ID: 1101370866

View in Genome Browser
Species Human (GRCh38)
Location 12:104129026-104129048
Sequence CTTATATCACTTATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101370866_1101370869 -1 Left 1101370866 12:104129026-104129048 CCATCTTCCATAAGTGATATAAG 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1101370869 12:104129048-104129070 GCATAAGGCCAATAGCGACAAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101370866 Original CRISPR CTTATATCACTTATGGAAGA TGG (reversed) Intronic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
906137811 1:43512532-43512554 CTTGTATAACTTATGCAAGGGGG - Intergenic
906476564 1:46173205-46173227 GTTATCTCACCTATGGGAGAAGG + Intronic
907879903 1:58538894-58538916 CTAATAGCTCTTATGGAAGCAGG + Exonic
911346644 1:96704682-96704704 CCTATATTACTAAAGGAAGAAGG - Intergenic
913462997 1:119108533-119108555 CTTATATCATAAATGAAAGAAGG - Intronic
915086602 1:153393529-153393551 CTTAAATCATTTCTGGAAGAAGG + Intergenic
915799657 1:158776703-158776725 TTTATCTCCCTTCTGGAAGATGG + Exonic
916015513 1:160746284-160746306 TTAATATTTCTTATGGAAGAAGG + Intronic
918984313 1:191603437-191603459 CATATATCATATATTGAAGAAGG - Intergenic
921605429 1:217147766-217147788 CTAATATCAGTAATGAAAGAGGG + Intergenic
922870823 1:228900517-228900539 CTTTTATCACTTCAGGAAGCTGG - Intergenic
923933591 1:238732866-238732888 GTTATATTACTTGTGGAAGAGGG - Intergenic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
1064181123 10:13116700-13116722 AATATTTCACTTATGGAAGCTGG - Intronic
1064573147 10:16716539-16716561 CTCATATCATGTATGGAAGGAGG - Intronic
1065972427 10:30816187-30816209 CTTCTACCACTCATGGCAGAAGG + Intergenic
1068289115 10:54978970-54978992 ATTATAGCACTTATAGAGGAAGG - Intronic
1068396079 10:56464064-56464086 CTAATATTACCTATAGAAGAAGG + Intergenic
1071309614 10:84329762-84329784 TTTTTATCACATATGGATGACGG - Intronic
1071714564 10:88082463-88082485 CTTTAATCACTTATAGAAGGAGG + Intergenic
1074692889 10:116022555-116022577 CTCTTATCACTGATGGAAAATGG - Intergenic
1077727492 11:4689553-4689575 CTAATATCACTAATTTAAGATGG - Intronic
1085545118 11:77311118-77311140 CATATATTACTGATGGAACAGGG - Intergenic
1088052131 11:105529808-105529830 CTTATACCACATATTCAAGATGG + Intergenic
1088446314 11:109932698-109932720 ATTATTTCACATATGTAAGAGGG - Intergenic
1089901181 11:121987429-121987451 GGTATATTACTTATAGAAGAAGG - Intergenic
1090140279 11:124250935-124250957 TTGGTATCACTTTTGGAAGATGG - Intergenic
1090899543 11:131015532-131015554 ATTATATTATTAATGGAAGAAGG + Intergenic
1091111008 11:132967656-132967678 CTTAAATCAATTAAGAAAGAAGG + Intronic
1092896815 12:13020057-13020079 CTTATATAACTAATAGAAGGTGG + Intergenic
1094356396 12:29582649-29582671 CTAATATCACTTAAGGAAAGGGG - Intronic
1095453806 12:42360855-42360877 CTTTTATCACTTGTTTAAGATGG + Intronic
