ID: 1101377649

View in Genome Browser
Species Human (GRCh38)
Location 12:104184660-104184682
Sequence GCCTGAAGTCAGCCTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377649_1101377657 5 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377657 12:104184688-104184710 TGGATCCAGGGGCTCAGAATTGG No data
1101377649_1101377662 11 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377662 12:104184694-104184716 CAGGGGCTCAGAATTGGTGGGGG No data
1101377649_1101377665 16 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377665 12:104184699-104184721 GCTCAGAATTGGTGGGGGAGGGG No data
1101377649_1101377656 -6 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377656 12:104184677-104184699 TCAGGCATGGCTGGATCCAGGGG No data
1101377649_1101377655 -7 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377655 12:104184676-104184698 TTCAGGCATGGCTGGATCCAGGG 0: 17
1: 76
2: 133
3: 222
4: 482
1101377649_1101377664 15 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377664 12:104184698-104184720 GGCTCAGAATTGGTGGGGGAGGG No data
1101377649_1101377654 -8 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377654 12:104184675-104184697 CTTCAGGCATGGCTGGATCCAGG 0: 47
1: 165
2: 296
3: 460
4: 728
1101377649_1101377659 9 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377659 12:104184692-104184714 TCCAGGGGCTCAGAATTGGTGGG No data
1101377649_1101377661 10 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377661 12:104184693-104184715 CCAGGGGCTCAGAATTGGTGGGG No data
1101377649_1101377663 14 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377663 12:104184697-104184719 GGGCTCAGAATTGGTGGGGGAGG No data
1101377649_1101377658 8 Left 1101377649 12:104184660-104184682 CCCACCACAGGCTGACTTCAGGC No data
Right 1101377658 12:104184691-104184713 ATCCAGGGGCTCAGAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377649 Original CRISPR GCCTGAAGTCAGCCTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr