ID: 1101369129

View in Genome Browser
Species Human (GRCh38)
Location 12:104108833-104108855
Sequence GAGAAGAAAGTATGAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101369126_1101369129 8 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369129 12:104108833-104108855 GAGAAGAAAGTATGAATTGGTGG 0: 1
1: 0
2: 3
3: 37
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101369129 Original CRISPR GAGAAGAAAGTATGAATTGG TGG Intergenic
900986892 1:6078417-6078439 GAGAAGAAAGTAGAAAAAGGAGG + Intronic
902908906 1:19580539-19580561 GAGAAAAAAGTTTGGATGGGAGG - Intergenic
903776386 1:25796791-25796813 GAGAACAAAGGATCACTTGGGGG - Intergenic
904289766 1:29477346-29477368 GAGGAGAAAGTTTGATCTGGTGG - Intergenic
904315786 1:29661694-29661716 CAGAAGAAAGTAAGAAATAGAGG - Intergenic
905116209 1:35642961-35642983 AATGAGAAAGTATAAATTGGGGG + Intergenic
906926348 1:50121439-50121461 GAAAAGAAAGTATCATTGGGTGG + Intronic
907021282 1:51068820-51068842 GAAAAGAAAGTAGGGAATGGGGG - Intergenic
908263059 1:62353601-62353623 GTGAAGAGACAATGAATTGGAGG + Intergenic
909117064 1:71550582-71550604 TGGAAGAAAGTATGAATTTGTGG - Intronic
909553199 1:76922971-76922993 AAGAAGAAAGTAAGAATAGAGGG + Intronic
909889581 1:80987284-80987306 GAGACGTAAGTATGCCTTGGAGG + Intergenic
910038563 1:82819146-82819168 GAGATGGAAGTATGTTTTGGAGG + Intergenic
910203310 1:84722605-84722627 GATAATGGAGTATGAATTGGGGG - Intergenic
910857009 1:91705989-91706011 AAGAAGAATGGATGAATTGCTGG + Intronic
911269582 1:95784304-95784326 GAGAAGAAATTGAGAATTGAGGG - Intergenic
911524745 1:98971055-98971077 GAGAACAAAGTGTGTATTGGTGG + Intronic
911685538 1:100772685-100772707 GAGAAGAAATTATAAATATGTGG - Intergenic
913089550 1:115467125-115467147 GAGAAGAAAGAAAGAAAAGGAGG + Intergenic
914801494 1:150965884-150965906 CAGTAGAAAGGATGACTTGGCGG + Exonic
914844787 1:151276638-151276660 AAGAAGAAACTAGGAATTTGAGG - Intergenic
914898898 1:151701371-151701393 GAGAAGAATCTAGGAAGTGGAGG + Intergenic
915329843 1:155104025-155104047 GAAAAGAAAGGAGGAAATGGAGG + Intergenic
915863747 1:159476172-159476194 GACAAGAAAGTCTGAAATAGAGG + Intergenic
916361623 1:163976699-163976721 AAAAAGAAAGAAAGAATTGGAGG - Intergenic
916372269 1:164111831-164111853 GAGAATAAGGGAGGAATTGGTGG + Intergenic
916418373 1:164613406-164613428 GAGAAGAGAGAATGAATTCAAGG - Intronic
916662937 1:166938804-166938826 GAGAAGCAAGAATGAACTGTGGG - Intronic
917448308 1:175125540-175125562 GAGAAGAAAGGAAGAGGTGGGGG - Intronic
918766128 1:188486270-188486292 TGGAAGAAAGTCTGAATTGAAGG - Intergenic
919110181 1:193208749-193208771 GAGAAGAAAGGAAGAATGGCAGG - Intronic
919333054 1:196195469-196195491 GAGAAGAAAGAAAGAATAGAAGG + Intergenic
919519984 1:198576111-198576133 GGGAGGAAAGTAGGAAATGGTGG - Intergenic
919546494 1:198927164-198927186 GTGAGGAAAGTATTAATAGGGGG + Intergenic
919804406 1:201372608-201372630 GAGAAGAAATTAGCAACTGGGGG - Intronic
922273895 1:224058766-224058788 TAGAAGCAAGAGTGAATTGGAGG + Intergenic
923963554 1:239109747-239109769 GAGAACTAAGTGTGAATTGTAGG + Intergenic
924377337 1:243426490-243426512 GAGAAGAAATGAAGAATTGGAGG + Exonic
924396949 1:243630645-243630667 AAAAAGCAAGAATGAATTGGAGG - Intronic
1063899206 10:10714471-10714493 GAAAAGAAAGTGTGAACTAGGGG + Intergenic
1063983304 10:11473921-11473943 GAGAAGGAAGAATGAGGTGGTGG + Intronic
1064031027 10:11882972-11882994 CAGAAGAAAGTGTGAATGTGAGG - Intergenic
1064288851 10:14015103-14015125 GAGAAGAAAGGATGAAAGGAAGG - Intronic
1064863987 10:19858671-19858693 GAGAAGAAAGTAAGCAGTGTTGG + Intronic
1065094822 10:22270095-22270117 GGGAAGAAAGTATTAATTTATGG + Intergenic
1065256957 10:23879835-23879857 GAGAAGGAAGGAAGAATTGATGG + Intronic
1066658322 10:37715042-37715064 GAGAAGGAAGAATAAATGGGAGG - Intergenic
1067350665 10:45472882-45472904 AAAAACAAAGGATGAATTGGAGG - Intronic
1069318398 10:67137018-67137040 GAGGAGCAAGTACGAAATGGTGG - Intronic
1069726961 10:70586296-70586318 GAGAAGAAGCTAAGAATAGGTGG - Intergenic
1070920468 10:80182126-80182148 GGGAGGAAAGAATGAATAGGTGG + Intronic
