ID: 1101377725

View in Genome Browser
Species Human (GRCh38)
Location 12:104185161-104185183
Sequence CACTATTAACATTTGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377725_1101377730 14 Left 1101377725 12:104185161-104185183 CCTGATCCCAAATGTTAATAGTG No data
Right 1101377730 12:104185198-104185220 CCCTGATGCAGATGAAGAAAAGG No data
1101377725_1101377732 15 Left 1101377725 12:104185161-104185183 CCTGATCCCAAATGTTAATAGTG No data
Right 1101377732 12:104185199-104185221 CCTGATGCAGATGAAGAAAAGGG No data
1101377725_1101377734 25 Left 1101377725 12:104185161-104185183 CCTGATCCCAAATGTTAATAGTG No data
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data
1101377725_1101377733 16 Left 1101377725 12:104185161-104185183 CCTGATCCCAAATGTTAATAGTG No data
Right 1101377733 12:104185200-104185222 CTGATGCAGATGAAGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377725 Original CRISPR CACTATTAACATTTGGGATC AGG (reversed) Intergenic
No off target data available for this crispr