ID: 1101369130

View in Genome Browser
Species Human (GRCh38)
Location 12:104108847-104108869
Sequence AATTGGTGGCATATCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101369127_1101369130 0 Left 1101369127 12:104108824-104108846 CCTATAAAAGAGAAGAAAGTATG 0: 1
1: 0
2: 6
3: 112
4: 623
Right 1101369130 12:104108847-104108869 AATTGGTGGCATATCAGATATGG 0: 1
1: 0
2: 0
3: 15
4: 142
1101369126_1101369130 22 Left 1101369126 12:104108802-104108824 CCTAGAGATGTCAGGGTGTTTAC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1101369130 12:104108847-104108869 AATTGGTGGCATATCAGATATGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101369130 Original CRISPR AATTGGTGGCATATCAGATA TGG Intergenic
901976369 1:12947503-12947525 AATTAGTGGCTTACCAGATCTGG + Exonic
902008803 1:13254267-13254289 AATTAGTGGCTTACCAGATCTGG - Exonic
908152967 1:61323552-61323574 CATTGGTGACATTTGAGATACGG - Intronic
908605188 1:65791233-65791255 ACTTGGTAGCATCTCAGATGTGG + Intergenic
910382001 1:86637044-86637066 AATTGGTGGCATACATGATGGGG - Intergenic
912276770 1:108266543-108266565 AATAGGTGGCAGGTCAGATTTGG - Intergenic
912291460 1:108427812-108427834 AATAGGTGGCAGGTCAGATTTGG + Intronic
913276649 1:117144810-117144832 AATTTGTGGAATATAAGATGTGG + Exonic
920164257 1:204024569-204024591 AATTGGTGACTGATTAGATATGG - Intergenic
923235912 1:232032616-232032638 ACTTGGTGGCATATCTGTTATGG + Intronic
924143956 1:241054753-241054775 ATTTGCTGACAAATCAGATATGG - Intronic
924548825 1:245055008-245055030 AATGGGTGGCATCACAGAAAGGG + Intronic
1063802979 10:9602759-9602781 AATTGCTGACGTACCAGATATGG + Intergenic
1066005833 10:31145460-31145482 TATTGGTGACAAATCAGAGAAGG + Intergenic
1069325133 10:67224408-67224430 AAGTGGTGGGATTTCAGAGAAGG + Intronic
1070454970 10:76603953-76603975 ACCTGGTGTAATATCAGATAAGG + Intergenic
1073647992 10:105326332-105326354 AAATGCTGGCACATCAGAGAAGG - Intergenic
1075347337 10:121693059-121693081 AATAGCTGGCATGTCAGAAAGGG + Intergenic
1075556021 10:123433086-123433108 AATAGATGGGAAATCAGATATGG + Intergenic
1078970744 11:16408319-16408341 AAGTGCTTGCATATCAGAAAAGG + Intronic
1084001813 11:66299752-66299774 AGGTGGTGGCATGTCAGATATGG + Intergenic
1084780792 11:71407096-71407118 ACTTGCTGGCATGTCAGAGATGG + Intergenic
1085304991 11:75480734-75480756 AATAGGTGGCAGATCAGATTTGG - Intronic
1086244651 11:84737808-84737830 TATTGGGGGTAGATCAGATATGG + Intronic
1088855447 11:113746853-113746875 AATAGGAGGCAGATCAGATAAGG + Intronic
1090596516 11:128326666-128326688 AATTTATTGCATATCAGCTATGG + Intergenic
1090888987 11:130906143-130906165 AGTCAGTGGCATATCACATATGG + Intronic
1092385867 12:8035093-8035115 TACTGGTGGTATATGAGATAGGG + Intronic
1095658937 12:44705970-44705992 TAGAGGTGGCATATCACATATGG - Intronic
1099739159 12:86609489-86609511 AATTGATTGTAGATCAGATAGGG + Intronic
1101369130 12:104108847-104108869 AATTGGTGGCATATCAGATATGG + Intergenic
1103268177 12:119648492-119648514 AAACGTTGGCATATCAGAGAAGG - Intergenic