1070952490 10:80442375-80442397 AAGAAGAAAGAATGGATTTGGGG + Intergenic
1071217776 10:83428047-83428069 TAGAAGAAAATATGAGATGGGGG + Intergenic
1071256461 10:83876146-83876168 GCAAAGAAAGGAAGAATTGGGGG + Intergenic
1071556101 10:86602862-86602884 GGGAAGAAAAGATGAATAGGTGG + Intergenic
1071722253 10:88159101-88159123 GGGAAGAAAAGATGAATTTGAGG - Intergenic
1072075454 10:91968191-91968213 GGGAAGGAAGGATGAATAGGTGG - Intronic
1073339667 10:102735341-102735363 GAGAGGGAAGAATGACTTGGAGG - Intronic
1077482163 11:2820866-2820888 GAGAAGAAAGTATGGGATGAAGG - Intronic
1079797299 11:24821666-24821688 AAGAAGAAAGTCTGCATTGAAGG - Intronic
1079941646 11:26688053-26688075 AAGAAGAACTTATGAATTGAGGG - Intronic
1080522954 11:33083497-33083519 GATAAGAAAGTCTGAATTAGAGG + Intronic
1080814697 11:35743625-35743647 GAAAAGAAAGAATAAATTAGAGG - Intronic
1081204393 11:40258338-40258360 GAAAAACCAGTATGAATTGGAGG - Intronic
1081706887 11:45187489-45187511 GAGAAGAAAGGAGGAATAGAAGG + Intronic
1081989390 11:47329605-47329627 GAGAGGAAGGGAAGAATTGGGGG + Exonic
1083944466 11:65916363-65916385 GAGAGGAGAGTATGAATGGCAGG + Intergenic
1084023779 11:66435202-66435224 GAGAAGAGAGCAGGAGTTGGGGG - Exonic
1084163213 11:67362348-67362370 GTGAAGAAAGTAAGAAATGATGG - Intronic
1086738490 11:90337650-90337672 GAGAAAAAAATAAGAATTGTGGG + Intergenic
1088252111 11:107870053-107870075 GTGAGGAAAGTAAGAAATGGAGG - Intronic
1088671254 11:112143634-112143656 GAAAAAAGAGGATGAATTGGGGG - Exonic
1089309079 11:117545978-117546000 GAGAAGAATGGATGGATGGGAGG + Intronic
1089966864 11:122660460-122660482 GAAAAGAAAGAATGTATTGGGGG + Intronic
1090273245 11:125402429-125402451 GAGAAAAAAGGATGAATTTCAGG - Intronic
1090739557 11:129645173-129645195 GAGAGGAAACCATGAATTGCTGG + Intergenic
1090927537 11:131261662-131261684 GAGAATAAACTAGGAATAGGTGG - Intergenic
1091524241 12:1281483-1281505 CAGAAGAAAGCATAAAATGGTGG + Intronic
1093100004 12:15016538-15016560 AAGAAGAAAGTTTTAAGTGGAGG - Intergenic
1095055112 12:37589230-37589252 CAGAAGGAAGGATGAATAGGTGG - Intergenic
1095293482 12:40502754-40502776 GAGCAGAATGGAAGAATTGGGGG - Intronic
1095675070 12:44907074-44907096 GAGAAGAATGAATGAAGAGGGGG - Intronic
1095690199 12:45079941-45079963 AAGAAGAAAATAGGATTTGGAGG + Intergenic
1097473773 12:60028308-60028330 GAAAAGAAAGAAAAAATTGGAGG + Intergenic
1098101436 12:67021739-67021761 TAGGAGAAAGTATAAATGGGAGG - Intergenic
1099381272 12:81955962-81955984 GGGAAAAAAGAATGAATTGTTGG - Intergenic
1099860816 12:88223217-88223239 GAGAACAACATAAGAATTGGAGG + Intergenic
1101369129 12:104108833-104108855 GAGAAGAAAGTATGAATTGGTGG + Intergenic
1102771942 12:115485557-115485579 GAGAAGCATGGATGAATGGGGGG - Intergenic
1105325968 13:19370832-19370854 GAGAAGAAGGTTTGCAGTGGGGG + Intergenic
1105586035 13:21743538-21743560 GAGTTGAAAGAATGAATGGGTGG - Intergenic
1105734682 13:23255491-23255513 GAGAAGAATGTGAGATTTGGGGG + Intronic
1105867536 13:24474262-24474284 GAGAAGAAGGTTTGCAGTGGGGG - Intronic
1107633401 13:42366644-42366666 GACAAGAAAGTTTGAAATTGAGG - Intergenic
1107893527 13:44935498-44935520 TAGAAAAAAATATGTATTGGGGG + Intergenic
1108027315 13:46191516-46191538 GAGAGGAAAGGATAGATTGGTGG - Intronic
1108296856 13:49029670-49029692 GACAAGAAAGAATGAATTGTTGG + Intronic
1108413139 13:50170597-50170619 GAGAAGAATGGATGAACTGCAGG - Intronic
1109205315 13:59476854-59476876 GAGCAGGAAAAATGAATTGGGGG + Intergenic
1110123241 13:71909240-71909262 GAGGAGTAAGGATGATTTGGGGG - Intergenic
1110153043 13:72277848-72277870 GAGATGCAAGTAGGAATTAGGGG - Intergenic
1110369327 13:74721858-74721880 GATAAGAAAGTAGGACATGGTGG + Intergenic
1110871620 13:80458997-80459019 GAGAAGAAAGTCTCAGTTGATGG - Intergenic
1110883830 13:80607904-80607926 AAGAAGAAATTAAGAATAGGTGG - Intergenic
1110930552 13:81210864-81210886 GAGAAGAAAAGATGAATGGCTGG - Intergenic
1111188084 13:84769945-84769967 GAGAAGAAAGAATAAATTCAAGG + Intergenic
1111720108 13:91932681-91932703 GAGAAAAAGGCATGCATTGGAGG - Intronic
1111827431 13:93285223-93285245 GAGAGGAAAGTACAAATTAGTGG + Intronic
