ID: 1101375629

View in Genome Browser
Species Human (GRCh38)
Location 12:104168946-104168968
Sequence TGGCCAACCAAACTTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101375624_1101375629 5 Left 1101375624 12:104168918-104168940 CCAGATCCTGTCGGTTCTGACCA No data
Right 1101375629 12:104168946-104168968 TGGCCAACCAAACTTGGAGCTGG No data
1101375620_1101375629 29 Left 1101375620 12:104168894-104168916 CCCATCTCATGGAATTTCTGTAG No data
Right 1101375629 12:104168946-104168968 TGGCCAACCAAACTTGGAGCTGG No data
1101375621_1101375629 28 Left 1101375621 12:104168895-104168917 CCATCTCATGGAATTTCTGTAGG No data
Right 1101375629 12:104168946-104168968 TGGCCAACCAAACTTGGAGCTGG No data
1101375625_1101375629 -1 Left 1101375625 12:104168924-104168946 CCTGTCGGTTCTGACCAAAGTGT No data
Right 1101375629 12:104168946-104168968 TGGCCAACCAAACTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101375629 Original CRISPR TGGCCAACCAAACTTGGAGC TGG Intergenic
No off target data available for this crispr