1103824087 12:123722042-123722064 AATGGGTGGAATTTCAGAAAAGG + Intronic
1104499624 12:129272453-129272475 AATTTGTGGAATTTCAGATTAGG - Intronic
1107124161 13:36827363-36827385 ATTTGCTGGCATATTAGAGAAGG + Intronic
1107615263 13:42160454-42160476 ATTTGGTGACATACCAGAGAAGG - Intronic
1108745189 13:53386318-53386340 AATTGGAGGAAAATCAGATTTGG + Intergenic
1109463658 13:62697981-62698003 ATTTGGTGTCAAATTAGATAGGG + Intergenic
1115829764 14:37324088-37324110 AATTGCTGGATTATAAGATAGGG + Intronic
1117895062 14:60475435-60475457 AATAGGTGGCAGATTAGATTTGG - Intronic
1118322569 14:64761890-64761912 CATTGGAGGCATCTCAGAAATGG - Intronic
1120530144 14:85622087-85622109 AATTGCTGTCATATCCGACATGG + Exonic
1120609406 14:86621998-86622020 ATTTGGTGGCATACTAGAAAAGG - Intergenic
1123887258 15:24738755-24738777 AGGTGGTGGCATATCACATTGGG - Intergenic
1126769926 15:52045555-52045577 ACTTGTTGGCATTTCAGAAATGG + Intronic
1127888534 15:63226362-63226384 AATTGGTTGTAAATCAGATAAGG + Intronic
1130545284 15:84852950-84852972 AATTGTTGGCAGATCCGATTAGG + Intronic
1133003144 16:2861175-2861197 CAATGGTGGCATCTCAGATGTGG + Intergenic
1133643018 16:7736001-7736023 TCTTGTTGGCAGATCAGATATGG - Intergenic
1135231250 16:20710252-20710274 CATTGGTGGAATATGAGATTTGG - Intronic
1136108760 16:28051475-28051497 AATTGGCAGCATGTCAGGTAGGG + Intronic
1146718268 17:35104368-35104390 ATTTGGAGGCATTTTAGATACGG - Intronic
1147115921 17:38299672-38299694 AATTTTTGTCATATCAGTTAGGG + Intronic
1148413757 17:47489940-47489962 AATTTTTGTCATATCAGTTAGGG - Intergenic
1155332193 18:24729742-24729764 ATTTGGTGACAGATCAGATACGG - Intergenic
1155755856 18:29494702-29494724 TATTTGTGGCATTTCTGATAGGG + Intergenic
1155873784 18:31059954-31059976 AATTTCTAGCATATCAAATAAGG - Exonic
1158180664 18:54711806-54711828 AATTGTTGCCAAATCAGCTATGG - Intergenic
1161744001 19:6043582-6043604 ATTTGGTTGCATATCATTTATGG + Intronic
927030968 2:19120062-19120084 CATTGGTTGGATATCAGATTAGG - Intergenic
927150284 2:20191658-20191680 AAGTGGTAGCACATCTGATAGGG + Intergenic
927631851 2:24781299-24781321 ATTTGGTGACATACCAGATGTGG + Intergenic
928287671 2:30007721-30007743 AATTGTTGTGATATCAGATGAGG + Intergenic
929216722 2:39422028-39422050 AGTTGGTGGCAGACTAGATACGG - Intronic
933574847 2:84055471-84055493 AATTGGCGGGACATCAGAAAGGG - Intergenic
934135160 2:88988760-88988782 AATTGCTGTCCTGTCAGATATGG - Intergenic
934235149 2:90225001-90225023 AATTGCTGTCCTGTCAGATATGG + Intergenic
937415104 2:121708360-121708382 CATGGGTGGCAAATCAGAAAAGG + Intergenic
938418252 2:131122443-131122465 AATTGATGGCATACCTGAGATGG + Intronic
940982139 2:160015706-160015728 AAATGGTGACATGTCAGCTACGG + Intronic
943854134 2:192766541-192766563 AATTGGTGACATATCAAAGTAGG + Intergenic
944182966 2:196915599-196915621 ATTTGCTGGCAGATCAGATATGG - Intronic
944993585 2:205267972-205267994 AGTTGGTGCCATATAAAATATGG - Intronic
945139920 2:206673789-206673811 CATTGGTTGCATATCAGAGGTGG + Intronic