1111890975 13:94082233-94082255 GAGAGTAAAGTGTGAATTTGAGG - Intronic
1112966671 13:105205118-105205140 GTGAAGGAAGGATGAATAGGTGG + Intergenic
1113386260 13:109851118-109851140 GGGAAGAAAGCATGAAGTGCAGG + Intergenic
1113641473 13:111960523-111960545 GAGATGAATGAATGAATGGGTGG + Intergenic
1114666843 14:24382678-24382700 GAGGAAAAAGTAGGAATTTGAGG + Intergenic
1117209693 14:53482665-53482687 GATAAGAAATTATGATTTGTAGG + Intergenic
1118335547 14:64850651-64850673 GGGAAGAAAATAGGAATTGTTGG - Intronic
1118504074 14:66391650-66391672 GAGAAGACAGTATGAGATGTTGG + Intergenic
1118984487 14:70742030-70742052 GAGAAGGAAGCATGAAGTTGGGG - Intronic
1120922478 14:89767439-89767461 GAAAAGAAAGTGAGAGTTGGGGG - Intergenic
1120948921 14:90023043-90023065 GAGAATAAAGGATGAAGTGGAGG + Intronic
1122577984 14:102753860-102753882 GAGAAGAAAGTCTGGGCTGGCGG - Intergenic
1123679482 15:22748989-22749011 GAGAAAAAGGCATGCATTGGAGG - Intergenic
1124227639 15:27908350-27908372 CTCAAGAAAGTAGGAATTGGTGG + Intronic
1124331698 15:28823441-28823463 GAGAAAAAGGCATGCATTGGAGG - Intergenic
1124584131 15:30990038-30990060 GAGATGGAAGTAGGGATTGGTGG - Intronic
1125152890 15:36553444-36553466 GTGATGAAAATATGAAGTGGAGG - Intergenic
1126171268 15:45697138-45697160 GAGAAGAAAGGAAGAAGTGAAGG - Intergenic
1127134473 15:55905344-55905366 GAGAAGACACTAACAATTGGGGG + Intronic
1127193367 15:56557264-56557286 AGGAAGAAATTATGAACTGGTGG - Intergenic
1127764935 15:62176060-62176082 GAGAAGGAAGTAAGAAATGAAGG - Intergenic
1127781120 15:62317160-62317182 GAGAGGAAAGGATGTAATGGAGG + Intergenic
1127905006 15:63369992-63370014 GAGAAGTAACTATGAGTAGGCGG + Intronic
1127923680 15:63516913-63516935 GAAAAAAAAGAATAAATTGGGGG - Intronic
1128287781 15:66452378-66452400 GACAAGAAAGTATCAATAAGAGG + Intronic
1128722092 15:69957571-69957593 GAGAGGAAGGGAGGAATTGGAGG - Intergenic
1131855827 15:96593034-96593056 AAGAAGACAATATGGATTGGTGG + Intergenic
1132426157 15:101719091-101719113 GAGAACAAAGGATGAACAGGTGG + Intronic
1133096221 16:3448106-3448128 GAGAAGAAAGGATGGGTTGGAGG + Intronic
1133097797 16:3458803-3458825 GAGAAGAAAGTCGGAGCTGGGGG - Intronic
1133575925 16:7089759-7089781 GAGAAGAAAATAGAAATTGAGGG - Intronic
1134334788 16:13288413-13288435 GAGAAGAAGATAGGGATTGGGGG + Intergenic
1134801002 16:17084657-17084679 CAGATGAAAGAATGAATGGGTGG - Intergenic
1136189185 16:28605739-28605761 AAGAATAAAATATGAATTGAGGG - Exonic
1136537320 16:30907664-30907686 GAGATGAATGAATGAATCGGAGG - Intergenic
1136656460 16:31712197-31712219 GAGAAGAAAGGCTGGATTGAAGG + Intergenic
1136706553 16:32193489-32193511 GAGAAAAAGGCATGCATTGGAGG + Intergenic
1136761358 16:32735928-32735950 GAGAAAAAGGCATGCATTGGAGG - Intergenic
1136806745 16:33134458-33134480 GAGAAAAAGGCATGCATTGGAGG + Intergenic
1137866992 16:51908400-51908422 CAGAAGAAAGGATGAGTTGCAGG - Intergenic
1137956666 16:52838357-52838379 GAGAAGAAAGGATGAATGCATGG - Intergenic
1139415403 16:66804265-66804287 CAGAAAAAAGTATAAATTGAAGG - Intronic
1141257255 16:82414366-82414388 GACAAGAAAGTAGGAATAAGAGG + Intergenic
1141609838 16:85175134-85175156 GAGAAGAAAGAAAGAAGAGGAGG + Intronic
1203063512 16_KI270728v1_random:996245-996267 GAGAAAAAGGCATGCATTGGAGG - Intergenic
1143303782 17:5930072-5930094 GAGAAGAAAGGAAGAACCGGGGG - Intronic
1143872606 17:9967996-9968018 GGGAAGAAAGAATGATTTTGAGG + Intronic
1144237507 17:13275887-13275909 AAGAAGAAAGTATGAAGTAGAGG - Intergenic
1144788853 17:17846505-17846527 GGGGAGAGAGTATAAATTGGTGG + Intronic
1145025205 17:19463112-19463134 GAGAAGAATATAAGATTTGGAGG + Intergenic
1146069122 17:29663102-29663124 GAGAAGAGAGAATTGATTGGTGG - Intronic
1146231379 17:31113991-31114013 CAGAAGGAACTATGAATTTGAGG - Intronic
1146341955 17:32027188-32027210 GAGAAGAGAGGAGGAAATGGAGG + Intronic
1147894762 17:43743351-43743373 GGGAAGAAATAATAAATTGGTGG + Intergenic
1149905724 17:60525367-60525389 GATGAGAAAGTAGGAATGGGTGG + Intronic
1151386471 17:73758020-73758042 GAGAAGAAAGAAAGAAGAGGAGG - Intergenic
1151413252 17:73944995-73945017 AAGAAGAAAGAAAGAATCGGGGG - Intergenic
