAAAAATGAATGAAAGGG - Intergenic
994520358 5:100826237-100826259 ATAGAGAAGAAACAACGAATAGG - Intronic
994551263 5:101238247-101238269 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
994732148 5:103504842-103504864 AAAGGGAACAGAGTGTGAATGGG - Intergenic
994747728 5:103699936-103699958 AAAGAGAAGAAACCTAGAATGGG - Intergenic
994800961 5:104374669-104374691 CAAGAGAAGAAAGAATGATCAGG + Intergenic
995053527 5:107733428-107733450 GAACAGAAAAAGGTATGAATAGG - Intergenic
995133849 5:108659558-108659580 AAGGAAAAGAAAGGAAGAATGGG + Intergenic
995217184 5:109608643-109608665 AAAGAGAACAAAGAAGCAATGGG + Intergenic
995419326 5:111945486-111945508 GAAGAGAAGAAAGGATAAAAAGG + Intronic
995685209 5:114765287-114765309 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
995739935 5:115345588-115345610 AAAGGGAAGAGAGAAGGAATTGG - Intergenic
995815868 5:116167288-116167310 ATAGAGAAAAAAGAATGAAAAGG + Intronic
995967355 5:117923923-117923945 AAAGAAAATAAAACATGAATTGG + Intergenic
995968463 5:117938583-117938605 AAAGAGAAAAAAGTAAGATTTGG + Intergenic
996090771 5:119349457-119349479 AAAATGAAGAAATAATGAATAGG + Intronic
996173696 5:120329004-120329026 GAAGAGAAAAAAGGAAGAATAGG + Intergenic
996463082 5:123769749-123769771 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
996864697 5:128107254-128107276 AAAGAAAAAAAAATATGACTAGG - Intronic
996893984 5:128457246-128457268 ATAGAGAAAAAAGAATGAAAAGG + Intronic
996910733 5:128654666-128654688 TTAGAGAAGAAAGAATGAAAAGG - Intronic
997027658 5:130085032-130085054 AAAGAGAAGAAAGTATAATGAGG + Intronic
997182092 5:131840542-131840564 ATAGAGAAAAAAGAATGAAAAGG - Intronic
998076659 5:139241995-139242017 GAAGAGGAGAAAGGAAGAATAGG - Intronic
998633882 5:143931016-143931038 AAAGAAAAGAAAAAATAAATAGG - Intergenic
998885144 5:146686327-146686349 AAAGGGCAGAGAGAATGAATGGG + Intronic
999311050 5:150552455-150552477 AAACAGAAGCAAGTAGGAAAAGG - Intronic
999363560 5:151006450-151006472 AAGGAGAAGAAAGTGAGTATGGG - Intergenic
999487956 5:152018496-152018518 AAAAAAAAGAAAGAAAGAATAGG + Intergenic
999488524 5:152025391-152025413 TAAGAGAAAAAAGAATGAAAAGG - Intergenic
999923837 5:156353235-156353257 AAAGGGAGAAAATTATGAATAGG + Intronic
1000094115 5:157955946-157955968 AAAGAAAAGAAAGAATAAAAAGG - Intergenic
1000418261 5:161006847-161006869 AAAGAGAAGAGAGAAAGAAAGGG - Intergenic
1000576331 5:162979923-162979945 AGAAAGAAGAAAGTGTAAATGGG + Intergenic
1000606437 5:163332422-163332444 AAAGTGAGGAAAATCTGAATGGG - Intergenic
1000975375 5:167758564-167758586 AAAGAGAAGACTGTATGGAGAGG - Intronic
1001139229 5:169129727-169129749 AAAGAGAAGAGGATATTAATGGG + Intronic
1001857928 5:175028890-175028912 GAAGAGAAGAAAGAAAGAAAGGG + Intergenic
1001890739 5:175336107-175336129 AAAGAGAAGGCATTATTAATGGG + Intergenic
1002262163 5:178001173-178001195 AAAAAGAAGAGAATAAGAATAGG + Intergenic
1002794375 6:459611-459633 AAATAGAAGAAAGGAGGAAGGGG + Intergenic
1003178256 6:3770167-3770189 AAGGAGGAGAAAGAATGAAACGG - Intergenic
1003447705 6:6200016-6200038 GAAGAGAAGAAAGTCTGTGTTGG + Intronic
1003686952 6:8314024-8314046 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1003743338 6:8968726-8968748 AAATAGAAGAAACCATAAATAGG - Intergenic
1004122286 6:12835619-12835641 TTAGAGAAGAAAGTATGAATAGG + Intronic
1004353984 6:14915691-14915713 GAAGAGTAGAAAGGTTGAATGGG - Intergenic
1004375556 6:15087846-15087868 AAAGAGAATAAAGTAGAAATGGG - Intergenic
1004770242 6:18773118-18773140 AAGGAGAATTAGGTATGAATGGG - Intergenic
1004834025 6:19510700-19510722 ATAGAGAATAAAGAATGAACAGG - Intergenic
1005106379 6:22228726-22228748 AAGGAGGAGAAGGTATGAAATGG - Intergenic
1005138489 6:22599239-22599261 AATGAGAAGCAAGTCAGAATAGG - Intergenic
1005170763 6:22981751-22981773 TTAGAGAAAAAAGAATGAATAGG + Intergenic
1005191809 6:23232696-23232718 AAAAAAAAGATAGTATGTATTGG - Intergenic
1005242268 6:23844850-23844872 AAAGGGAAGCAAGCCTGAATGGG - Intergenic
1006252986 6:32806361-32806383 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1006723211 6:36174140-36174162 AAAGAAAAGAAAGGAAGAATGGG + Intergenic
1007150289 6:39683829-39683851 AAAGAGGAGGAAGTAGGATTAGG + Intronic
1007299857 6:40858938-40858960 AGAGAGAAGGAAGTATGATTAGG - Intergenic