946924506 2:224613235-224613257 AATGGGTGGAATATGAAATATGG + Intergenic
947105510 2:226664069-226664091 AATTGGTCCAACATCAGATATGG - Intergenic
1174940713 20:54923559-54923581 CATTGTTGACAAATCAGATATGG + Intergenic
1177791245 21:25724023-25724045 GATAAGTGGCATATCAGACATGG - Intronic
1180320095 22:11311927-11311949 GAATGGAGGCATATCAGACACGG + Intergenic
1183087245 22:35493909-35493931 AATGGATGGCATCTCACATAGGG + Intergenic
1183509190 22:38225171-38225193 AATTGCTGGCATCTCAGTTTCGG - Intronic
951485643 3:23206227-23206249 ACATAATGGCATATCAGATAGGG - Intronic
953148124 3:40298078-40298100 AATTGGTGACATGTAAGACATGG - Intergenic
955582590 3:60440403-60440425 AATTGTAGGCATGTCAAATAGGG + Intronic
957140615 3:76350312-76350334 AAGTGGAGACATATCAGTTATGG - Intronic
957410874 3:79838217-79838239 AATTGTTGGCATATCATATCAGG - Intergenic
958176692 3:90004421-90004443 AATTGGGTGCATATAAGAAATGG - Intergenic
958716423 3:97788218-97788240 ACATGGTGGCATATAAGCTAAGG + Intronic
960837495 3:121921846-121921868 ACTTGGTAACATTTCAGATATGG + Intronic
963059999 3:141217754-141217776 AGTGGGTGGTATTTCAGATAGGG - Intergenic
963670320 3:148243443-148243465 AACTGGTGGGATATAAGACATGG - Intergenic
965909438 3:173753453-173753475 ACTTGCTGGCAAATTAGATATGG - Intronic
965959321 3:174409753-174409775 AAATGGTAGCATATTAGAAAAGG + Intergenic
966542840 3:181110971-181110993 ACTTGGTGGCATATTGGAGATGG - Intergenic
973712830 4:53646226-53646248 AATTGGAGGCATCTCAGAGTTGG - Intronic
973723273 4:53746978-53747000 AAATGGTGACATTTCAGGTAAGG - Intronic
973991388 4:56411936-56411958 ATTTGGTGTCATCTCAGAAATGG - Intronic
977391745 4:96418625-96418647 TATTGGTGGAATATGAGGTAGGG + Intergenic
978646520 4:110939187-110939209 AATTGGTAGCATATTTCATAAGG + Intergenic
978796150 4:112709944-112709966 TATTGGTGTCATATCATTTATGG + Intergenic
980565374 4:134532593-134532615 AAATGGTACCATATCAGACAGGG + Intergenic
983775315 4:171598787-171598809 AAATGGTGGCATGTTAGATTGGG - Intergenic
984319833 4:178179972-178179994 AAATGTTTGCATATCACATAAGG + Intergenic
985177757 4:187220824-187220846 AATTTGTGGAATATCTGATTGGG - Intergenic
988080433 5:26408278-26408300 GAGTGGTGGCATATCTGATTGGG + Intergenic
989220263 5:38951586-38951608 AATTCATGGCATCTCAGATTTGG + Intronic
990083824 5:51950676-51950698 CAAAGGTAGCATATCAGATATGG - Intergenic
990734582 5:58845945-58845967 AAATGGTCTCATATGAGATATGG + Intronic
990953491 5:61321155-61321177 AAATGGTGGCAGATCAGAGTAGG - Intergenic
994794139 5:104272387-104272409 AATAGGTTGCATATCAGTGAAGG + Intergenic
997731025 5:136176112-136176134 AGTTGTTTGAATATCAGATAAGG - Intronic
999060370 5:148627448-148627470 CAGTGGTGGCATTTGAGATAAGG + Intronic
1000604275 5:163311716-163311738 ACTTGGTGCCACATCAGCTAAGG + Intergenic
1001394515 5:171406532-171406554 CATGGGTGGCAAATCAGAAAAGG - Intronic
1001742520 5:174065639-174065661 AAACGGTGGCAGATCAGATAAGG + Intronic
1003972775 6:11314918-11314940 AATTAGTGGGATACCAGAAAAGG + Intronic