1152034083 17:77861323-77861345 GAGAAGAAAGAGTGGATGGGTGG + Intergenic
1152204714 17:78968358-78968380 GGGAGGAAAGGATGATTTGGGGG - Intergenic
1153261592 18:3229517-3229539 CAGAAGGTACTATGAATTGGAGG + Intergenic
1153581776 18:6581298-6581320 GGGAAGAGAGAATGGATTGGAGG - Intronic
1155212919 18:23618800-23618822 AAGAAGGAAGAATGAATTGGGGG + Intronic
1155310764 18:24520777-24520799 GAGAAGAGGGAATGAATTGGCGG - Intergenic
1156569089 18:38232494-38232516 GGGAAGAGAGTAAGAATTGGAGG - Intergenic
1159429418 18:68332253-68332275 GAGAAGATAGCATGAAATGGGGG - Intergenic
1161287430 19:3476174-3476196 TAGATGAATGGATGAATTGGAGG + Intronic
1162404016 19:10462703-10462725 GAGAAGAAAGGAGGAATTGGGGG - Intronic
1162404694 19:10466855-10466877 GGGAAGAAAGTATAAATGGGCGG - Intronic
1162616913 19:11809247-11809269 AAGGAGAAAGAATGGATTGGAGG + Intronic
1163627445 19:18398248-18398270 GAGAGGATAGAAGGAATTGGTGG + Intergenic
1163864477 19:19761100-19761122 GAAAAGAAAGAATGAAATGCTGG + Intergenic
1164735678 19:30539415-30539437 GAGATGAACGTTTGAATGGGTGG - Intronic
1167337714 19:48896853-48896875 GAAAAGAAAATAGGAATTGGGGG - Intronic
1168142008 19:54394475-54394497 GCGAAGGAAGGATGAATAGGTGG - Intergenic
1168543453 19:57231449-57231471 GAGGTGAAAGAAAGAATTGGAGG - Intronic
925637470 2:5953950-5953972 GAGAGGAAAGAATGAATAGGTGG + Intergenic
926353296 2:12016611-12016633 GAGCAGGAAGTCTGATTTGGAGG - Intergenic
926516243 2:13850555-13850577 GAAAAGACAGTGTGAATTGCTGG + Intergenic
927431735 2:23031921-23031943 TAGATGAATGTATGGATTGGTGG - Intergenic
928188301 2:29136414-29136436 GAGAAGAAATTAAAAGTTGGGGG - Intronic
928365662 2:30698910-30698932 GAGTGGGAAGTATGGATTGGAGG + Intergenic
928618805 2:33068587-33068609 GAGAAGGAAGAATGAATAGGTGG - Intronic
929052541 2:37850199-37850221 GAGCAGAAAGGGTGAATGGGAGG + Intergenic
929376751 2:41296567-41296589 GAAGAGAAAGACTGAATTGGTGG + Intergenic
931247769 2:60505573-60505595 GAGAAGGAGGTATGCATTTGAGG - Intronic
931426167 2:62173593-62173615 ATGAAGAAAGTATGTATTAGGGG + Intergenic
931515125 2:63046362-63046384 AAGAAGAAAATATTAAATGGGGG - Exonic
931792429 2:65676547-65676569 GAAAAGAAAGTAAGAATTGGGGG + Intergenic
933141806 2:78800572-78800594 CAGCAGAAATTATGAGTTGGGGG - Intergenic
933593431 2:84258701-84258723 GAGAAGACACTTTGAATTGCTGG + Intergenic
933649446 2:84838452-84838474 GAGAAGCAATTCTGAAATGGTGG - Intronic
933919332 2:87028682-87028704 GAGAAAAAAGAATGGATTAGGGG + Intergenic
934003662 2:87741225-87741247 GAGAAAAAAGAATGGATTAGGGG - Intergenic
934613964 2:95760091-95760113 CAGAAGAATGGATGGATTGGTGG + Intergenic
934646965 2:96064462-96064484 CAGAAGAATGGATGGATTGGTGG - Intergenic
934840365 2:97620525-97620547 CAGAAGAATGGATGGATTGGTGG - Intergenic
935047959 2:99498728-99498750 GGGAAGAAAGTATGATTCGTAGG + Intergenic
935501535 2:103846780-103846802 GAGAAGAAAGGGAGAATGGGAGG + Intergenic
935635213 2:105244692-105244714 GGGAAGAAAGTATGAGAAGGAGG - Intergenic
935934069 2:108162974-108162996 GAGAAGAATGAATAAAGTGGTGG - Intergenic
936998379 2:118438918-118438940 TAGATGATAATATGAATTGGAGG + Intergenic
938640524 2:133273514-133273536 GAGAAAAAAGGAAGAATAGGAGG + Intronic
939260421 2:139801279-139801301 TAGAAGAAACGATGAATTTGAGG - Intergenic
939666436 2:144957875-144957897 GAGAAGAATGTAATAATTGATGG + Intergenic
940023634 2:149181871-149181893 GAGAAGAAAGAAGAATTTGGAGG - Intronic
940606445 2:155929404-155929426 AAGAAGTAAGAAAGAATTGGTGG + Intergenic
940823677 2:158386093-158386115 GAGAACAAAGTATGTATCAGCGG + Intronic
941228915 2:162884423-162884445 GAGAAGAAAGGATGGACTTGAGG + Intergenic
942694004 2:178618098-178618120 AAGAAGAAAATATGAGTTTGGGG + Intronic
942833465 2:180264387-180264409 GAGAAATAAGTATAAATTAGAGG - Intergenic
942841431 2:180366419-180366441 GAGAAAAAAATATGAATTAAAGG - Intergenic
942889403 2:180969518-180969540 GAATAGAAAGTATTATTTGGGGG - Intronic
943670168 2:190651453-190651475 AAGAAGAAATTATAAACTGGGGG + Intronic
943993070 2:194721982-194722004 GGGAAGAAGGAATGAATAGGTGG + Intergenic
944379786 2:199094873-199094895 AAGAAGAAAGGATGAATGGGAGG + Intergenic