1007305369 6:40899785-40899807 AAATAGAAGAGAGTATGATAAGG + Intergenic
1007558603 6:42786855-42786877 CAAGGGGAGAAATTATGAATAGG + Intronic
1007797791 6:44364708-44364730 AAAGAAAAGAAAGAAAGAGTGGG - Intronic
1007939334 6:45763168-45763190 AAAGAAAAGATAGAAAGAATGGG + Intergenic
1008293136 6:49742671-49742693 AAAAAAAAGAAAGAATTAATTGG + Intronic
1008344661 6:50411886-50411908 AAAGAGGATAAAGATTGAATGGG + Intergenic
1008619140 6:53254640-53254662 AAACTGAAGAAAGTGTGAATGGG - Intergenic
1008784133 6:55144944-55144966 GAAGAAAAGACAGTTTGAATAGG - Intronic
1008802762 6:55390145-55390167 AAAGAGAAGAAAAAGTGAAAAGG - Intronic
1008858574 6:56121379-56121401 GAAGAGAAGAAAGGATCAAAAGG + Intronic
1008881705 6:56386832-56386854 AAAGGGAAAAAAAGATGAATTGG + Intronic
1009346253 6:62615423-62615445 AAGGAGAAGAAATCATGTATGGG + Intergenic
1009347695 6:62637270-62637292 AAAAAGAAGAAAGAATTCATGGG - Intergenic
1009404483 6:63294638-63294660 AAACAGAGGAATGTATGAGTAGG - Intronic
1009621840 6:66087313-66087335 AAAGAGAAGAAAGTGAGCATAGG - Intergenic
1009759617 6:67987256-67987278 AATGAAAAGAAAATATAAATTGG + Intergenic
1009893425 6:69717454-69717476 AAAGATAAGAAAATATGGAAAGG - Intronic
1009945212 6:70335321-70335343 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1010277456 6:73986321-73986343 AAAGACAAGTAATTATGTATTGG + Intergenic
1010374350 6:75149170-75149192 AGAGAGGAGAAAGTATCAAAAGG - Intronic
1010528353 6:76932826-76932848 ACAAAGAAGAAATTATGATTAGG - Intergenic
1010972396 6:82276755-82276777 AAAGAAAGGAAAGTTTGAAAAGG + Intergenic
1011174249 6:84542262-84542284 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
1011214283 6:84988403-84988425 ATAGAGAAAAAAGAATGAAGAGG + Intergenic
1011416349 6:87123529-87123551 AAAAAAAGGAAAGTATGATTTGG + Intergenic
1011442494 6:87401472-87401494 AAAGAGAAGAAAAAAAGAAAAGG + Intergenic
1011549835 6:88521187-88521209 AAAAAGAAGAAAATCTGATTGGG - Intergenic
1011578358 6:88828831-88828853 TTAGAGAAGAAAGAATGAAAAGG + Intronic
1011703934 6:89982475-89982497 AAAGAGATAAAAGTCTGATTTGG + Intronic
1011773123 6:90696727-90696749 AAAGAGAAAATAGAAAGAATGGG + Intergenic
1011781878 6:90798696-90798718 AAAGAGAAGAAAGAATGAGAGGG - Intergenic
1011783390 6:90816042-90816064 AAAGAAAAGAAGATATAAATAGG - Intergenic
1011915395 6:92498772-92498794 TATGAGAAGAAAATAAGAATAGG + Intergenic
1012012584 6:93807725-93807747 AAAAAGAGGAAAATATAAATTGG + Intergenic
1012630098 6:101455228-101455250 AAAGAGAAGAAATTAAAAGTGGG + Intronic
1012715330 6:102661277-102661299 AAAGAGAAGATAATATGCTTTGG + Intergenic
1013022952 6:106238113-106238135 AAAGACAAGAAAGTATAGAATGG - Intronic
1013461677 6:110380024-110380046 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1013541136 6:111110528-111110550 GGAGAGAAGAAAGTAAGAATGGG + Intronic
1013734643 6:113211803-113211825 AAAGAAAAGAAAAGATGAACAGG - Intergenic
1013814710 6:114084066-114084088 AAAGAAAAGAAAATATGATCAGG - Intronic
1013974582 6:116062478-116062500 AAAGAAAAGAAAGAAAGATTTGG + Intergenic
1013991947 6:116264289-116264311 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1014027403 6:116664574-116664596 AAAGAAAAGAAAGAATGAGAAGG + Intronic
1014084924 6:117331285-117331307 AGAGAGAAAAAAGAATGAAAAGG + Intronic
1014153062 6:118081100-118081122 AAAGAGAAGAGAGGATTAAAGGG - Intronic
1014250875 6:119114465-119114487 AGAGAGAAGAATCTATGAAGTGG - Intronic
1014265008 6:119267677-119267699 AGAGAGAAGGAAGTATGATTGGG - Intronic
1014285716 6:119495040-119495062 AAACAGAAGAAAACATGAAACGG + Intergenic
1014356067 6:120411730-120411752 AAAGAGAAGAAAATGAGAAAGGG + Intergenic
1014369130 6:120583306-120583328 ATAGAGAAGAATGAATGAAAAGG - Intergenic
1014439792 6:121460931-121460953 AAAGAAAAGAAAGGAAGAGTGGG - Intergenic
1014626419 6:123731394-123731416 GAAGGGAAGAAAATATGAATCGG + Intergenic
1014756578 6:125308222-125308244 AAAGAGAAGAAAATAAGAAAGGG + Intergenic
1014886493 6:126787680-126787702 AAAAAAAAAAAAGTATGCATGGG + Intergenic
1014888805 6:126816346-126816368 AAAGAGAAGGAAGGAAGAAAGGG - Intergenic
1015127563 6:129771428-129771450 AATGAGATGAATGAATGAATGGG - Intergenic
1015413809 6:132925325-132925347 AAAGAAAAGAAAGAATGAACAGG - Intergenic
1015424226 6:133047000-133047022 AAAGAAAAGGAACTAAGAATAGG + Intergenic