1005290989 6:24378569-24378591 AATTGGTAGGACATCAGGTAAGG - Intergenic
1005352366 6:24949099-24949121 AATTGTTGTCACACCAGATATGG - Intronic
1011759028 6:90539349-90539371 TATTTGTGGCATATTAAATAGGG - Intronic
1012013283 6:93820891-93820913 AATTGGTGGCATATCATACTGGG + Intergenic
1016465944 6:144325570-144325592 AATTGGTGGCTGATCAGCGATGG - Intronic
1016588968 6:145722069-145722091 AAATGATGGAAGATCAGATACGG + Intronic
1016849158 6:148599303-148599325 AATTGGTAGGATTTCAGATAAGG + Intergenic
1023304527 7:38810795-38810817 AACAGGTGGCAGATCACATAGGG - Intronic
1023644368 7:42293799-42293821 AATTGGTTGCTTATAAGAAAGGG + Intergenic
1024478689 7:49841424-49841446 AATTGGTGGAATTTAAGGTAGGG + Intronic
1025059324 7:55791084-55791106 AAATGGTGGTATATCACAGAAGG + Intergenic
1025614931 7:63110107-63110129 AAATGGTGGTATATCACAGAAGG + Intergenic
1026124395 7:67566859-67566881 AAATGGTGACATTTCAGAGAGGG + Intergenic
1028535234 7:91884259-91884281 AATTGCTGTCATATCAGGTCTGG - Intergenic
1032542926 7:132718812-132718834 AATTGCTGGAATATAAGAAAGGG - Intronic
1036577979 8:10046418-10046440 AAGTGCTGACATTTCAGATATGG - Intergenic
1037823323 8:22146362-22146384 ACTTGGTGGCTTATGAAATATGG + Intergenic
1038336587 8:26650576-26650598 AATCGATGGCATCTCAGATACGG - Intronic
1038598403 8:28911995-28912017 AAAAGGTAGCATATCACATATGG - Intronic
1038819608 8:30940305-30940327 TCTTGGTGGCTTATCTGATAAGG + Intergenic
1041269860 8:56101039-56101061 CATGGGTGGCAAATCAGAAAAGG + Intergenic
1042007613 8:64199182-64199204 AATTGGGGGCAAATGAGACATGG + Intergenic
1042160394 8:65888229-65888251 AGTTTGTGGCTGATCAGATATGG + Intergenic
1042494470 8:69440619-69440641 TAGTGGTGGGATATCACATAAGG - Intergenic
1044246729 8:89956734-89956756 AATAAGTGGCAGATCAGATTTGG - Intronic
1044337946 8:91011127-91011149 AATGGGTGCCATAGCAGAGAGGG - Intronic
1046514627 8:115242222-115242244 ACTTGGTGACTTATCAGATCTGG + Intergenic
1051054049 9:12962495-12962517 AATTGGTGGAATTTAAAATAGGG + Intergenic
1051365916 9:16321323-16321345 AAATCGGGGCATTTCAGATAGGG + Intergenic
1059989162 9:119848274-119848296 AATTGGTAGCATTTAAGATAAGG - Intergenic
1062163780 9:135095263-135095285 GATGGATGGCATAGCAGATAGGG + Intronic
1186277047 X:7950358-7950380 AAATGGTGGCAGATAAGAGAAGG - Intergenic
1187277129 X:17826098-17826120 AAGTGGGGCCAGATCAGATAGGG - Intronic
1188857741 X:35218609-35218631 AATTGGTGTAATTTGAGATATGG + Intergenic
1188948005 X:36332254-36332276 AATTTTTGACATATCAGATAGGG - Intronic
1189089867 X:38070361-38070383 AATTGGTGACATGTCTGATATGG - Intronic
1190553231 X:51606721-51606743 AATCTGTGGCATAGCAGATTTGG + Intergenic
1194078414 X:89427139-89427161 AATATATGGCATATCATATATGG + Intergenic
1194078416 X:89427167-89427189 AATACATGGCATATCATATATGG + Intergenic
1197896980 X:131326952-131326974 ACTTACTGACATATCAGATATGG + Intronic
1199241863 X:145555992-145556014 AATAATTGGAATATCAGATAAGG + Intergenic
1199807350 X:151313397-151313419 AATGGGTGGCCTTTCAGAGAAGG + Intergenic