944597948 2:201279189-201279211 GAGAGGAAGGTATGAATCAGAGG - Intronic
945619130 2:212111361-212111383 AGGAAGAAAGTATTATTTGGAGG - Intronic
946469521 2:219945528-219945550 GAGAAAAAAGGATGAGATGGGGG - Intergenic
946514675 2:220398747-220398769 GAGAGGAAAGTATAAATAGTTGG - Intergenic
1169203166 20:3725016-3725038 GACAGGAAAGGATGAATAGGTGG + Intergenic
1169319724 20:4622441-4622463 GAGAAGAATGTATTGATTTGGGG + Intergenic
1171872428 20:30539204-30539226 GAGAAAGAAGTGTGAGTTGGAGG + Intergenic
1175638708 20:60607696-60607718 GAGATGAAAATATAAAATGGGGG - Intergenic
1175798994 20:61790309-61790331 GAGATGAAAGGATGAATGGATGG - Intronic
1177388919 21:20442139-20442161 TGGAAGAAAGGGTGAATTGGAGG - Intergenic
1177688516 21:24472028-24472050 GAGAAGGAAGTGTGGTTTGGGGG + Intergenic
1178030137 21:28516660-28516682 GACAAGAAAGAGTGAGTTGGAGG + Intergenic
1178139620 21:29668033-29668055 TAGAAGAAAATATGACTTTGGGG + Intronic
1178395235 21:32237018-32237040 GAGAGGAAAGTAGAATTTGGGGG - Intergenic
1181262655 22:21609708-21609730 AATAAGTAAGTATGAAGTGGGGG + Intronic
1181509590 22:23383096-23383118 GAGAGGAATGGAGGAATTGGAGG + Intergenic
1181519598 22:23437431-23437453 GAGAAGAAAGTATGACTGACAGG - Intergenic
1181536805 22:23550508-23550530 GAGAATGAAGAATGAATGGGAGG - Intergenic
1181888040 22:26037257-26037279 GAGAAGAAACCAAGAATTAGAGG - Intergenic
1182931800 22:34181458-34181480 TAGATTAACGTATGAATTGGTGG + Intergenic
949115084 3:310875-310897 GAGAAGAGGGAATGAATAGGAGG - Intronic
949697533 3:6716467-6716489 GAGAAGAAAGGAAGAAAGGGAGG + Intergenic
950277465 3:11674831-11674853 GAGAAGAAAGTAATAAGGGGGGG + Intronic
951215662 3:20022407-20022429 GAGAAGAAGGGATGAATAGGTGG + Intergenic
951832754 3:26949012-26949034 GAGAAGAAAGGATGGATGGAAGG + Intergenic
952156167 3:30645847-30645869 GAGATGTATGTATGAGTTGGAGG - Intronic
953328958 3:42035891-42035913 GAGAAGCAAGTAGGGTTTGGGGG - Intronic
953510999 3:43539088-43539110 GAGTGGAGAGTATGAATTGGGGG - Intronic
955490221 3:59474556-59474578 GAGAGGGAAGAATGAATAGGTGG - Intergenic
955582111 3:60434841-60434863 GAGTAGAAACTATGATTTGGTGG - Intronic
956676376 3:71736653-71736675 GAGAGGAAGGAATGAATAGGCGG + Intronic
957227042 3:77462997-77463019 AAGATGAAAGTATGAATTATTGG - Intronic
957503348 3:81086764-81086786 GAGAATAAAGTCTGATTTGCAGG + Intergenic
957974317 3:87423917-87423939 AAGAAGAAAGGATAAATTGAAGG + Intergenic
959599261 3:108160906-108160928 GAGAAGGAAGTAAAAATAGGTGG + Exonic
960081707 3:113548374-113548396 GAGAATAAAGGATGAATTAATGG - Intronic
960480000 3:118176301-118176323 TATAGGAAAGGATGAATTGGTGG + Intergenic
961222961 3:125214082-125214104 GTGAACAAAGGATGAATGGGCGG + Intergenic
961868476 3:129971735-129971757 GAGAAGAAAGGATGGAAGGGAGG + Intergenic
962342692 3:134598496-134598518 GATAAGAATATATGAATGGGAGG + Intronic
964239228 3:154572455-154572477 GAGAACAGAGTATGACATGGAGG - Intergenic
964773621 3:160252105-160252127 GAACAGAAAGAATGAATGGGTGG + Intronic
965162837 3:165156808-165156830 TACAAGGAAGTAAGAATTGGGGG + Intergenic
966606029 3:181822552-181822574 GAAAAGAATGTTTGAGTTGGTGG - Intergenic
967258828 3:187621684-187621706 TAGGATAAAGTATGACTTGGAGG - Intergenic
967308238 3:188080470-188080492 GAGAGGAAGGGATAAATTGGTGG + Intergenic
967575732 3:191089481-191089503 GAGAAAGAAGTTTGAATTGTAGG - Intergenic
967691572 3:192479988-192480010 GAGAAGAAAGAAGGATTTGGGGG + Intronic
967764792 3:193267349-193267371 GGGAAGGAAGGATGAATAGGTGG - Intronic
967767731 3:193300141-193300163 AAGAAGACAGGAAGAATTGGAGG - Intronic
972081282 4:35153498-35153520 AAGAAGAAAGTAGGAATATGAGG - Intergenic
972312760 4:37896190-37896212 GAGAAGAAAGGATGAATGGAGGG - Intronic
973529195 4:51818493-51818515 AAGAACAAAGTATGATTTGGAGG - Intergenic
973766093 4:54164330-54164352 GATAGAACAGTATGAATTGGAGG - Intronic
974059356 4:57016756-57016778 AAGAAGAGAGTATACATTGGAGG - Intronic
975176509 4:71295617-71295639 GAGAGGAAAGGAAGAAATGGAGG - Intronic
975522040 4:75311615-75311637 GAGAAGAATATAAGATTTGGTGG + Intergenic
979006019 4:115298243-115298265 CAGTAGAAACAATGAATTGGAGG - Intergenic