1015454117 6:133405766-133405788 AAAGAAGAGAGAGAATGAATGGG + Intronic
1015688861 6:135897656-135897678 AAAGAAAAGTAGGTATTAATAGG + Intronic
1015902045 6:138077433-138077455 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1016161736 6:140890194-140890216 AAAGAGAAGAAAGACAGAAAGGG - Intergenic
1016549699 6:145265119-145265141 AAAGAAAAGAAAGAGTGAAGAGG + Intergenic
1016569490 6:145496522-145496544 ACAGAGAAGAAAGAATGAAAAGG - Intergenic
1016807428 6:148226006-148226028 GAAGAAAAGACAGTATGAAAAGG + Intergenic
1017142697 6:151206185-151206207 TAAAAGAAGAATGAATGAATGGG - Intergenic
1017175157 6:151495490-151495512 AAAAAGAAGAAAGAAAGAAAAGG - Intronic
1017253887 6:152311729-152311751 AAAGAGGAGAAATGAGGAATAGG + Intronic
1017665194 6:156713377-156713399 AAAGAAAAGAAAAAAAGAATTGG - Intergenic
1017758244 6:157548213-157548235 AAAAAGATGCAAATATGAATTGG - Intronic
1017832394 6:158142471-158142493 AAAAAAAAAAAAGAATGAATAGG - Intronic
1018275462 6:162125578-162125600 AAAGACAAGAAAATAGGTATGGG - Intronic
1018423711 6:163662087-163662109 CAAGAGAAGGAAGGGTGAATAGG + Intergenic
1018815448 6:167327009-167327031 AAAGAGAAAAGAGTAGGTATTGG + Intronic
1018871486 6:167787001-167787023 AGAAAGCAGAAAGTATGAAGAGG - Intronic
1019113384 6:169737011-169737033 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1019851093 7:3558326-3558348 AGGGAGAAGAAAGTATGAGATGG - Intronic
1020409251 7:7872834-7872856 AAAGAAAAGAAAGTTTGAGTGGG + Intronic
1020828594 7:13064237-13064259 ATAGAGAAGCAAGTAAGAACAGG - Intergenic
1020876567 7:13702268-13702290 AAAAAGAAGAAAGGAAGAAAGGG - Intergenic
1020919852 7:14249776-14249798 AAAGTGATGAAATTATGAGTTGG - Intronic
1020982923 7:15094653-15094675 AAAGAGGACAAAGTTTGAGTAGG + Intergenic
1021064459 7:16156409-16156431 AAAGGGAAGAAAATCTAAATAGG + Intronic
1021065625 7:16169230-16169252 AAAGGGAAGAAAATATGACAGGG + Intronic
1021129952 7:16899655-16899677 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1021422478 7:20461294-20461316 AAAGAGGAGAAAATCTGAAGGGG + Intergenic
1021478463 7:21089326-21089348 AAAGTGAAGAATAAATGAATAGG + Intergenic
1021520831 7:21537510-21537532 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1021604169 7:22393851-22393873 CAAGGGAAGAAAGTAAAAATCGG - Intergenic
1022068461 7:26885827-26885849 CAGGAGAAAAAAGTATGAAAAGG - Intronic
1022294524 7:29037580-29037602 AAAGAAAAGCACATATGAATCGG + Intronic
1022452830 7:30531729-30531751 AAAAAAAAAAAACTATGAATGGG - Intronic
1022541780 7:31144208-31144230 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1022616608 7:31937468-31937490 AAAGAGAGGAGAGTATAAACAGG + Intronic
1022643257 7:32207453-32207475 AAAGTGAAGTAAGCATCAATCGG + Intronic
1022660242 7:32360190-32360212 AATGAAAAGAAACAATGAATGGG + Intergenic
1022877937 7:34553979-34554001 ATAAAGAAGAAAGAATGAAAAGG + Intergenic
1022942281 7:35252567-35252589 AGAGAGAAGAAAGGAAAAATTGG + Intronic
1023162990 7:37315716-37315738 AAAGAGCAGAAAGTGTGAAATGG - Intronic
1023196067 7:37640990-37641012 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1023283035 7:38591254-38591276 AAAGAAAAGAAAGGAGGCATTGG - Intronic
1023473271 7:40548831-40548853 GAAGATAGGAAAGGATGAATAGG - Intronic
1023709942 7:42981462-42981484 AAAGAGAGAAAAGAATGAAATGG + Intergenic
1024132213 7:46364968-46364990 GGAGGGAAGAAAGGATGAATAGG - Intergenic
1024157895 7:46644781-46644803 AAAGAGAAGAAAGGGAAAATTGG - Intergenic
1024433761 7:49324034-49324056 AAAGTAAAGAAATAATGAATGGG + Intergenic
1024442832 7:49441423-49441445 AAAGAGCAGAAAGTATGACCTGG - Intergenic
1024770012 7:52711691-52711713 AAAGAGAAAGAAGAATGAAATGG - Intergenic
1024990420 7:55230780-55230802 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1025001588 7:55319877-55319899 AAAGAAAGAAAAGTCTGAATAGG + Intergenic
1025598537 7:62964077-62964099 AAAGAAAAGAAAGTTTTACTTGG - Intergenic
1025718466 7:63986123-63986145 AAATGGAAGACAGGATGAATGGG + Intergenic
1025747941 7:64261846-64261868 AAAAAAAAGAAAGAAAGAATTGG - Intronic
1026238664 7:68552232-68552254 AAAGAAAAGAAAAAAAGAATTGG - Intergenic
1026494651 7:70891992-70892014 AAAGAAAAGAAATTATGGTTTGG + Intergenic
1026872538 7:73861794-73861816 AAAAAAAAGAAAAAATGAATGGG - Intronic