1095643605 12:44514676-44514698 CGTATATCCCTTGTGGAAAAAGG + Intronic
1095840575 12:46687359-46687381 CTTCTTTCACATAGGGAAGACGG + Intergenic
1098999742 12:77165455-77165477 CTAGTATCATTTATGGAATAGGG - Intergenic
1099817642 12:87669199-87669221 TGGATATCAGTTATGGAAGATGG + Intergenic
1100012503 12:89970359-89970381 CTGATATCACTTAGGTTAGAGGG + Intergenic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1102260741 12:111441907-111441929 CTAAAATCATTTTTGGAAGAAGG + Intronic
1102793749 12:115670777-115670799 GTTATATTACTAAAGGAAGAGGG - Intergenic
1107299374 13:38948901-38948923 TTTGTTTCATTTATGGAAGAAGG - Intergenic
1107568437 13:41630644-41630666 ATAATAGCACTTACGGAAGAAGG - Intronic
1109806178 13:67446714-67446736 CATATTTCACTTATGGAAGAAGG - Intergenic
1111339682 13:86867433-86867455 CTTTTATCACTTAATTAAGAAGG + Intergenic
1112897529 13:104319232-104319254 TTTATATCACTTATAGCATATGG - Intergenic
1113337599 13:109392196-109392218 CTTATTTCCCTTGTGGAAGTGGG + Intergenic
1114375633 14:22143701-22143723 CTTATATTACTTATGCCACAAGG - Intergenic
1115309376 14:31964185-31964207 CTTATATCCATTTTGGAACAAGG + Intergenic
1116266207 14:42693817-42693839 CTCATATCACTCACAGAAGAAGG + Intergenic
1127468648 15:59270100-59270122 CTTATATAACTTCTGGATCAGGG - Intronic
1127704111 15:61530403-61530425 GTTATATCACTTTTGGGAGGGGG - Intergenic
1128051083 15:64665448-64665470 CTTAAATCACTTTTTGAGGAAGG - Intronic
1129095375 15:73201024-73201046 CTAATATCAGATATGAAAGAGGG - Intronic
1131039358 15:89248276-89248298 ATGAGATCACTTATGGAAAAAGG - Intronic
1131775262 15:95788466-95788488 TTTTTATCACTTATGGTACACGG - Intergenic
1134348170 16:13411181-13411203 ATTATCTCACTTAAGGAGGAAGG - Intergenic
1138161833 16:54761680-54761702 CTAATATCCCTTAGGAAAGAAGG - Intergenic
1140913077 16:79470952-79470974 CTTATATAATGCATGGAAGATGG + Intergenic
1141354547 16:83332659-83332681 CTTATATAACTCTTGGATGATGG - Intronic
1141957398 16:87382264-87382286 ATTATATCCTTTAGGGAAGAAGG + Intronic
1142888010 17:2925223-2925245 CTTGCATCACTTTTGGAGGAAGG - Intronic
1142927122 17:3250515-3250537 AGTATAACAATTATGGAAGATGG + Intergenic
1148020777 17:44551943-44551965 CTAAGATCACCTAGGGAAGATGG - Intergenic
1148377910 17:47166456-47166478 CTTATATCAGGAATGAAAGAAGG - Intronic
1150444236 17:65216120-65216142 CTCAAATCCCTTCTGGAAGAAGG - Intronic
1150934606 17:69622016-69622038 CTAGAATCACTTATTGAAGAGGG + Intergenic
1151546107 17:74794158-74794180 CTGGAATCATTTATGGAAGATGG + Intronic
1153415037 18:4837109-4837131 ATTAGCTCAATTATGGAAGAAGG - Intergenic
1153780003 18:8486065-8486087 CTTTTAGCACTTCTGGAGGAAGG + Intergenic
1154038135 18:10826611-10826633 GTTATTTCACTGAAGGAAGATGG - Intronic
1157740500 18:50088729-50088751 TATAAATCACTTTTGGAAGATGG - Intronic
1159133204 18:64305182-64305204 CTCATATCACTGCTGTAAGATGG - Intergenic
1160095825 18:75871952-75871974 CTTAGATTCCTTTTGGAAGAAGG - Intergenic