979407033 4:120325922-120325944 GAGAAGAAAATATGAAATCCTGG - Intergenic
980185726 4:129458658-129458680 GAGGAGAAGCTATCAATTGGAGG + Intergenic
980275619 4:130646508-130646530 GAGAGGCAAGTATGACATGGAGG + Intergenic
980466645 4:133195107-133195129 AAGAAGAAAATATGAATTAAGGG + Intronic
980748068 4:137047601-137047623 GAGAACAAAGTAGGAATTCTGGG + Intergenic
981775291 4:148360173-148360195 GATAAGAAAGTATAAAGTAGGGG - Intronic
982377135 4:154705185-154705207 GAAAAGGAAGGCTGAATTGGTGG + Intronic
982662256 4:158221344-158221366 GAGAAGACATTATGTTTTGGTGG - Intronic
983380943 4:166992823-166992845 AGGAAAAGAGTATGAATTGGGGG - Intronic
983494188 4:168424898-168424920 GAGAAGTAAGCAAAAATTGGTGG + Intronic
984080382 4:175241660-175241682 GAGAAGAAAGAATGACATGTTGG + Intergenic
984688247 4:182695683-182695705 CAGAAGCAAGTAGGTATTGGAGG + Intronic
985013079 4:185604444-185604466 GCGAAGAGAGAATGAAATGGAGG + Intronic
986488634 5:8266552-8266574 GAGATGAAAGTATTAATTTAAGG + Intergenic
986741727 5:10710794-10710816 GAGAAGCAGGTATGAAAGGGAGG + Intronic
987024056 5:13906103-13906125 GAGAGGGAAGGATGAATAGGTGG + Intronic
987318533 5:16746706-16746728 TTGCAGAAAGTATGAAATGGAGG - Intronic
987400377 5:17469525-17469547 GAGTAGACAGTATGAATTCCAGG + Intergenic
987450630 5:18079474-18079496 GAGAGGGAGGTATGAATAGGTGG - Intergenic
987516167 5:18912358-18912380 CAGAAGAAAATTTGAATTGTTGG + Intergenic
987732414 5:21792272-21792294 GATAGGAAAGTAGGAACTGGTGG - Intronic
988209860 5:28189449-28189471 GAAAAAAAAGTATTAAATGGTGG + Intergenic
988607573 5:32692825-32692847 AAGAATTAAGTATGGATTGGGGG + Intronic
988702767 5:33691889-33691911 AAGAAGAAAAAATGAATTAGTGG + Intronic
990638870 5:57760291-57760313 GAGAAGCAAGTTTGAAGTGAAGG + Intergenic
990740163 5:58904179-58904201 GAGAAGAAGGAAAGACTTGGAGG + Intergenic
991648993 5:68832362-68832384 GACAAGAAAGTGGGATTTGGTGG + Intergenic
992267380 5:75032541-75032563 GAGAAGAAAGGATGGATTTGAGG - Intergenic
992309112 5:75476605-75476627 GAGAAGCATGTGTGAATAGGTGG - Intronic
992440125 5:76790640-76790662 GAGCAGGAGGTATGAATAGGAGG + Intergenic
993394596 5:87368653-87368675 GAGAAAAAAGAATGAATTTCAGG - Intronic
995841220 5:116445077-116445099 TAGAAGGCAGTGTGAATTGGAGG + Exonic
995968464 5:117938586-117938608 GAGAAAAAAGTAAGATTTGGAGG + Intergenic
999651489 5:153772018-153772040 GACAAGAGAGAATGAAGTGGAGG + Intronic
1000277114 5:159747833-159747855 GAAAAGAAAGAAAGAACTGGGGG - Intergenic
1000540780 5:162537339-162537361 GAGAAGAAAGTATCATTGTGGGG + Intergenic
1001857929 5:175028893-175028915 GAGAAGAAAGAAAGAAAGGGAGG + Intergenic
1002621370 5:180490976-180490998 GCGAGGACAGCATGAATTGGTGG - Intergenic
1003178255 6:3770164-3770186 GAGGAGAAAGAATGAAACGGTGG - Intergenic
1003550526 6:7098671-7098693 GAGAAGAAGGCAGGAACTGGTGG - Intergenic
1003770388 6:9292490-9292512 TAGAAGAAAGTAGGAATTTCAGG - Intergenic
1004680741 6:17891987-17892009 GTGAAGAGAGTAGGAAGTGGAGG - Intronic
1004816754 6:19319347-19319369 GAGAAGAAAGAATGAAAAAGGGG - Intergenic
1004963651 6:20821922-20821944 TAGAAGAAAGTATAGATTAGAGG + Intronic
1006723214 6:36174143-36174165 GAAAAGAAAGGAAGAATGGGGGG + Intergenic
1007178950 6:39914812-39914834 GACAAAAGAGTATGAATGGGAGG + Intronic
1007299503 6:40856140-40856162 TAGAAGAATGTGTGAATAGGTGG - Intergenic
1007716619 6:43859841-43859863 AACATGAAAATATGAATTGGGGG + Intergenic
1008081478 6:47199304-47199326 GAGCATGAAGGATGAATTGGAGG - Intergenic
1008342968 6:50389763-50389785 GCACAGAAAGTATGATTTGGAGG - Intergenic
1008460306 6:51761834-51761856 GAGAAAAAAATAAGAATTTGGGG + Intronic
1008498373 6:52155467-52155489 GAGATGAATGTTTAAATTGGTGG - Intergenic
1008649577 6:53548835-53548857 GAGAAGAAAGGATGTAATGAAGG - Intronic
1008674732 6:53807406-53807428 GATAAGAAAATATGAATTTCAGG + Intronic
1008949402 6:57139066-57139088 GAGAAATATGTATAAATTGGTGG + Intronic
1009793933 6:68441699-68441721 GAGAAGTAACCATGAATTGAAGG + Intergenic
1010194180 6:73223655-73223677 CTGAAGAAAGTTTGAATTTGTGG - Exonic
1011504869 6:88030331-88030353 GTGAAGAAAGGATGAATAAGTGG - Intergenic