1027539673 7:79452649-79452671 GAAGAAAAGAAAGAAAGAATGGG - Intronic
1027604834 7:80287727-80287749 GAGGAGAAGAAAGAATGAAGAGG + Intergenic
1027606688 7:80308753-80308775 ATAGTGTAGAAAGTATTAATGGG + Intergenic
1027865081 7:83635959-83635981 AAAGAAAAGAAAGTCAGAACTGG - Intronic
1027895016 7:84030550-84030572 AAAGAGTTGAAAGGAAGAATTGG - Intronic
1027944189 7:84724033-84724055 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1028053786 7:86218761-86218783 AAAGAGGAGATAATATGAAGTGG - Intergenic
1028150619 7:87367249-87367271 AAAGAGATGGAAGTATGAGAAGG + Intronic
1028213601 7:88105291-88105313 TAAGAGAAGAAGGTCTGATTCGG + Intronic
1028503503 7:91545922-91545944 AAAGGGAAAAAAGGATAAATTGG + Intergenic
1028620268 7:92818577-92818599 AAAGAAAAAAAAAGATGAATTGG + Intronic
1029175217 7:98659739-98659761 AAAGAAAAGAAAGAAAGAAGAGG + Intergenic
1029281250 7:99437300-99437322 AAAGAAAAGAAATTATGATAGGG - Intronic
1029292649 7:99514382-99514404 AAAGAGAGGAAAATTTGAAGAGG - Intronic
1029307177 7:99629088-99629110 AAAGAGAAGGAACCATGAATGGG + Intronic
1029308782 7:99641879-99641901 ATAGAGAAGAGAGTATGCAGAGG - Intergenic
1030011301 7:105170704-105170726 AAAGACAAGAAAGAAAGAAAAGG + Intronic
1030115506 7:106059601-106059623 AATGGGAAAAAAATATGAATAGG + Intergenic
1030139533 7:106290778-106290800 AAAGAGAAGGAAAGCTGAATGGG - Intergenic
1030164048 7:106535211-106535233 TAAGAGAAGAAAATCTGACTAGG + Intergenic
1030166617 7:106562010-106562032 GAAGAGATGAATGTCTGAATAGG + Intergenic
1030394923 7:108974114-108974136 GAGGAGAAGAAAGTGTGTATGGG - Intergenic
1030500667 7:110355475-110355497 TAAGAGAAAAAAGAATGAAAAGG - Intergenic
1030723460 7:112897742-112897764 AAAGAGAGAAATGTATGAAAAGG + Intronic
1031020041 7:116617933-116617955 GAAAAGAAGAAAGAAAGAATCGG - Intergenic
1031066929 7:117115291-117115313 AAAGAGAAAGAAGAATGAATAGG - Intronic
1031097003 7:117432255-117432277 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1031399358 7:121313417-121313439 AGAGAGAAGAAACTAGGAAGAGG - Intergenic
1031431514 7:121676472-121676494 AAAGAGAGGAAAGCAAGATTTGG + Intergenic
1031688537 7:124762435-124762457 AAAGAGACAAAAGTATAAAGCGG - Intronic
1031773546 7:125877371-125877393 AAACAGAAGAAAGCAGGATTGGG + Intergenic
1032295768 7:130637421-130637443 TTAGAGAAGAAAGAATGAAAAGG - Intronic
1032362078 7:131265369-131265391 AGAGAGAAGAAAGAAAGAAGGGG - Intronic
1032665656 7:134033589-134033611 AAAGAGAACAGAGAATGAAGGGG + Intronic
1032879229 7:136071454-136071476 AAAAAGAAGAAAGAATAAAAGGG + Intergenic
1032911216 7:136432655-136432677 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
1033138738 7:138806527-138806549 AAAGAAAAGAAAATCTGAAAGGG + Exonic
1033234891 7:139630389-139630411 AAAGAAAAGGAAGAATGAAGCGG - Intronic
1033277650 7:139984777-139984799 AAAGAAAAGAAAGAAAGAAAGGG + Intronic
1033291250 7:140084727-140084749 AAAGGGAACAAAGTCAGAATTGG + Exonic
1033415918 7:141161192-141161214 AGAGAGATGTAAGGATGAATGGG + Intronic
1033565859 7:142577259-142577281 AAAGAAAAGAAAGAAAGAAGAGG + Intergenic
1033906171 7:146206464-146206486 AAACTGAAGAAAGTAAAAATAGG + Intronic
1033977043 7:147115515-147115537 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1034316201 7:150135712-150135734 ATAGAGCAGAAATTATTAATAGG + Intergenic
1034790687 7:153965075-153965097 ATAGAGCAGAAATTATTAATAGG - Intronic
1035348951 7:158229698-158229720 AAAAAGAACAAAGAATGAAGAGG + Intronic
1035599340 8:888073-888095 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1035724459 8:1815945-1815967 AAAGAAAAGAAAGGAAGCATGGG + Intergenic
1035796101 8:2358141-2358163 AAACAGAAAAAAAAATGAATAGG + Intergenic
1035848935 8:2894489-2894511 AAAGAGAAAATAATATGCATTGG - Intergenic
1036513805 8:9424747-9424769 AAAGAGAACAAATTATAAAGAGG + Intergenic
1037166180 8:15831737-15831759 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1038082373 8:24153437-24153459 AAAAAGTAAAAAGGATGAATTGG + Intergenic
1038125204 8:24665691-24665713 AATGAGAAGAAAGAAGAAATAGG + Intergenic
1038243188 8:25829856-25829878 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1038670399 8:29578376-29578398 AAAGAAAAGAAAGGAGGAACAGG - Intergenic
1038706869 8:29902488-29902510 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1038971745 8:32644386-32644408 TAAGAAAGGAAAGTGTGAATGGG - Intronic