1165909731 19:39218038-39218060 GTTATATCTCTTAGGGAATAAGG - Intergenic
1168366906 19:55796071-55796093 CTTATATCACTGGTGTAAGTTGG - Exonic
1168561074 19:57383786-57383808 CTTGTGTCACTTAAGCAAGAAGG - Intronic
927851465 2:26502685-26502707 TGAATATCTCTTATGGAAGAAGG + Intronic
927959632 2:27233031-27233053 CTTATATCCCATCTGCAAGAGGG - Exonic
927998559 2:27504212-27504234 CTTATCTCACAAAAGGAAGATGG - Intronic
931470027 2:62530286-62530308 TTTAGAGCACTTCTGGAAGATGG + Intergenic
933358198 2:81241930-81241952 TTTATATAAGTTTTGGAAGATGG + Intergenic
935245213 2:101213048-101213070 TTTATATCATTTATTAAAGATGG + Intronic
938411350 2:131067313-131067335 CTTATATCACAATTGGAAGAGGG + Intronic
938654790 2:133420074-133420096 CTAATATCTTTTAGGGAAGATGG + Intronic
939427415 2:142057274-142057296 CTTGTTTCATTTATGTAAGAAGG + Intronic
943705008 2:191025336-191025358 CTGATTCCACTTATGGAGGAAGG - Intergenic
943843393 2:192608024-192608046 CTATTACCACTTATGGAAAAGGG - Intergenic
945339905 2:208640100-208640122 CTTAAACCCCTTATGGAAGAGGG - Intronic
946349697 2:219141938-219141960 CTTATATCGCCTGGGGAAGATGG - Intronic
947896146 2:233674564-233674586 TTTATATCACCTATGATAGAGGG + Intronic
1169238784 20:3956422-3956444 CTAATATCACTAATGAAAAAGGG - Intronic
1170163552 20:13340183-13340205 CTTATATCAAGGAAGGAAGATGG - Intergenic
1170300853 20:14882933-14882955 CTTTTATGGCTTATGTAAGAGGG - Intronic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1179310363 21:40190088-40190110 CTGCTATAAGTTATGGAAGAAGG - Intronic
1181964900 22:26649601-26649623 CTTTTATCTCTTATGGTTGAAGG - Intergenic
1184848312 22:47102534-47102556 CTCATATCATCTATGGAAAATGG - Intronic
949204719 3:1424135-1424157 CTTGAATCCCTTATGGAAGTAGG + Intergenic
949273180 3:2245036-2245058 ATTGTATCTATTATGGAAGACGG - Intronic
951416327 3:22426801-22426823 GTTCTATCACTTATGGAGCAAGG - Intergenic
956019346 3:64916880-64916902 CTAATAACACCTATAGAAGAGGG + Intergenic
957843173 3:85697827-85697849 ATTATAACACTTATGTAAGCGGG + Intronic
959216624 3:103458204-103458226 GTTATTTCAATTATGTAAGAAGG + Intergenic
959759467 3:109942545-109942567 CATATATCACGTATGGAAGTTGG + Intergenic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961324330 3:126101360-126101382 GTTATATGACTTAAGAAAGAAGG + Intronic
961934851 3:130572152-130572174 CTTATTTCAATTGTGGCAGAAGG + Intronic
962106360 3:132394596-132394618 ATTACATCACTTATCAAAGATGG + Intergenic
966052491 3:175637646-175637668 CTTCTTCCACTCATGGAAGAAGG - Intronic
966121636 3:176528258-176528280 CTTTTTTGACTTATGGCAGAAGG + Intergenic
966185376 3:177222144-177222166 CTGAAATGAGTTATGGAAGAAGG + Intergenic
967019988 3:185514285-185514307 CTTATATCTTTTATAGAACAAGG + Intronic
970492315 4:16586812-16586834 CTTATATCAATTAAGGAAGAAGG - Intronic
970589906 4:17550486-17550508 CTTAAATCTCTTCTGGAATAAGG + Intergenic