1012059871 6:94464845-94464867 CAGAAGAAAGAATGAATCAGAGG + Intergenic
1012836160 6:104271027-104271049 AAAGAGAAAGTATGAAGTGGTGG - Intergenic
1013451357 6:110284927-110284949 TAGAAGCAAGCATGAGTTGGTGG + Intronic
1013742112 6:113299540-113299562 GACAATAAAGTATGATTTGGGGG - Intergenic
1014210850 6:118706692-118706714 GAAAAGAAAATATGACATGGTGG - Intronic
1014272990 6:119354242-119354264 GAGAAGAAAGTATGGTTGGGAGG + Intergenic
1014419494 6:121224170-121224192 GATAAAAAAGTATGTATAGGTGG - Intronic
1015217990 6:130772237-130772259 GAGAGGAAGGGATGAATAGGTGG + Intergenic
1015352354 6:132236291-132236313 GAGAAGATACTTTAAATTGGGGG - Intergenic
1015605745 6:134953130-134953152 GAGAAAAAATTATAAATGGGAGG + Intergenic
1015927149 6:138322067-138322089 GAGAAGAACATTTGAATTGGTGG + Intronic
1017758241 6:157548210-157548232 AAGATGCAAATATGAATTGGGGG - Intronic
1018127441 6:160695385-160695407 GAGAAAAAAGAATGGATTAGGGG - Intergenic
1018463012 6:164017078-164017100 GGGGAGAAAAAATGAATTGGAGG - Intergenic
1018815451 6:167327012-167327034 GAGAAAAGAGTAGGTATTGGGGG + Intronic
1018911756 6:168104992-168105014 GAGACGAAAGGATGCATAGGTGG + Intergenic
1020544750 7:9512962-9512984 GAGAGGAAAGCATGAATAAGTGG - Intergenic
1020652535 7:10892959-10892981 AAGAAGAAAGCATGAAATAGTGG - Intergenic
1020662769 7:11002251-11002273 TAGAAGAAAGTAAAAATGGGGGG + Intronic
1021292159 7:18859434-18859456 GAGAAGAAAGAAAGAACTTGGGG - Intronic
1022658217 7:32340847-32340869 GAGAAGAAGGGATGAATAGATGG + Intergenic
1022980905 7:35604006-35604028 GAGAAACAAGGATGACTTGGAGG - Intergenic
1023836082 7:44068001-44068023 GAGAAGAAAAGAAAAATTGGAGG - Intronic
1026419642 7:70220791-70220813 GACATGAAAGAAAGAATTGGGGG - Intronic
1027539672 7:79452646-79452668 GAAAAGAAAGAAAGAATGGGAGG - Intronic
1027816450 7:82978209-82978231 GTGAAGAGAGTATACATTGGTGG - Intronic
1027940822 7:84676664-84676686 AAGAAGAAAGTGTGAAATAGAGG - Intergenic
1028073186 7:86477759-86477781 GAGTAGAAAGTAGGGATGGGGGG + Intergenic
1028464675 7:91137249-91137271 GAGAAGCATGTCTGAATTGGGGG + Intronic
1028694729 7:93695626-93695648 GAAAAGAAAGTATATAATGGGGG - Intronic
1028812898 7:95108578-95108600 GAGATTAAAGAATGAAATGGTGG + Intronic
1030612364 7:111703686-111703708 GAGAAGAATGTATTGATTTGGGG + Intergenic
1030970960 7:116054188-116054210 TAGAAGAATCTATGAATTGTGGG + Intronic
1031042369 7:116851597-116851619 AAGGAAAAAATATGAATTGGAGG + Intronic
1031066926 7:117115288-117115310 GAGAAAGAAGAATGAATAGGGGG - Intronic
1031913920 7:127544904-127544926 GAGAAGAAAGTATGCGCTGGTGG - Intergenic
1032144374 7:129365866-129365888 GAGAAGAAAGTGTTGTTTGGAGG + Intronic
1032495916 7:132362202-132362224 AAGACGGAAGTATGAACTGGAGG - Intronic
1032509286 7:132459263-132459285 AAGCAGAAAGTAAGAACTGGAGG + Intronic
1033035172 7:137868787-137868809 TAAAAGAAAGCAGGAATTGGAGG + Intergenic
1033517644 7:142124502-142124524 GAAAAGTAAGAATGATTTGGAGG - Intronic
1035154306 7:156899663-156899685 GAGATTAATGTTTGAATTGGTGG - Intergenic
1035587926 8:790094-790116 GTGGAGAAAGTAAGAATTTGAGG + Intergenic
1036075084 8:5489598-5489620 AAGATGAATGTATGATTTGGAGG + Intergenic
1037229332 8:16636286-16636308 GAGTAGAAAGAATGAAATGCAGG - Intergenic
1037611581 8:20480638-20480660 TAGATGAAAGTATGGCTTGGAGG + Intergenic
1037797047 8:22004887-22004909 AAGTAGAATGTATGAATTGATGG - Intronic
1038592336 8:28851385-28851407 CAGAAAAAAGTGAGAATTGGGGG + Intronic
1039267187 8:35838590-35838612 TAGAAGAAAGTATAATTTTGGGG + Intergenic
1039565535 8:38549692-38549714 GAGAAAAAATGATGAAATGGGGG - Intergenic
1041302981 8:56432481-56432503 TAGAAGAAAGGATGAATTCCTGG + Intergenic
1043199226 8:77342092-77342114 AAGAAGAAAGTATCACTTTGTGG + Intergenic
1044217670 8:89631745-89631767 GAGACTAAACTATGAACTGGAGG - Intergenic
1044391493 8:91657582-91657604 GGGAAGAAAGAATGAGTTTGGGG - Intergenic
1044802186 8:95968677-95968699 CAAAAGAAAGTATGAATTTAGGG - Intergenic
1044808166 8:96030140-96030162 GTGAAAAGAATATGAATTGGGGG - Intergenic
1044956815 8:97489864-97489886 GGGAAGACAGGATGAATAGGAGG + Intergenic