1039185854 8:34915555-34915577 AAAGAGAAGAGAGCTTGTATAGG - Intergenic
1039226402 8:35393115-35393137 AAAAAAAAAAAAGTAGGAATAGG - Intronic
1039568780 8:38570043-38570065 AGGGATAAGAAAGTATGAAAAGG + Intergenic
1040082324 8:43299509-43299531 ACAGAGAAGAAAGTCAGACTAGG - Intergenic
1040970814 8:53135903-53135925 AAAGAAAAGAAAGAAAGAAAGGG + Intergenic
1041004009 8:53481895-53481917 AAAGAAAAGAAAGGAAGAAAAGG + Intergenic
1041035019 8:53780418-53780440 AATGAAAAGAAGGAATGAATGGG + Intronic
1041264392 8:56049955-56049977 AAAGAAAATAATGTATGTATTGG - Intergenic
1041329614 8:56710586-56710608 AAACAGAAAACACTATGAATAGG + Intergenic
1041424118 8:57701462-57701484 GAAGAGTAGAAAATATAAATGGG - Intergenic
1041623797 8:60001947-60001969 ATAGAGAAGAAAGAATGAAAAGG + Intergenic
1041795880 8:61747549-61747571 AAAGATAGAAAAGAATGAATGGG + Intergenic
1042011976 8:64256713-64256735 AAAGAGGAGAGACTTTGAATGGG - Intergenic
1042065217 8:64867544-64867566 TCACAGAGGAAAGTATGAATTGG - Intergenic
1042129902 8:65578121-65578143 AAACAGAAGAAAGAATCACTGGG - Intergenic
1042176214 8:66039336-66039358 AAAAAAAAAAAAGTATGAAGTGG - Intronic
1042555943 8:70033798-70033820 AAAGAAAAGAAAGGAAGAAGTGG + Intergenic
1042631662 8:70823522-70823544 AAAAAGAAGAAAGTAGTAGTTGG - Intergenic
1042673078 8:71285598-71285620 AAAGAGAAGAAATGATAAAGAGG + Intronic
1042889345 8:73590040-73590062 GAAGAGAAGAAAGAATAAAGAGG + Intronic
1043328920 8:79088876-79088898 AAGGAGAAGGAGGTATGATTGGG + Intergenic
1043396635 8:79843733-79843755 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1043421236 8:80101099-80101121 AAAGAGAAGAAAAGATGTATGGG + Intronic
1043613996 8:82103159-82103181 ACAGAGAAGACAGAATGAAAAGG + Intergenic
1043625972 8:82258723-82258745 CAACTGAAGAAACTATGAATTGG - Intergenic
1043730143 8:83667782-83667804 AAAGTGAAGAAAGCATTATTAGG - Intergenic
1044055544 8:87565703-87565725 AAAGAGAACAAAGAATCAAATGG + Intronic
1044113434 8:88304240-88304262 AGAGAGAAAAAAGAATGAAAAGG + Intronic
1044185220 8:89242862-89242884 AAAGAGATGTAAATACGAATTGG + Intergenic
1044280410 8:90348352-90348374 AAAGGGAAGAAAGAATGAATTGG - Intergenic
1044477072 8:92639516-92639538 AAGGAGCAGAATGTATGAAGAGG + Intergenic
1044898238 8:96915899-96915921 AACGAGAAGAAAATCTTAATTGG - Intronic
1045029160 8:98118375-98118397 AAAAAGAAAAAAATGTGAATTGG - Intronic
1045400183 8:101807935-101807957 AATGAGAAGAAACTATGGAATGG + Intronic
1045583901 8:103509173-103509195 AAAGGGGAGAAAGTAAGATTAGG + Intronic
1045672875 8:104576064-104576086 GAACAGAAAAAAGAATGAATAGG + Intronic
1046160112 8:110351434-110351456 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1046363696 8:113196599-113196621 AAAGAGAATCAAGGCTGAATTGG + Intronic
1046559791 8:115820954-115820976 AAAAAGTCGAAAGTATGAAAAGG + Intergenic
1046572980 8:115990298-115990320 CAAGAAAAAAAAGGATGAATTGG - Intergenic
1046588143 8:116173149-116173171 ATAGAGAAAAAAGTCTAAATGGG + Intergenic
1046605322 8:116365439-116365461 AAAAAGAAGAAAGAAAGAAAAGG + Intergenic
1046664443 8:116984864-116984886 AAAGAAAAAAAATTATAAATTGG - Intronic
1046764515 8:118055241-118055263 CCAGAGAAGAAAGAATGTATAGG - Intronic
1047012494 8:120687156-120687178 AAAGAGGAGAAAGGCTGAACTGG + Intronic
1047049574 8:121095777-121095799 AAAGAAAAGAAAGTGTGAAATGG + Intergenic
1047068354 8:121313421-121313443 GAAGAGAAAAAACAATGAATAGG - Intergenic
1047087106 8:121530028-121530050 AAATAGAATAAATTATGAAAAGG + Intergenic
1047152060 8:122274807-122274829 TTAGAGAAAAAAGTATGAAAAGG + Intergenic
1047561946 8:125995539-125995561 AAAAAGAAAAAAAAATGAATAGG + Intergenic
1047590786 8:126324608-126324630 AAATACAAGAATGTATGACTGGG - Intergenic
1047654789 8:126965165-126965187 AAAGAGAAAATAGTTTGAGTTGG + Intergenic
1047670996 8:127147242-127147264 AAAGAAAAGAAAGAAAGAAGGGG - Intergenic
1047678656 8:127230879-127230901 AAAGACAAGAAGGTTTTAATTGG + Intergenic
1047832294 8:128647890-128647912 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1048062259 8:130932469-130932491 AAAGAGAAGGAAGTGGGCATAGG - Intronic
1048147909 8:131863466-131863488 GAAGAAAATAAAGTATGGATAGG - Intergenic
1048433055 8:134388622-134388644 AAAGAGAAGAAAATGAGAAATGG + Intergenic