974071649 4:57129472-57129494 CTTAACTGACTTGTGGAAGATGG + Intergenic
974477184 4:62398435-62398457 CTGCTTTCACTTATGGTAGAAGG + Intergenic
977449502 4:97176820-97176842 CTGCTTTCACTCATGGAAGAGGG + Intergenic
978231918 4:106410120-106410142 ATCATTTCTCTTATGGAAGAGGG - Intergenic
978467520 4:109024890-109024912 CACATATCACTTTTGGAAGTAGG + Intronic
979836246 4:125371511-125371533 CTTATAGCACTTATAGCAGATGG - Intronic
979884437 4:126008089-126008111 CTTAAATCACTGATTTAAGAAGG - Intergenic
985284101 4:188317126-188317148 ATTATATAATTAATGGAAGAGGG - Intergenic
985323681 4:188742994-188743016 CTTAGATCACTTCATGAAGATGG - Intergenic
986583821 5:9293998-9294020 CTTATACCACTATTGGCAGAGGG - Intronic
986998384 5:13633426-13633448 CTTCTATCACTTTTGGTTGAGGG - Intergenic
989179340 5:38560920-38560942 CTTAAGTCCCTTTTGGAAGAAGG - Intronic
990614726 5:57495831-57495853 CTTTTATCCCTTAGGCAAGAGGG + Intergenic
990928016 5:61051731-61051753 CTTACATCCTTTCTGGAAGAAGG - Intronic
992387922 5:76303585-76303607 CTTCTATTCCTTATGGCAGAGGG - Intronic
993112443 5:83674943-83674965 ATTATATCACATAAAGAAGATGG + Intronic
993643169 5:90430985-90431007 TTTATCTTACTTATGGAGGAAGG + Intergenic
994151550 5:96453087-96453109 TTTATTTCAGTTAAGGAAGAAGG + Intergenic
994578712 5:101612255-101612277 TTTGTATCACTTATACAAGAAGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996337771 5:122403487-122403509 CTTCTGCCACTTGTGGAAGATGG - Intronic
997092693 5:130876044-130876066 CTTTTAACACTTATAGATGAGGG - Intergenic
999668438 5:153937027-153937049 CTCAAACCACTTATGGGAGAGGG + Intergenic
1001868962 5:175133649-175133671 CTTCTGTCATTTATGTAAGATGG - Intergenic
1003337365 6:5186454-5186476 CTAGTATCATTTATGGAATAAGG - Intronic
1003750896 6:9054599-9054621 GTTATCTCACTGGTGGAAGATGG + Intergenic
1003852422 6:10238881-10238903 ATTAGATAACTTATTGAAGAAGG + Intergenic
1004355074 6:14923541-14923563 CTTAAATCACAAAGGGAAGAAGG + Intergenic
1004533479 6:16476821-16476843 CTTATTTCAGCTATGGTAGAAGG + Intronic
1004841498 6:19591159-19591181 CTCATATCTCTTATAAAAGATGG - Intergenic
1006858057 6:37149806-37149828 TTTATATCACTTAAGGAAAAAGG - Intergenic
1008161890 6:48088124-48088146 CTTATAAAACTTATGGGAAATGG - Intergenic
1012695950 6:102383843-102383865 CCTGTCTCACTTATGGAGGATGG + Intergenic
1012856931 6:104513238-104513260 CTTATGTCACTTATGTCACAGGG + Intergenic
1014007152 6:116432744-116432766 CATATATCATTTTTGGAATAGGG - Intronic
1014392503 6:120880416-120880438 CTAATATCAGTAATGAAAGAGGG + Intergenic
1014657096 6:124120512-124120534 TTTTTATCATTTATGGAAGAGGG - Intronic
1016846239 6:148571087-148571109 CTCGTGTCCCTTATGGAAGAAGG - Intergenic
1018780797 6:167063592-167063614 CTTATGTCACTAAAGGAAAAAGG + Intergenic
1018791105 6:167148406-167148428 CTTGTATGACTTTTGGAAGCAGG + Intronic
1020585915 7:10067163-10067185 GTAATATCACTAACGGAAGAGGG + Intergenic