1045391889 8:101723752-101723774 TATAAGATAGTATGAATTTGTGG - Intronic
1046159991 8:110349316-110349338 GAGAAGAAAATGTTAAGTGGTGG - Intergenic
1046196581 8:110871686-110871708 GATAAAAAAGTATGAAATAGAGG + Intergenic
1046630703 8:116620123-116620145 GAGAAGAAAGTAGTTATTGAGGG + Intergenic
1047371543 8:124260157-124260179 CAGAAGAAAGTCTGACTTTGAGG - Intergenic
1047694286 8:127387572-127387594 GAGAAGCAAATGTGAAGTGGAGG - Intergenic
1048622284 8:136147222-136147244 GAGAAGAAACTTTGAAGAGGGGG + Intergenic
1048663074 8:136629497-136629519 AAAAAGAAAGGATGATTTGGAGG + Intergenic
1049570524 8:143368329-143368351 GAGAAGAAAGCAGGCATTGTCGG + Intergenic
1050325921 9:4496973-4496995 TAGAAGACAGTGTGAAATGGAGG + Intronic
1051173001 9:14338416-14338438 GAAAAGAAAATATGTATTTGCGG + Intronic
1052238676 9:26246031-26246053 GAGAGGAAAGGATAACTTGGTGG - Intergenic
1052283294 9:26756637-26756659 GAGAAGAAAGGAAGAATGGGTGG + Intergenic
1052446674 9:28570797-28570819 GAGAAGAAAGTCTGGATTTATGG - Intronic
1053873134 9:42514780-42514802 GAGAAGGAGGGATGAATAGGTGG - Intergenic
1054269195 9:62951972-62951994 GAGAAGGAGGGATGAATAGGTGG + Intergenic
1055111452 9:72563915-72563937 AAAAAAAAAGTATAAATTGGGGG + Intronic
1056189640 9:84172416-84172438 GAGAAGAAAGGATGAAGTGGAGG + Intergenic
1056445046 9:86657366-86657388 GAGAAGAAGGGATGAATAGGTGG - Intergenic
1056624350 9:88241863-88241885 GAGAAGAAAGGAGGAGGTGGAGG + Intergenic
1056745554 9:89298533-89298555 GAGCAGAAATTATGAATGGAAGG - Intergenic
1059322186 9:113478391-113478413 GAGAACAGACTAGGAATTGGAGG - Intronic
1059579671 9:115530749-115530771 AAGAATACATTATGAATTGGAGG + Intergenic
1060496632 9:124124224-124124246 AAGAAGAAAGTATCAGGTGGTGG + Intergenic
1060866159 9:126999472-126999494 GAGAAGAAGAGATGAATAGGTGG - Intronic
1061689126 9:132310729-132310751 GAGAAGAATCTATGAATTAGTGG - Intronic
1185814809 X:3144966-3144988 GAGAAGAAAGGAGGAAGAGGAGG - Intergenic
1185949537 X:4416193-4416215 GAGAAGAAGGGATGAATAGGTGG - Intergenic
1185984716 X:4818861-4818883 TAGATGAAAGAATGGATTGGTGG + Intergenic
1186253817 X:7698839-7698861 GAGAAGAGTGGATGAATAGGTGG - Intergenic
1186353169 X:8760901-8760923 GACAGGAAAGGATTAATTGGTGG - Intergenic
1187551430 X:20309817-20309839 GAGAAGAAAATGTGATGTGGAGG + Intergenic
1187655501 X:21467027-21467049 GGGAAAAAATAATGAATTGGGGG + Intronic
1188142029 X:26562613-26562635 AAGAAAAAAGTATAACTTGGAGG - Intergenic
1189490675 X:41469354-41469376 GGGTAGAAATTATGAATCGGTGG + Intronic
1189547747 X:42059611-42059633 GGGAGGAAGGAATGAATTGGTGG - Intergenic
1190328818 X:49223296-49223318 GAGATGAGAGTAAGAAGTGGGGG + Intronic
1190558453 X:51662581-51662603 GGGAAGAAGGGATGAATTGGTGG + Intergenic
1190724561 X:53180274-53180296 GGGAGGGAAGTATGAATAGGTGG + Intergenic
1191122698 X:56922532-56922554 GAGAAGAAAATGAGATTTGGGGG + Intergenic
1191772910 X:64782038-64782060 GAGTAGCAAGTATGGATTGCAGG + Intergenic
1192327739 X:70147480-70147502 GAGAAGAAAGGTAGAACTGGAGG + Intronic
1192431513 X:71115453-71115475 GAGAGGGAAGGATGAATAGGTGG + Intergenic
1193833322 X:86313426-86313448 AAGAAGAAAGTGTCAAGTGGAGG - Intronic
1194199911 X:90941712-90941734 GAGAAGAACATAAGATTTGGGGG + Intergenic
1194437125 X:93880769-93880791 TAGTAGGAGGTATGAATTGGAGG - Intergenic
1194849657 X:98855464-98855486 GTGCAGAAACTATGAGTTGGGGG + Intergenic
1194996732 X:100599407-100599429 TAGAAGACTGTATGAGTTGGGGG - Intronic
1196003861 X:110814629-110814651 GTGAAGAAAGTATTATATGGAGG + Intergenic
1196066543 X:111470769-111470791 GAGAAGAACATATGATTTAGAGG - Intergenic
1196247914 X:113422481-113422503 GAGAAGAAAGCGTGCATAGGAGG - Intergenic
1196416779 X:115479546-115479568 GATAATGAAGTTTGAATTGGGGG + Intergenic
1197506669 X:127313588-127313610 GAGAAGAAAGCATGTATAGGAGG + Intergenic
1199991376 X:152989493-152989515 GAGAAGAGAGGATGTGTTGGGGG - Exonic
1200545902 Y:4518128-4518150 GAGAAGAACATAAGATTTGGGGG + Intergenic
1200878007 Y:8180006-8180028 TAGAAGAAAGTCTGAATATGGGG + Intergenic
1201363092 Y:13174844-13174866 TAGAAGAAAGGATGATTTAGAGG - Intergenic