1048557399 8:135493947-135493969 AAGGAAAAGATAGCATGAATAGG - Intronic
1048569395 8:135639037-135639059 AAAGTGAAGAAAGTATGTCAAGG + Intronic
1048599209 8:135901032-135901054 AAAGAGTAGTTAGAATGAATGGG + Intergenic
1049123662 8:140765646-140765668 AAATAAAAGAATGTATGATTTGG - Intronic
1049128284 8:140811859-140811881 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1049196696 8:141319804-141319826 AAAGAGAAAGAATGATGAATGGG - Intergenic
1049964756 9:768170-768192 TTAGAGAAGAAAGAATGAAAAGG + Intergenic
1050066842 9:1768791-1768813 AAAGACAAGAATGTATAAATTGG + Intergenic
1050381758 9:5038248-5038270 AAAGAACAGAAAGTTTGAATAGG + Intronic
1050480677 9:6084260-6084282 AAAGAGAAGTTAATAAGAATAGG + Intergenic
1050675783 9:8051805-8051827 AAAGAAAAGAAAGAAAGAGTAGG + Intergenic
1050756951 9:9016360-9016382 AAAGAGAAAAGAGAAAGAATTGG - Intronic
1050982469 9:12037274-12037296 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1051036017 9:12746416-12746438 ATAGAGATGAAAGAATGAAAAGG - Intergenic
1051254373 9:15197608-15197630 GGAGAGAAGAAAGTAAGAATGGG + Intronic
1051412051 9:16799922-16799944 ACAGAGAAGAAACTATGTAGAGG + Intronic
1051727158 9:20100012-20100034 AAAGAAAAAAAAAGATGAATAGG - Intergenic
1051735986 9:20199615-20199637 AAGGAGAAAAAAGTAACAATAGG + Intergenic
1051934274 9:22425866-22425888 AGAGAGAAGAAAGAAGGATTAGG - Intergenic
1052086087 9:24267652-24267674 AAAAAAAAAAAAGTATGTATAGG - Intergenic
1052216986 9:25978692-25978714 AAAGAGAAAAGAGAAAGAATGGG - Intergenic
1052225137 9:26076828-26076850 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1052260933 9:26515459-26515481 AAAGAAAAGAAAAAGTGAATGGG + Intergenic
1052283293 9:26756634-26756656 AAAGAGAAGAAAGGAAGAATGGG + Intergenic
1052402619 9:28019641-28019663 AAAAAGAATAAATTAGGAATAGG - Intronic
1052423520 9:28274220-28274242 AAAGAGAGGAGAGAATGATTAGG - Intronic
1052464271 9:28809909-28809931 AAACAGAAGAAAGAATGATGTGG - Intergenic
1053082110 9:35184845-35184867 AAAGAAAAGAAAGAAAGAAAGGG + Intronic
1053127392 9:35593513-35593535 AAAAAGAAAAAAGCATGAAAAGG + Intergenic
1053158233 9:35794660-35794682 AAAGAGAAAAAGATAGGAATGGG + Intronic
1053476978 9:38389286-38389308 AAAAAGAAAAAAGTATATATTGG + Intergenic
1053552039 9:39091920-39091942 AAGGAGGAGAAAATATAAATTGG - Intronic
1053816173 9:41912058-41912080 AAGGAGGAGAAAATATAAATTGG - Intronic
1054106433 9:61055742-61055764 AAGGAGGAGAAAATATAAATTGG - Intergenic
1054614424 9:67275383-67275405 AAGGAGGAGAAAATATAAATTGG + Intergenic
1054729934 9:68691264-68691286 AAACAGAAAAAAGTATGTCTGGG + Intergenic
1055055900 9:72023672-72023694 AAAAGAAAGAAAGAATGAATGGG + Intergenic
1055066953 9:72128952-72128974 AAAGAAAAGAAAGAAAAAATTGG - Intronic
1055111449 9:72563912-72563934 AAAAAAAAAAAAGTATAAATTGG + Intronic
1055177027 9:73332420-73332442 AAAGATAAGAATGTTTGAATGGG + Intergenic
1055379012 9:75685885-75685907 AAAGAGAAGAAAGGAAGGAAGGG + Intergenic
1055820469 9:80255657-80255679 AAAGAGTAGAACTTATGCATGGG - Intergenic
1056196056 9:84229622-84229644 AAAAAGAAGAAAATAAAAATCGG + Intergenic
1056562047 9:87739053-87739075 AAAGAAAAGAAAATATAAAAAGG + Intergenic
1057089831 9:92247217-92247239 AAAGAGAAGAGAGTAAGGAAAGG + Intronic
1057354874 9:94324686-94324708 AAAGAAAAGAAAGTAAGTATTGG + Intronic
1057652875 9:96932949-96932971 AAAGAAAAGAAAGTAAGTATTGG - Intronic
1058111139 9:101031578-101031600 AAAGATAAGAAAGTAAAAAATGG + Intronic
1058278229 9:103074788-103074810 AAAGGGCAGAAAGTCTGAAATGG - Intergenic
1058315140 9:103555435-103555457 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1058423918 9:104860120-104860142 AAAGGGAACAAAGCATGATTGGG - Intronic
1058713244 9:107699282-107699304 GAAGAGCAGAAAGTATGATGGGG + Intergenic
1058881521 9:109289448-109289470 GCAGAGAAGCAAATATGAATAGG - Intronic
1059070476 9:111130537-111130559 TAAGAGAAGGAAGTTTGGATTGG + Intergenic
1059165543 9:112073322-112073344 AAAGGGAAGAAAAGATGAAAAGG - Intronic
1059556870 9:115290085-115290107 ATAGAGAAAAAAGGATGAAAAGG + Intronic
1059560667 9:115331861-115331883 AAAGAGAAGAACCTATGCAAAGG + Intronic
1059582173 9:115563176-115563198 AAAGAAAAGAAACAATAAATTGG + Intergenic
1059676383 9:116544512-116544534 AAAAAGAGGAAAGGATGATTTGG + Intronic
1059705305 9:116817302-116817324 AAAAAGAAGAAAGAAAGAATGGG + Intronic