1020699237 7:11457629-11457651 CTCATACCACTTATCGAACAAGG + Intronic
1020868353 7:13594382-13594404 CTTTTATCATTTATGAGAGAGGG + Intergenic
1022381079 7:29860481-29860503 CTGATTCCACTTATGGTAGAAGG - Intronic
1022650387 7:32268504-32268526 CTTAAATCTCTTTTGGAACAAGG - Intronic
1023760058 7:43456962-43456984 CATATATCAATTATGGAATCAGG - Intronic
1026177710 7:68012593-68012615 CTTATATTACTCAAAGAAGAAGG + Intergenic
1027876120 7:83770990-83771012 CTTATATCTCTTTTCAAAGAGGG - Intergenic
1027997650 7:85446196-85446218 CTTATAGCAGTTATGGGAAATGG - Intergenic
1028752591 7:94396958-94396980 CTTATAACAATTATGGCAAAAGG + Intronic
1029860964 7:103571619-103571641 ATTATATTACTTATGGCAAAAGG + Intronic
1030707205 7:112705837-112705859 CTAATATCAGATATGAAAGAGGG + Intergenic
1033985010 7:147214534-147214556 ATTATATCTCTTATTAAAGATGG + Intronic
1035003540 7:155637228-155637250 CTTATCTCACTTATGGAAAAAGG - Intronic
1038113035 8:24521419-24521441 CTTATATCAGCTTAGGAAGAAGG + Intronic
1038598373 8:28911756-28911778 CTCAAATCACTTATGTAAAATGG - Intronic
1040649537 8:49432869-49432891 CTTATCTTTCTTAAGGAAGAAGG - Intergenic
1042788947 8:72581961-72581983 CTTCTACCACTGATGGCAGATGG + Intronic
1043415596 8:80045354-80045376 ATCATATCAGTTATGGTAGAAGG - Intronic
1044048587 8:87470259-87470281 CTTATTTCTCTTCTGGAATATGG - Intronic
1044104394 8:88184827-88184849 CTAATTTCACTTATAGAAAAAGG + Intronic
1044183852 8:89228306-89228328 CTTATTTTTCTTATGGTAGAAGG - Intergenic
1047849398 8:128840273-128840295 TTTATATCTCCTATGCAAGAAGG - Intergenic
1047876460 8:129143323-129143345 TTTAGATCAGTTTTGGAAGATGG - Intergenic
1048025305 8:130581165-130581187 CTAATACCACTTATTGAAGAAGG + Intergenic
1048751328 8:137679675-137679697 CTTAGATCACTTATGCAACAGGG + Intergenic
1050368124 9:4891472-4891494 CTTAGATCACCCATGAAAGAAGG - Intergenic
1051103233 9:13547147-13547169 CTTATAACATTTCTGGAAGTCGG - Intergenic
1055859678 9:80732969-80732991 CTTATCTCACCTATGGCAGCAGG - Intergenic
1056750858 9:89350130-89350152 CTTGTATTAATGATGGAAGAGGG + Intronic
1058711136 9:107680310-107680332 CTTGTATGACCTTTGGAAGATGG + Intergenic
1059972768 9:119684513-119684535 CCTACATCACTTATAGACGATGG + Intergenic
1062706170 9:137944705-137944727 TTTATATCAGTTATAGAAAAGGG + Intronic
1187055277 X:15736722-15736744 CTCAAATCATTTGTGGAAGAAGG + Intronic
1187864883 X:23715015-23715037 CTTGTATCATTTATTGAGGAGGG - Intronic
1188391474 X:29625885-29625907 ATTATAACTCTTATGTAAGAAGG + Intronic
1188444146 X:30239295-30239317 CTTATATCACTCCTGGGACAGGG + Intergenic
1197689794 X:129485856-129485878 CTGCTTTCACTTATGGCAGAAGG - Intronic
1199391945 X:147290541-147290563 TTTATATCACTTTTTGAAAAGGG - Intergenic
1200341840 X:155405603-155405625 CTTCTATCAGTTACTGAAGAAGG - Intergenic
1202087357 Y:21153038-21153060 CTCATATCTCTCATGGCAGAGGG - Intergenic