1059743463 9:117178142-117178164 AGAGAGAATAAAGAATGAAAGGG - Intronic
1059937736 9:119328314-119328336 AAAGAGATTAAGGCATGAATGGG + Intronic
1059947808 9:119429739-119429761 AATCAGAAGAGAATATGAATGGG + Intergenic
1060740394 9:126093993-126094015 AATGAGAACAAAGTCTGAGTTGG - Intergenic
1060866160 9:126999475-126999497 AGAGAGAAGAAGAGATGAATAGG - Intronic
1061157953 9:128876392-128876414 AAAAAGAACAAAGGATGACTGGG - Intronic
1061457574 9:130710249-130710271 AAAATGACTAAAGTATGAATGGG + Intergenic
1061794159 9:133074656-133074678 AAAGGGAAGAGAGTATGATGAGG - Intronic
1062059066 9:134484977-134484999 AAAGAAAAGAAAGAAAGAAAAGG - Intergenic
1062240197 9:135533523-135533545 AAAGAGAAGAAATTGACAATGGG + Intergenic
1062701439 9:137906981-137907003 AAAGAGAAGAGAATCTGACTGGG - Intronic
1185814810 X:3144969-3144991 AAGGAGAAGAAAGGAGGAAGAGG - Intergenic
1186253818 X:7698842-7698864 AAAGAGAAGAGTGGATGAATAGG - Intergenic
1186785101 X:12949764-12949786 AAATAGAGGAATGAATGAATGGG + Intergenic
1187077269 X:15947634-15947656 AATAAGAAGAAAGTAATAATAGG - Intergenic
1187852523 X:23605292-23605314 AAAGAAAAAAAAGTTTTAATTGG - Intergenic
1188142030 X:26562616-26562638 AAAAAGAAAAAAGTATAACTTGG - Intergenic
1188158128 X:26767297-26767319 AAAAAAAACAAAGTATCAATTGG + Intergenic
1188455121 X:30355389-30355411 ATAGAGAAAAAAGAATGAAATGG - Intergenic
1188619251 X:32199604-32199626 AAAGAAAAGAAAGAAAGTATAGG - Intronic
1188915303 X:35903548-35903570 GAAGAGAAAAAAGAATGAAAAGG - Intergenic
1189061635 X:37759681-37759703 ATAGAGAAGAAATGAGGAATGGG + Intronic
1189106257 X:38238746-38238768 AAAGAGAAGACAGCAGGAGTGGG + Intronic
1189357521 X:40322496-40322518 AATGAGATGCAAGTAAGAATGGG + Intergenic
1189387056 X:40545686-40545708 GAAGAGAAGAAAGCAAGAGTGGG - Intergenic
1189412110 X:40781600-40781622 AAAGAGAGGAAAGTGTAAAGAGG + Intergenic
1189447680 X:41095878-41095900 AAAGATAAGAAATAATGATTAGG + Intronic
1189574954 X:42342063-42342085 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1189655323 X:43239006-43239028 AAAGAGAAAGAAGGAAGAATTGG - Intergenic
1189675099 X:43453259-43453281 AAAGAGCAGAAAGTAGAATTTGG + Intergenic
1189754278 X:44254566-44254588 TTAGAGAAGAAAGAATGAAAAGG + Intronic
1190201430 X:48364928-48364950 AAAGAGAAGAGAGAATGCAATGG + Intergenic
1190307238 X:49091447-49091469 AAAGAAAAGAAAGAAGGAATTGG + Intronic
1190311184 X:49117903-49117925 AAAGAAAAGAAAATGTCAATGGG - Intronic
1190450926 X:50580004-50580026 AAAGAGATGAAAGGAAGAATGGG - Intergenic
1190523904 X:51309546-51309568 ATAGAGAAGAAAGAATGAAAAGG - Intergenic
1190668266 X:52715428-52715450 AAAGAGAAGAGAGAATGCAATGG + Intergenic
1190671151 X:52742976-52742998 AAAGAGAAGAGAGAATGCAATGG - Intergenic
1190826870 X:54025834-54025856 AAAGTCAAGAATGTGTGAATAGG - Intronic
1190925784 X:54902670-54902692 ATAGAGAGGCAAGTAGGAATTGG - Intergenic
1191823778 X:65341153-65341175 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1191974692 X:66859190-66859212 ATAGAGAAGATAGAATGAAAAGG + Intergenic
1191995581 X:67091814-67091836 AAACAGAAGAAAGTCTGCAAGGG + Intergenic
1192002254 X:67165435-67165457 AAACAATAGAAAGAATGAATAGG + Intergenic
1192288439 X:69764217-69764239 AAAAAGAATAAAAAATGAATGGG - Intronic
1192490863 X:71576419-71576441 AAAGAGGAGCAAGCATGAATGGG - Intergenic
1192494838 X:71609048-71609070 AAAGCGAAATAAGGATGAATTGG + Exonic
1192537028 X:71936848-71936870 AAAGAGGAGAAAGTAGAAAAGGG + Intergenic
1192597072 X:72422256-72422278 AAAGAGAAGAGGTTATGAAAGGG - Intronic
1192984956 X:76387976-76387998 AAAGAAAAAAAAGTAAAAATAGG - Intergenic
1193039433 X:76988796-76988818 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1193055107 X:77141756-77141778 AAAAAAAAGTAAGAATGAATAGG - Intergenic
1193061537 X:77213350-77213372 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1193094263 X:77529104-77529126 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1193099788 X:77596309-77596331 AAATATAAGAAAATCTGAATAGG - Intronic
1193246867 X:79239365-79239387 AAAGAGAGGAAAGGATAAAGAGG - Intergenic
1193286649 X:79722587-79722609 CAAGAGACAAAAATATGAATAGG + Intergenic
1193453862 X:81704641-81704663 AAAGTGAAGAGAACATGAATTGG - Intergenic
1193588103 X:83352552-83352574 AAAGAGAAGAAATTCAGATTTGG - Intergenic
1193616198 X:83690864-83690886 AAGGAGAAGAATTAATGAATGGG - Intergenic
1193736300 X:85160625-85160647 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1193752608 X:85364945-85364967 AAAGAAAAAAAAGAATGAAAAGG - Intronic
1193780658 X:85697889-85697911 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1193850809 X:86535484-86535506 AAAGGGAAGAAAGTATAATGAGG - Intronic
1193867386 X:86751730-86751752 AAAAAAAAGAAAGTATGCACAGG + Intronic
1194160310 X:90441123-90441145 AAAGAGAAGACATCAAGAATGGG + Intergenic
1194202982 X:90977823-90977845 ATAGAGAAAAAAGAATGAAAGGG - Intergenic
1194281234 X:91956952-91956974 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1194548731 X:95271128-95271150 AAAGAGAAGAAATGCTGACTAGG - Intergenic
1194632091 X:96297333-96297355 ATAAAGAAGAAAGAATGAAATGG + Intergenic
1194670798 X:96730133-96730155 AAGGAGATGAAAGAATGATTGGG + Intronic
1194690264 X:96975960-96975982 AAAGAAAAGAAATTATGTACAGG - Intronic
1195043263 X:101033272-101033294 AAAGAAAAGAAATTAGCAATTGG + Intronic
1195412440 X:104582549-104582571 AAAGAGGAGAAAGGAGGAAGGGG - Intronic
1195639945 X:107162280-107162302 AAAGAGAGGAAAGAGAGAATGGG + Intronic
1195676663 X:107512005-107512027 AAAAAAAAGAAAGTAGGAAGTGG - Intergenic
1195684523 X:107573449-107573471 AAAGACAAAAAAGTATGGAAAGG - Intronic
1195869148 X:109468081-109468103 GAAGAGAAGACAGTAGGATTGGG - Intronic
1195929326 X:110058251-110058273 AAAGAAAAAAAAGGATGAAAAGG - Intronic
1196247915 X:113422484-113422506 AGAGAGAAGAAAGCGTGCATAGG - Intergenic
1196284368 X:113862759-113862781 TTAGAGAAGAAAGAATGAAAAGG - Intergenic
1196425715 X:115566976-115566998 AAATAGAAGAAAGTATCACATGG - Intronic
1196541457 X:116913854-116913876 AAAAAAAAAAAAGTATGATTTGG - Intergenic
1196820606 X:119697431-119697453 AAAGAGAAGAAAGTTGGAGGAGG + Intergenic
1196960065 X:120991743-120991765 TTAGAGAAGAAAGAATGAAAAGG - Intergenic
1197136303 X:123064403-123064425 AATGAGTAGAAGATATGAATAGG - Intergenic
1197341532 X:125280869-125280891 CAAAAAAAGAAAATATGAATAGG - Intergenic
1197506668 X:127313585-127313607 AGAGAGAAGAAAGCATGTATAGG + Intergenic
1197790598 X:130250099-130250121 ATAGAGAAAAAAGAATGAAAAGG + Intronic
1197905147 X:131416818-131416840 GAAGAGAAAAAAGTAAGAAGGGG + Intergenic
1198005126 X:132485727-132485749 AAAGAGAAGAAACTGTGTCTGGG - Intronic
1198296116 X:135288627-135288649 AAAGAGTAAAAAGTATTCATGGG + Intronic
1198396551 X:136224857-136224879 GAATAGAAGAAATTATGAAGCGG - Exonic
1198502356 X:137264035-137264057 AAGGAGAGGGAAGGATGAATAGG + Intergenic
1198502625 X:137267114-137267136 AAAGATAATGGAGTATGAATAGG + Intergenic
1198687226 X:139239299-139239321 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1198764353 X:140065484-140065506 AAGGAGAAGAAAGTCAAAATAGG - Intergenic
1198897349 X:141470145-141470167 AAAAAAAAGAAAGAAAGAATTGG + Intergenic
1199040078 X:143102931-143102953 AAAGGCAAGAAATTATGAAAAGG + Intergenic
1199437865 X:147833348-147833370 AAATAGTAGAAAGTTTGAATAGG - Intergenic
1199478855 X:148275166-148275188 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1199589135 X:149450230-149450252 ATAGAGAAAAAAGAATGAAAAGG - Intergenic
1199841580 X:151654568-151654590 AAAGTGAAGAAAGTATTTACAGG + Intronic
1199863677 X:151824069-151824091 AAAGAGAAGAAGCTACAAATCGG + Intergenic
1200344776 X:155437035-155437057 ATAGAGAAAAAAGAATGAAAAGG + Intergenic
1200372471 X:155741296-155741318 AAAGAGAAAAAAGAATGAAAGGG + Intergenic
1200413070 Y:2880504-2880526 AAAGAGAAGAAAATGTGCATTGG + Intronic
1200506601 Y:4018071-4018093 AAAGAGAAGATATCAAGAATGGG + Intergenic
1200548818 Y:4553249-4553271 ATAGAGAAAAAAGAATGAAAGGG - Intergenic
1200598827 Y:5181616-5181638 ATAGAGAAAAAAGAATGAAAAGG - Intronic
1200635149 Y:5643014-5643036 AAAGAGAAGAAGCTTTGGATTGG - Intronic
1201309754 Y:12586172-12586194 AAAGAAATAAAAGCATGAATAGG + Intergenic
1201691767 Y:16774981-16775003 GAAGAGAAGAAAGGAGGGATGGG - Intergenic
1201800619 Y:17951033-17951055 TTAGAGAACAAAGTATGAAAAGG - Intergenic
1201800934 Y:17954923-17954945 TTAGAGAACAAAGTATGAAAAGG + Intergenic
1202349917 Y:23978400-23978422 AAAGAAAAGAAAGAAAGAAGAGG + Intergenic
1202520862 Y:25691721-25691743 AAAGAAAAGAAAGAAAGAAGAGG - Intergenic